ID: 1155163262

View in Genome Browser
Species Human (GRCh38)
Location 18:23212548-23212570
Sequence GCAGCCCTGCCCTCCCATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155163256_1155163262 25 Left 1155163256 18:23212500-23212522 CCAAAAGTGCCAAAAGCCGAAAG 0: 1
1: 0
2: 0
3: 4
4: 116
Right 1155163262 18:23212548-23212570 GCAGCCCTGCCCTCCCATGACGG 0: 1
1: 0
2: 1
3: 25
4: 260
1155163259_1155163262 9 Left 1155163259 18:23212516-23212538 CCGAAAGTGGCTTTTGATTGCAT 0: 1
1: 0
2: 0
3: 16
4: 215
Right 1155163262 18:23212548-23212570 GCAGCCCTGCCCTCCCATGACGG 0: 1
1: 0
2: 1
3: 25
4: 260
1155163258_1155163262 16 Left 1155163258 18:23212509-23212531 CCAAAAGCCGAAAGTGGCTTTTG 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1155163262 18:23212548-23212570 GCAGCCCTGCCCTCCCATGACGG 0: 1
1: 0
2: 1
3: 25
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155163262 Original CRISPR GCAGCCCTGCCCTCCCATGA CGG Intronic
900131622 1:1089645-1089667 GGGGTCCAGCCCTCCCATGATGG - Intronic
900149860 1:1173643-1173665 TCCGCCCGGCCCTCCCAGGATGG - Intergenic
900301013 1:1977390-1977412 GCAGCCTTCCCCTCCCTCGAAGG + Intronic
900592790 1:3467437-3467459 GCAGCCCAGTCCTCCCAGGGAGG + Intronic
900880804 1:5380025-5380047 CCTCCCCTGCCTTCCCATGAAGG + Intergenic
901804441 1:11729304-11729326 ACAGCCCTGGCCTCCATTGACGG + Intergenic
901828946 1:11880458-11880480 GCAGCCCTGCCCACCCCTAGTGG - Intergenic
902830274 1:19007979-19008001 GGACCCCTGCCCACCCATGGAGG + Intergenic
903049342 1:20589247-20589269 GCTGCCCTGCTCACCCAGGAGGG + Exonic
903282689 1:22259018-22259040 GGAGTCCTGCCCTGCCATGCTGG + Intergenic
904449192 1:30600211-30600233 GTGGCCCTGCCCTCTGATGATGG - Intergenic
904744322 1:32702083-32702105 TCAGCCGTGCCCTGCCAGGAGGG + Intronic
905226615 1:36483011-36483033 GCAGCCCCTTCCTCCCAGGAAGG + Exonic
905917967 1:41699006-41699028 GCTGGCCTGACCTCCCATTAAGG + Intronic
906543076 1:46603165-46603187 CCAGCCCAGCCCTCTAATGAAGG + Intronic
908115395 1:60935263-60935285 GGAGCCCTGGCCTCCCATTCAGG + Intronic
911539960 1:99146434-99146456 GGAGCCCTGCCCTCCTCGGAAGG + Intergenic
915571381 1:156747054-156747076 CCAGCCCTTCCCCCCCAGGAAGG + Intronic
919811577 1:201412169-201412191 GCAGCCCTGCACTCCAAATAGGG - Intronic
920033111 1:203049005-203049027 GCAACCCGGCCCTCCCAGGCTGG - Intronic
920549033 1:206842837-206842859 GCAGCCCTTTACTCCCAGGATGG - Exonic
922751825 1:228073648-228073670 CCAGCCTTGCCCTCCCATGGTGG + Intergenic
923029415 1:230235504-230235526 GCATCCCTGCTGTCCCAGGAAGG + Intronic
1064903044 10:20315156-20315178 GCTTCCATGCCCTCCCATGGTGG + Intergenic
1069554744 10:69390324-69390346 GCGGGCCTGACCTCCCAGGAGGG - Intronic
