ID: 1155163722

View in Genome Browser
Species Human (GRCh38)
Location 18:23216182-23216204
Sequence TATTCCCCAAGGTCTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155163716_1155163722 10 Left 1155163716 18:23216149-23216171 CCACACTTGTCTTTGAAGTGTCC 0: 1
1: 0
2: 0
3: 22
4: 231
Right 1155163722 18:23216182-23216204 TATTCCCCAAGGTCTGGGGTAGG 0: 1
1: 0
2: 0
3: 16
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155163722 Original CRISPR TATTCCCCAAGGTCTGGGGT AGG Intronic
900357306 1:2271083-2271105 GAAACCCCAAGTTCTGGGGTGGG - Intronic
900657143 1:3764008-3764030 GATTCCCCAAGGTGTGTGGGAGG + Intronic
900746472 1:4364185-4364207 TAATCCCCAGTGTTTGGGGTGGG + Intergenic
900971789 1:5995963-5995985 TATCCCCCAGGGTCTGGGCCTGG - Intronic
901567278 1:10128517-10128539 TAAATCACAAGGTCTGGGGTGGG - Intronic
902530784 1:17089481-17089503 GCTCCACCAAGGTCTGGGGTAGG + Intronic
902919284 1:19656814-19656836 TGTTCCCAAAGGTCTGGGGCAGG - Intronic
904887512 1:33752230-33752252 TAATCCCCAATGTTTGAGGTTGG + Intronic
904981563 1:34507357-34507379 TGTTTACCAAGGACTGGGGTGGG + Intergenic
906308245 1:44735041-44735063 TATCCCCCAAGGCCGTGGGTGGG - Intergenic
906472195 1:46140362-46140384 TTTTCCCCAATGTCTGTGCTTGG - Intronic
906532165 1:46530194-46530216 TACTCCCCAGGGCCTGGGGGCGG - Intergenic
910059122 1:83067801-83067823 TAATCCCCAAGGTTGGAGGTAGG + Intergenic
910491131 1:87772800-87772822 TATTCCTTAAGCTCTGTGGTAGG + Intergenic
910673090 1:89792818-89792840 TAATCCCCAATGTCGGAGGTGGG - Intronic
911799067 1:102110519-102110541 TAGGCCCCCAGGTCTGTGGTGGG + Intergenic
915303932 1:154967258-154967280 TATCCCTCAAGGCCTGAGGTGGG + Intronic
916004296 1:160645715-160645737 TACTTCCCAAGGTCTAGGGGAGG - Intronic
916560018 1:165926565-165926587 TATTCCCCAGTGTCTGTTGTTGG + Intergenic
919311453 1:195915883-195915905 TAATCCCCAATGTTTGAGGTGGG + Intergenic
919374142 1:196771082-196771104 TATTGCCCTATGTCGGGGGTGGG + Intergenic
920032321 1:203044820-203044842 TGTTCCCCAAGGTGGGAGGTTGG + Intronic
920866565 1:209758441-209758463 CATTCCCCAGGGTCATGGGTGGG - Intronic
921634633 1:217477588-217477610 TACTCCCCATGGCCTGTGGTAGG + Intronic
921936183 1:220799297-220799319 TGTCCCCCAAGGTCCTGGGTTGG + Intronic
922433675 1:225582025-225582047 TAATCCCCAATGTTGGGGGTGGG + Intronic
923428429 1:233895046-233895068 TATTTACTAAGTTCTGGGGTTGG + Intergenic
924324757 1:242884645-242884667 TAATCCCCAATGTTGGGGGTAGG + Intergenic
1063840435 10:10065539-10065561 TAATCCCCAAGGCCGGAGGTGGG - Intergenic
1064061615 10:12142331-12142353 TATTGCCAAATGTCTTGGGTGGG + Intronic
1065906226 10:30254996-30255018 TATGCCCCTGGGTCTGGGGTGGG + Intergenic
1067107005 10:43373201-43373223 TGTTCCCAAAGGTCTGGGCCTGG - Intronic
1068693512 10:59941829-59941851 TAATCCCCAATGTCGGAGGTGGG - Intergenic
1068973026 10:62979155-62979177 GATTCTCCAAGGTCTGGGTGAGG - Intergenic
1069781810 10:70961610-70961632 TATTTCCTAAGCCCTGGGGTGGG + Intergenic
1070909913 10:80109051-80109073 TAGCCCCCACGGTCTGGTGTTGG + Intergenic
1073806952 10:107108571-107108593 TAATCCCCAATGTTTGAGGTGGG - Intronic
1073885953 10:108039894-108039916 TTTTCCCCATTGACTGGGGTTGG + Intergenic
1075212006 10:120499533-120499555 TGATCCACTAGGTCTGGGGTGGG + Intronic
1075666832 10:124237144-124237166 TCGTCCCCTAGGACTGGGGTTGG + Intergenic
1077868699 11:6243523-6243545 TAATCCCCAATGTTGGGGGTGGG - Intronic