1069821538 10:71231512-71231534 ACAGCCCTGCGCTCCCAGGCTGG - Intronic
1070808061 10:79282455-79282477 GCAGCCCCGCCCTGCCCCGAGGG + Intronic
1070959158 10:80486883-80486905 GTAGCCCAACCCTCCCCTGAAGG + Intronic
1071565847 10:86670939-86670961 ACAGCCCTGCCATCCCACCAGGG + Intronic
1071600905 10:86958328-86958350 ACTGCCCTGCCCACCCATGGGGG - Intronic
1077404634 11:2377545-2377567 GCAGCCCTCCACTCCCATGGCGG - Exonic
1077434308 11:2531434-2531456 GCAGCCCTGCCCAGGCAGGAGGG + Intronic
1077551103 11:3200670-3200692 TCAGCCCTGCCCTACCCTCAAGG - Intergenic
1077843204 11:5997184-5997206 GTAGCCCTGCTTTCCCATGGGGG - Intergenic
1078185834 11:9051426-9051448 TCAGCCCTGTCCTCCCACGACGG - Intronic
1080204446 11:29712878-29712900 CCAGCCCTGCCCTGCCCTGCAGG - Intergenic
1080409796 11:32012682-32012704 GCAGCCCTGGCTTCACATAAGGG + Intronic
1080517348 11:33036765-33036787 GCAGTTCTGCCTTCCCCTGAAGG - Intergenic
1081579120 11:44339898-44339920 GCAGCCCAGACCTTCCAAGAAGG - Intergenic
1083596197 11:63919233-63919255 GCACCCTTGCCCCTCCATGAGGG - Intergenic
1084329542 11:68422687-68422709 GCTGCCCTGCCTTCCCAAGAGGG + Intronic
1089640744 11:119845648-119845670 ACAGCCCTGTCTTCCCAGGATGG - Intergenic
1090184170 11:124725445-124725467 CCAGGCCTGCCCTGCCAGGAAGG + Intergenic
1091116040 11:133014482-133014504 GCTGCCCTGCCCTTCCTTCATGG - Intronic
1091356620 11:134942401-134942423 GCAGCGCGGCCCTCCCAGCAGGG + Intergenic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1092714162 12:11371129-11371151 GCAGCCCTGCTCTCTTCTGATGG + Intronic
1093881184 12:24406107-24406129 GCAGCCTCTCCCGCCCATGAAGG + Intergenic
1094447345 12:30546137-30546159 CCAGCCCTGCCCTCACCTGATGG - Intergenic
1096718577 12:53505299-53505321 GGAGCCCTGCCCTGGCATGGAGG - Intronic
1097848574 12:64390220-64390242 GCAGCCCTCCCCGCGCAGGAGGG + Intronic
1098977970 12:76923572-76923594 GCACCACTGCCCTCCCGTGTGGG - Intergenic
1099687439 12:85908029-85908051 CTAGCCCTGCCCTCACCTGATGG - Intergenic
1100680756 12:96917324-96917346 GCAGTCCTGGTCTCCCATCAGGG - Intronic
1101615295 12:106330420-106330442 CCCGCCCTGCCCTGCCAGGATGG - Intronic
1103358953 12:120342490-120342512 GCAGCCCTGCCCTCCTCTCCAGG + Exonic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104095141 12:125550228-125550250 GCAGCCATACCCACTCATGAGGG + Intronic
1104535135 12:129611668-129611690 CCATTCCTGTCCTCCCATGATGG - Intronic
1104804772 12:131578645-131578667 CCAGCCCAGCCCTCCCGTGCTGG - Intergenic
1104867076 12:131962123-131962145 ACAGCTCTTCCTTCCCATGAAGG - Intronic
1105896137 13:24718637-24718659 CCAGCCCTGCCTTCCCATGCCGG - Intergenic
1114557884 14:23572075-23572097 GCTGCCCTGGCCTGCCAGGAAGG - Intronic
1115499648 14:34037956-34037978 GCAGGCCCTTCCTCCCATGATGG + Intronic
1118326384 14:64784269-64784291 GCAGAGCTGGCTTCCCATGAAGG - Exonic
1118860857 14:69661877-69661899 GCAGCCTTGACCTCCCAGGCTGG + Intronic
1119728623 14:76937336-76937358 GCAGCTCTGCCTGCCCCTGAAGG + Intergenic
1121459871 14:94066368-94066390 GTAGACCTGCCCCCACATGATGG + Intronic
1122310097 14:100788940-100788962 ACAGAGCTGCCCTCCCGTGATGG + Intergenic
1122350455 14:101086998-101087020 GCAGCCCTCTCTTCCCATGTAGG + Intergenic
1122799823 14:104223942-104223964 GCAGCCGGGCCCTCCCAGGAGGG - Intergenic
1122809537 14:104281200-104281222 CCAGCCCCGCCATCCCATGCTGG - Intergenic
1123935801 15:25193541-25193563 GCAGCCCTGGCTCCCCATGTAGG + Intergenic
1124355391 15:28991521-28991543 GCAGCCCAGCCAGCCCACGAAGG + Intronic
1125200340 15:37096806-37096828 CCAGCCCTGACCTCCCAAGAAGG + Intronic
1125723304 15:41855457-41855479 GCAGCCCTGCCTTTCCAGGCTGG + Intronic
1127332825 15:57955412-57955434 GCAGCCCAGCCTTCCTCTGAGGG + Intronic
1129516722 15:76161670-76161692 GCAGCACTGCCCTCCCAGAAGGG + Intronic
1132706535 16:1245938-1245960 ACAGCCCTCCCCTCTCATGGAGG - Intergenic
1132759609 16:1502348-1502370 GCAGCCCTGCGGGCCCTTGAGGG + Exonic
1133102182 16:3486289-3486311 CCTGCCCTGCCCTCCGATGCAGG + Exonic
1133758075 16:8777331-8777353 GCAGCACTGCCCTCCCCTGCTGG + Intronic
1133978516 16:10617276-10617298 TCAGCCCTCCCCTCCCATCAAGG + Intergenic
1134831036 16:17323053-17323075 GCAGCCCTGACCTGCCATGGAGG - Intronic
1135521802 16:23183310-23183332 GCAGCCCTGCCCTCCCTGCGCGG - Intronic
1136066933 16:27765597-27765619 GTAGCCCTTCCTTCCCATGCTGG - Intronic
1136620774 16:31427302-31427324 GCAGCCCTGGGCTCCCATGGGGG + Intergenic
1138552318 16:57754560-57754582 GTACCCCTGCCCTCCCCTCAGGG + Intronic
1139972929 16:70787433-70787455 GCAGCCCCTCCCTCCCATGAGGG - Intronic
1140348572 16:74239309-74239331 GCATCCCTGCCCTCACCTGTTGG + Intergenic
1141153322 16:81579612-81579634 CCAGCCCTGCTCCCCCCTGAAGG + Intronic
1141157952 16:81610125-81610147 GCAGCCCTGGCCTCCAAAGGAGG + Intronic
1141437028 16:84005729-84005751 ACAGCCCCTCCCTCCCAGGATGG - Intergenic
1141707314 16:85674096-85674118 GCAGCCCTGGCCTCTGGTGAGGG - Exonic
1142123644 16:88399539-88399561 CCAGCCTGGCCCTCCCATGAAGG - Intergenic
1142622017 17:1171318-1171340 GCAGCCCTTCAATCCCACGAAGG + Intronic
1143517362 17:7426619-7426641 GCGGGCCTGCCCTCCAATGTGGG + Exonic
1143539064 17:7558757-7558779 GCAGCCCTGTCCTTCCTAGAGGG + Exonic
1144855068 17:18262968-18262990 GGTGCCCTGGGCTCCCATGAAGG - Intronic
1145317899 17:21745728-21745750 GCAGCCCTGCTCTCCCGGCAGGG + Intergenic