1079657433 11:23000459-23000481 TGTTCCCCATTGACTGGGGTTGG + Intergenic
1080565832 11:33508574-33508596 CATTGCCCAAAGCCTGGGGTAGG - Intergenic
1081576200 11:44319834-44319856 GTTTCCCCAAGGCCTGGGGGTGG - Intergenic
1082878535 11:58014272-58014294 TAATCCCCAAGGTTGGAGGTGGG - Intergenic
1083582081 11:63831447-63831469 CCCTCCCCAAGGTCTTGGGTAGG + Intergenic
1085038837 11:73315260-73315282 AATTCACCAGGGCCTGGGGTTGG + Intronic
1086554195 11:88089983-88090005 TAGTCCCCCAGTTCTGAGGTGGG - Intergenic
1087164723 11:94990303-94990325 TTCTCACCAAGGTCTGAGGTTGG + Intronic
1088988473 11:114929767-114929789 TCCTCCCCAGGGTCAGGGGTCGG - Intergenic
1089382448 11:118045096-118045118 TATTGCCCAAGGTCCAGGTTTGG + Intergenic
1091246652 11:134101940-134101962 TATTCCCAAGAGTCTGAGGTGGG + Intronic
1093714179 12:22362615-22362637 TATTCCCACATGTCTGGGTTTGG - Intronic
1093763998 12:22941988-22942010 TAATCCCCAAGGTTGGAGGTGGG + Intergenic
1095162995 12:38938296-38938318 TTTTCCCCATTGTCTAGGGTTGG + Intergenic
1095948459 12:47767175-47767197 AACTCCACAAGGGCTGGGGTGGG + Intronic
1097317334 12:58185953-58185975 TATTGCCCAACGTGTGGGATAGG + Intergenic
1097464744 12:59908375-59908397 TATTCCCTAAGGGCTGGGCGTGG + Intergenic
1105409875 13:20162017-20162039 CGTCCCCCAAGGTCTGGAGTGGG + Intergenic
1105771819 13:23619352-23619374 TGTTGCCTAAGGGCTGGGGTTGG + Intronic
1105796483 13:23859127-23859149 TTTTCCCCAGATTCTGGGGTAGG - Intronic
1107247150 13:38310065-38310087 TAATCCCCAATGTTGGGGGTGGG - Intergenic
1107366868 13:39688610-39688632 TAATCCCCAATGTCGGAGGTGGG - Intronic
1107992440 13:45830442-45830464 CATTCCTCAAGGCGTGGGGTAGG + Intronic
1110080249 13:71300420-71300442 GACTCCCCAAGGTCTGGGTGTGG + Intergenic
1115179061 14:30601065-30601087 TATGCCCCCACCTCTGGGGTAGG + Intronic
1116311300 14:43329892-43329914 TACTCCCGCAGGCCTGGGGTGGG + Intergenic
1117837515 14:59822541-59822563 TCTTCTCCAAGCTTTGGGGTTGG + Intronic
1118449054 14:65880714-65880736 TATTCTCCAAGGTCTGCTTTTGG + Intergenic
1120200005 14:81527195-81527217 TAATTCCCAAAGTCTGGGTTCGG + Intronic
1120835216 14:89032777-89032799 TATTCCCCAACGCATGGGGCTGG + Intergenic
1120975080 14:90241293-90241315 TATTCCCCAAGGTCATAGATTGG + Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1121288227 14:92753238-92753260 TAATCCCCAAGGTTGGAGGTAGG + Intergenic
1122082173 14:99273696-99273718 TCGTCCCGAAGGTCTTGGGTGGG + Intergenic
1123189763 14:106557541-106557563 TATATACCAAGCTCTGGGGTGGG + Intergenic
1123962568 15:25421072-25421094 TAATCCCCAATGTTGGGGGTGGG + Intronic
1125328210 15:38558578-38558600 TACTCCAGTAGGTCTGGGGTGGG - Intronic
1125605996 15:40940361-40940383 TAAGCACCCAGGTCTGGGGTGGG - Intergenic
1127294397 15:57596963-57596985 TATTCCACCAGGCCTGGGGAGGG - Intronic
1127729054 15:61781417-61781439 TGGTTGCCAAGGTCTGGGGTAGG - Intergenic
1129374186 15:75117230-75117252 TATCCCCCACGGCCTGGTGTTGG - Intronic
1130358184 15:83154498-83154520 TATTTCAGAAGGTCTAGGGTGGG - Intronic
1130829353 15:87583858-87583880 TATTCCCCAAGAGTTGTGGTTGG + Intergenic
1131104827 15:89726301-89726323 TATTCCAGTAGGTCTGGGGTGGG + Intronic
1131335406 15:91544238-91544260 TATACCCCAAGTACTTGGGTTGG - Intergenic
1132169088 15:99629418-99629440 TTTTTCCCATTGTCTGGGGTCGG + Intronic
1133786734 16:8979766-8979788 GATTACCCAAGGTCAGGAGTTGG - Intergenic
1134097622 16:11429128-11429150 TAATCCCCAGCGTCAGGGGTGGG + Intronic