1145749373 17:27344268-27344290 GGAGCCTTGCCCTCCCATCCTGG + Intergenic
1146308110 17:31746156-31746178 CCAGCCCTGGCCTCCAAGGAAGG + Intergenic
1146648241 17:34589747-34589769 GGAGCCCTGCCACCGCATGACGG + Intronic
1147689068 17:42304443-42304465 GCAGACCTGCCCTCCGAGGGTGG - Intronic
1149368112 17:55965867-55965889 GCAGCACTGCTGTACCATGAAGG - Intergenic
1151966365 17:77433770-77433792 GCACCCCTGCCCTCCCCTCCTGG + Intronic
1152735750 17:81996059-81996081 GCAGCACTGCCCTTACCTGATGG - Exonic
1152885002 17:82844554-82844576 GAAGCCCAGCCCTCCCCTGGAGG - Intronic
1153168971 18:2293430-2293452 CCAGCCCTGCCCCCACCTGATGG - Intergenic
1154498037 18:14976901-14976923 GCAGCGCGGCCCTCCCAGCAGGG - Intergenic
1155163262 18:23212548-23212570 GCAGCCCTGCCCTCCCATGACGG + Intronic
1155402867 18:25458030-25458052 TCAGCCATTCCCTCCCATGGTGG - Intergenic
1157684157 18:49629380-49629402 GCAGCCCTGGCCTCTCCTGCAGG - Intergenic
1158592577 18:58790107-58790129 CCAGCTCTCCCCTCCCAAGAAGG - Intergenic
1158683311 18:59589076-59589098 ACAGCCATGCCCTTCCAGGAAGG + Intronic
1160441231 18:78894440-78894462 GCTGCCAGGACCTCCCATGAGGG - Intergenic
1160791379 19:925308-925330 GCAGCCCGTCCCTCCCCAGAGGG + Intergenic
1160866120 19:1256877-1256899 ACAGTCCTGCCCTCCCTGGAGGG - Intronic
1162115924 19:8429268-8429290 GGGCCCCTGCCCTCCCATGCTGG - Intronic
1162294895 19:9806680-9806702 TCAGGACTGCCCTCCAATGAAGG - Intergenic
1163886649 19:19971356-19971378 CCAACCCTGCCCTCACCTGATGG - Intergenic
1164157295 19:22604366-22604388 TCACCTCTGCCCTCCCATTATGG - Intergenic
1164598290 19:29544714-29544736 GCAGCCCTGGGCTCCCCAGAGGG + Intronic
1164876438 19:31693976-31693998 ACATCCCTGAGCTCCCATGAGGG + Intergenic
1165335962 19:35169783-35169805 CCAACCCTGCCCGCCCCTGAAGG + Exonic
1166181414 19:41111893-41111915 GCAGCCCCCACCACCCATGAAGG + Intergenic
1167404916 19:49300056-49300078 GCATCCTGGCCCTTCCATGAGGG - Intronic
925876529 2:8316012-8316034 CCAGCCCAGCCTTCCCATGCTGG - Intergenic
925942641 2:8835577-8835599 GCAGCCCTGACCTCCTCTTAGGG - Intronic
927849121 2:26487864-26487886 GCAGGGCTGCCCTCCGCTGAGGG + Intronic
928197016 2:29223304-29223326 GCACCCCTCTCCTCCCAGGACGG + Intronic
928204204 2:29272492-29272514 GCAGCCCTCCCTTCTGATGAGGG - Intronic
932300072 2:70660617-70660639 TCAGCCCTGCCTACCTATGAAGG + Exonic
932437646 2:71712114-71712136 TCAGCCCTGCCCACCCGTGAAGG - Intergenic
932871874 2:75409118-75409140 GGAGCCCAGCCCTGCCATTATGG + Intergenic
933999606 2:87696811-87696833 CCAGCTCTGCCTTCCCATCATGG - Intergenic
934079776 2:88458086-88458108 GCAGCCCTTTCCCCCCATGAAGG + Intergenic
934113265 2:88761910-88761932 GCAGCACTGCCTTCTCAGGAAGG + Intergenic
935327001 2:101946618-101946640 AATGCCCTGCCCTACCATGAAGG + Intergenic
935958226 2:108399584-108399606 GCATGCTTTCCCTCCCATGAGGG + Intergenic
936294247 2:111254081-111254103 CCAGCTCTGCCTTCCCATCATGG + Intergenic
937124745 2:119466669-119466691 GCAGCCTTGACCTCCCAGGCTGG - Intronic
937915382 2:127096416-127096438 GCAGCTCTGCCCTCCCTGGTGGG - Intronic
938261321 2:129896915-129896937 TCCTCCCTGCCCTCCCAAGATGG + Intergenic
938451271 2:131423755-131423777 CCCGCCCTGCCCTTCCATGGTGG - Intergenic
940966814 2:159847372-159847394 GCAACACTGCCCTCCCATGTGGG - Intronic
942935092 2:181546283-181546305 GCAGGTCTACCCTCCCAAGAAGG + Intronic
945536637 2:211026059-211026081 CCAACCCTGCCCTCACCTGATGG - Intergenic
946361574 2:219222234-219222256 GCTGCCGTGCCCTCCCATCTTGG + Intronic
947570202 2:231227910-231227932 GTAGCCCTGCTCCTCCATGAAGG - Intronic
949059430 2:241948118-241948140 GCAGACCCGGCCTCCCATGCAGG - Intergenic
1170406537 20:16043977-16043999 GCAATCCTGCCCTCCCACAATGG + Intronic
1172065701 20:32218678-32218700 GCAGACCTGCCCTCAAAGGATGG + Intronic
1173926410 20:46784512-46784534 GCAGCCCTGGCCTCTTCTGAGGG - Intergenic
1174404183 20:50292958-50292980 GCAGCCCTGATCACCCAAGACGG - Intergenic
1175303494 20:57959736-57959758 GCAGCCCTTTCCTCTCATAAAGG - Intergenic
1175810040 20:61852958-61852980 GCAGCCCTCCCCTGCCCTCAGGG - Intronic
1176023197 20:62973000-62973022 GCAGCCCGGCCCTGCCCTGCTGG - Intergenic
1176073765 20:63239340-63239362 GCAGGCCTGTCCTCCTAGGAGGG + Exonic
1176101927 20:63368334-63368356 GCAGCCCTGGGCTCCCATGTAGG + Intronic
1178030294 21:28518337-28518359 GCAGCCCTGCCTTCCCAAGGGGG - Intergenic
1179429787 21:41312931-41312953 TCTGCCCTGCCCTTCCTTGAAGG - Intronic
1179873609 21:44256312-44256334 CCAGCACTGCCCCCCCAGGAAGG + Intronic
1180974832 22:19842580-19842602 GCAGGTCTGGCCTCCCTTGAAGG - Intronic
1181181082 22:21068952-21068974 GCAGCCATGCTCACCCCTGAAGG - Intergenic
1181454340 22:23047860-23047882 CTAGCCCTGCCCTCGCCTGATGG + Intergenic
1181509980 22:23384826-23384848 GCAGCCCTGGATTCCCATGTTGG - Intergenic
1181528717 22:23503947-23503969 GCTGCCATGCCCACCCATGTTGG - Intergenic
1181797125 22:25318931-25318953 AGAGCCCAGCCCTCCCAGGACGG + Intergenic
1182095351 22:27621933-27621955 GCAGCCCTGACCTCCCCAGCGGG + Intergenic
1183288275 22:36981624-36981646 GCAGCCCTCCCCTGCCATGGGGG + Intergenic
1183316692 22:37141059-37141081 GGAGCCCTGCCCTCCCAGGCAGG + Intronic
1183619976 22:38966583-38966605 ACAGGCCTGCCCTTCCAGGAGGG - Intronic
1184962985 22:47945078-47945100 CCTGCCCCGCCCTCCCCTGAGGG - Intergenic
1185375242 22:50479823-50479845 GCATCCCTGCCCTCCCAGATCGG + Intergenic
1185378975 22:50498050-50498072 GCACCCCTGCACTCCCAGCATGG - Intergenic
950135425 3:10577477-10577499 GCAGCCCTGGGATCCCCTGATGG - Intronic
950186943 3:10951286-10951308 GGAGCCGTGCCCTCCTGTGATGG + Intergenic
950681246 3:14586497-14586519 ACAGCCCTGCCCTCCCCCGGAGG + Intergenic
951216316 3:20028746-20028768 GCCACCCTGCCCCACCATGAAGG + Intergenic
958480775 3:94643365-94643387 CTAGCCCTGCCCTCACCTGATGG - Intergenic
960634372 3:119768673-119768695 GGAGCCTTGCCCTCCCAGCAGGG - Intergenic
960928780 3:122823061-122823083 TCAGCCTTGCCCTTCCATGTGGG + Intronic
961094197 3:124140779-124140801 GCAGCCTTGCCCTCCCGGGGGGG + Intronic
962883551 3:139601675-139601697 GGAGCCCTGCTCTCACAGGATGG + Intronic
963585305 3:147179211-147179233 GCTGCCCTGCAGTCCCATGGTGG + Intergenic
964421648 3:156510317-156510339 GCTGCCATGTCTTCCCATGATGG + Intronic
964684499 3:159380197-159380219 GCAGTCCTACACTCCCAAGAAGG + Intronic
968598156 4:1495928-1495950 GCTGCCCTGCCCTGCCAGGGAGG + Intergenic
968643382 4:1726317-1726339 TCAGCCCTGCCCTTCAGTGAAGG + Intronic
969093504 4:4714985-4715007 GCAGGGCTGCACTCTCATGAAGG + Intergenic
969385660 4:6845236-6845258 GCAGCCCTGCCCCCTCACCAGGG - Intronic
971001052 4:22322896-22322918 CACACCCTGCCCTCCCATGAGGG + Intergenic
972386031 4:38566662-38566684 ACAGCCCTGCTTTCCAATGATGG + Intergenic
973675455 4:53257263-53257285 GCAGGCTAGGCCTCCCATGAAGG + Intronic
975044314 4:69783289-69783311 GCAGCCCTGCCCTTCCAGTCAGG + Intronic
976002449 4:80388008-80388030 GCAGCCCTACCCACCCCTGGAGG - Intronic
979157392 4:117413812-117413834 ACAGCATTGACCTCCCATGAAGG + Intergenic
981748020 4:148069381-148069403 CCAGCCCTCCCCTCCCTGGAAGG - Intronic
984145010 4:176049639-176049661 GCATCCCTTCCCTCCTATTATGG - Intergenic
985008618 4:185559872-185559894 CTAGCCCTGCCCTCACCTGAGGG - Intergenic
985055168 4:186029822-186029844 GCAGGCGTGCACTCCCAGGAGGG - Intergenic
985484977 5:143390-143412 GCACCACTGCTCTGCCATGACGG - Exonic
985560445 5:583482-583504 GCAGCCCTGCCCTCACTCGTGGG - Intergenic
986089453 5:4489573-4489595 GCAGCCCTGCCCTGCCACAGCGG - Intergenic
990157645 5:52897204-52897226 GCAGCCCTGTCCTCGCCAGAGGG - Intronic
990206412 5:53434224-53434246 GAAGCACTGCTCTCCGATGAGGG + Intergenic
996637652 5:125713421-125713443 GCATCCTTGCCATCCCATGCTGG - Intergenic
997884258 5:137616177-137616199 GCTTCCCTGCCCACCCTTGAGGG + Intergenic
999743431 5:154574132-154574154 CCAGCCCTGCCTGCCCCTGAGGG - Intergenic
1000193808 5:158938724-158938746 ATAGCCCTCCCCTGCCATGATGG - Intronic
1001570539 5:172727689-172727711 CCAGCTCTGCCCTGCCAGGAGGG - Intergenic
1002950875 6:1810107-1810129 ACAGCCCTGCCCTCCCCTAGAGG + Intronic
1003221534 6:4164969-4164991 GCAGCCCAGCCCTCCCTCGGGGG - Intergenic
1005760280 6:28961302-28961324 CTAGCCCTGCCCTCACCTGATGG + Intergenic
1006806154 6:36790992-36791014 GTAGCACTGACCTCCCAGGAAGG + Intronic
1008351841 6:50500186-50500208 GTATCCCTGCCCTCACATGGTGG + Intergenic
1010479908 6:76338356-76338378 CCAGCCCTGCCTTCACCTGATGG - Intergenic
1012922687 6:105235501-105235523 TTAGCCCTGCCCTCACCTGATGG + Intergenic
1013235616 6:108195475-108195497 ACAGCCCAGCCCTCCCAGAAGGG - Intergenic
1013408664 6:109865162-109865184 GCAGCCCTGCCCTCAAAGGGTGG - Intergenic
1017433348 6:154392717-154392739 GGAGCCCTTGCCTCCCCTGACGG + Exonic
1018196396 6:161359342-161359364 GAAGCCCGGCCATCCCAGGATGG - Intronic
1018287113 6:162252627-162252649 CCAGCCGTGCCCTCTCATGGTGG - Intronic
1019473855 7:1234921-1234943 GCAGTCCTGCCCTCCCCAGGAGG - Intronic
1019722668 7:2582644-2582666 GCAGCCCTGCGCCCACCTGATGG - Exonic
1019927473 7:4202854-4202876 GCAGCCCAGGCCTGCCATGCAGG + Intronic
1020143461 7:5624903-5624925 GCAGCCCGGTCCTCCCACCATGG - Intronic
1021005804 7:15393249-15393271 GAAGCCCTGCCTTTCCAAGAAGG - Intronic
1022465511 7:30650501-30650523 GCAGGCCTGGCCTCCCAGCAGGG + Intergenic
1024548277 7:50540028-50540050 GCTGCTCTGTCCTCCCATGCAGG - Exonic
1024745751 7:52404128-52404150 CTAGCTCTGCCCTCACATGATGG - Intergenic
1027266257 7:76496770-76496792 GCAGCCCAGCCCTCACAGTATGG + Intronic
1027317637 7:76994888-76994910 GCAGCCCAGCCCTCACAGTATGG + Intergenic
1027432746 7:78131495-78131517 CCATCCCTCTCCTCCCATGATGG - Intronic
1027757667 7:82235415-82235437 GCAGCCTGCCCCTCCCATCAGGG - Intronic
1029698022 7:102227461-102227483 GCAGCCCTGTCCCCCCATCGAGG + Exonic
1031076879 7:117221647-117221669 GCTCCTCTTCCCTCCCATGAAGG + Intronic
1033657072 7:143381556-143381578 GCAGCCCGGCCCGGCCATGGCGG + Exonic
1034354538 7:150442381-150442403 GTGGCCCTGCCCTCCCATGTAGG - Intergenic
1035051929 7:156003979-156004001 CCAGCCCTGCGCTCCCAGCAGGG + Intergenic
1035061278 7:156071325-156071347 TCAGCCCTGCCCACCCCTGTGGG - Intergenic
1035752909 8:2008438-2008460 GCAGCCCTTCCCTCACATCTGGG - Intergenic
1036287069 8:7452331-7452353 ACCTCCCTGCCCTCCCGTGAAGG + Intronic
1036334412 8:7859191-7859213 ACCTCCCTGCCCTCCCGTGAAGG - Intronic
1036673825 8:10812498-10812520 GCAGCTCTGCCAGCCCATGCAGG + Intronic
1037787567 8:21911864-21911886 GCTGCCCTGCTCTCCCCTGGGGG - Intronic
1038613984 8:29076260-29076282 CCAGGCCTGGCCTCCCATGCTGG + Intronic
1039471407 8:37815655-37815677 GAAGCCCTGCCCTCTCCTCATGG + Intronic
1039810491 8:41043894-41043916 CTAGCCCTGCCCTCACCTGATGG - Intergenic
1039982719 8:42421977-42421999 GCAGTCCTGCCCTGTCACGAAGG + Intronic
1040710901 8:50187832-50187854 AAAGCTCTGCCCTTCCATGATGG + Intronic
1041201924 8:55458297-55458319 GCATGCTTCCCCTCCCATGAGGG - Intronic
1042445821 8:68884309-68884331 GCACCCCTGTCATCCCATGAAGG - Intergenic
1046124071 8:109882356-109882378 GCTTCACTGCACTCCCATGAGGG + Intergenic
1047588422 8:126300162-126300184 GCAGCAATGCCCTCCCATGCAGG + Intergenic
1048573931 8:135676404-135676426 ACAGCCGTGACCACCCATGAGGG - Intergenic
1048822241 8:138391150-138391172 GAATCCCTGTCCTCCCATTAAGG + Intronic
1048928280 8:139290365-139290387 GCAGTGCTGGCCTCTCATGATGG + Intergenic
1049003418 8:139840213-139840235 GCGGCCCTGGCCTCCCCTGCAGG + Intronic
1049386337 8:142344818-142344840 GCAGCCCAGCCCTGGCCTGAGGG - Intronic
1049425073 8:142534320-142534342 GCAGCCCTGCCCTTCCAGGCTGG - Intronic
1049427171 8:142542675-142542697 GCAGCCCTGCCCTCGCTGGCTGG - Intronic
1052246882 9:26347047-26347069 CTAGCCCTGCCCTCACCTGATGG + Intergenic
1055999260 9:82196599-82196621 GCAGCCCAGCCCTCAGATTAAGG + Intergenic
1056773518 9:89496403-89496425 GCAGCCCTGGGGTCCCAGGAGGG - Intronic
1057245622 9:93451911-93451933 GAAGCCCTGCACGCCCATGGCGG - Exonic
1057635171 9:96757963-96757985 GCCCTCCTGCTCTCCCATGAGGG - Exonic
1059509489 9:114830702-114830724 GCAGCCCTTCCCTGCCAGGTGGG - Intergenic
1060558857 9:124526322-124526344 GCACCCCTGCTCTGCCCTGAAGG + Intronic
1060790766 9:126484042-126484064 CCTGCCCTCCCCTCCCCTGATGG - Intronic
1060879101 9:127105268-127105290 ACTGCCATTCCCTCCCATGACGG + Intronic
1061147033 9:128806092-128806114 GCAGCCCTGCCCACCCTTCGGGG - Intronic
1061466779 9:130786620-130786642 CCAGCCCTTCCCTCACATCAGGG - Intronic
1061832254 9:133303597-133303619 CCAGCCTTGCACTCCCACGAGGG - Intergenic
1062042864 9:134412112-134412134 ACAGCCCTGCCCTCCGCTGTCGG - Intronic
1062236930 9:135514831-135514853 GCACACCTGCCCTCCCCTGCTGG - Intergenic
1062457311 9:136645819-136645841 GCAGCCATGTCCTCCCAGGGAGG + Intergenic
1062711590 9:137978005-137978027 GGAGCACTGCCCCCCCAGGAAGG + Intronic
1062711683 9:137978287-137978309 GGAGCACTGCCCCCCCAGGAAGG + Intronic
1062711747 9:137978481-137978503 GAAGGAGTGCCCTCCCATGAAGG + Intronic
1186487598 X:9945463-9945485 GCAACCCTGCAGTCCAATGACGG - Intronic
1187504666 X:19869162-19869184 TCAGCCCTGCCCACCCATTCTGG + Intronic
1190156990 X:48002289-48002311 GCAACCTTGACTTCCCATGAAGG + Intronic
1190452658 X:50596651-50596673 GCATCCCTGCCCAGCCATGTGGG - Exonic
1199636432 X:149817215-149817237 GCAGGCCTGACCTGCCAGGAGGG + Intergenic
1199945810 X:152666113-152666135 GCAGTCCTGCCCCTCCAGGAAGG + Intergenic