1135043035 16:19132597-19132619 TACTCCCCAAGGGCTGGAGTTGG - Intronic
1135130656 16:19851321-19851343 TGTTTCTAAAGGTCTGGGGTGGG + Intronic
1137621564 16:49879866-49879888 TGTCCCCCAATGTCTGGGGCAGG - Intergenic
1137636133 16:49988138-49988160 TAATCCCCAAGGTTGGAGGTGGG + Intergenic
1137891641 16:52169336-52169358 GCTTCCCCCAGATCTGGGGTGGG - Intergenic
1138015038 16:53420423-53420445 TAATCCCCAATGTTAGGGGTGGG - Intergenic
1138092821 16:54190485-54190507 TAGTCCCCATGGACTGGGGGTGG + Intergenic
1139692526 16:68650275-68650297 TTTTCCCCAAGGAATGGGGCAGG - Intronic
1142800622 17:2343118-2343140 TATTCTCCAAGGTTAGGGGTAGG - Intronic
1143308468 17:5968645-5968667 TAATCCCCAATGTTGGGGGTGGG + Intronic
1143624746 17:8103421-8103443 TGGTCCCCTTGGTCTGGGGTGGG + Exonic
1144496151 17:15746816-15746838 TAACCCCCAAGATCTGGTGTTGG - Intronic
1146172831 17:30646409-30646431 TAGCACCCAGGGTCTGGGGTGGG + Intergenic
1146346288 17:32062420-32062442 TAGCACCCAGGGTCTGGGGTGGG + Intergenic
1146519476 17:33515182-33515204 TGTTCCTGAAGCTCTGGGGTTGG + Intronic
1146826682 17:36029115-36029137 AGTTCCCCAAGGTCAGTGGTTGG + Intergenic
1147807175 17:43140078-43140100 CATTCCCCATCCTCTGGGGTGGG + Intergenic
1148366451 17:47059039-47059061 CATTCCCCATCCTCTGGGGTAGG - Intergenic
1149140713 17:53429268-53429290 TAATCCCCAAAGTTGGGGGTGGG + Intergenic
1150263484 17:63815963-63815985 TGATTCACAAGGTCTGGGGTTGG - Intronic
1150400266 17:64850801-64850823 CATTCCCCATCCTCTGGGGTGGG + Intergenic
1151034079 17:70778340-70778362 TAATCGTCTAGGTCTGGGGTTGG - Intergenic
1151082953 17:71349453-71349475 TAATCCCCAATGTCAGAGGTGGG - Intergenic
1151222912 17:72626661-72626683 AATTCCCCAGTGTCAGGGGTGGG + Intergenic
1151237428 17:72731386-72731408 TAATCCCCAATGTTGGGGGTAGG + Intronic
1151902195 17:77023783-77023805 TAATCCCCAATGTTGGGGGTGGG + Intergenic
1151960392 17:77402591-77402613 AATTCTCCAAGGTCTGGGCTGGG - Exonic
1155163722 18:23216182-23216204 TATTCCCCAAGGTCTGGGGTAGG + Intronic
1155632412 18:27908583-27908605 TATTGCCCAACTTCTGGGGAAGG - Intergenic
1156672802 18:39491116-39491138 CATTCCCCAACCTCTGGGGAGGG + Intergenic
1157342784 18:46794238-46794260 TAGTTCCATAGGTCTGGGGTGGG + Intergenic
1157611555 18:48959779-48959801 TATTCTCCTAGGTCTGCGTTGGG - Intergenic
1161013514 19:1971292-1971314 GCCTCCCCAAGGGCTGGGGTGGG - Intronic
1161800781 19:6415847-6415869 TATTGCCCCAGCCCTGGGGTGGG + Exonic
1163884948 19:19957046-19957068 ATTTCCCCAAGCTCTGGGGTGGG - Intergenic
1165782669 19:38443046-38443068 TCTGCCCCAAGGTCCGGGTTGGG + Intronic
1166336818 19:42113252-42113274 TATTTCAGAATGTCTGGGGTAGG - Intronic
1166499521 19:43330533-43330555 TATTTGCCAATGTCTGAGGTAGG + Intergenic
1166853132 19:45769739-45769761 TATTCGCGAGGGTCGGGGGTGGG + Exonic
1166970918 19:46567005-46567027 TGATCCCCAATGTCAGGGGTGGG - Intronic
1167133116 19:47600537-47600559 TATTGGCCCAGGTCTGGGGGCGG - Intergenic
1167658403 19:50781237-50781259 TAAACCACAAGGTCTGGGGATGG - Intergenic
1167739894 19:51318242-51318264 TATTTCCCAAGGCCTCTGGTGGG + Intronic
1168057530 19:53871496-53871518 TAATCTCCAAGGTGGGGGGTAGG + Intronic
925163293 2:1701741-1701763 TAATCCCCAAGGGATGGTGTTGG + Intronic
926235983 2:11044351-11044373 TAATCCCCAGTGTCTGAGGTGGG + Intergenic
928367897 2:30716753-30716775 TAATCCAGAAGGTCTGGGGCTGG - Intergenic
928380656 2:30814819-30814841 TAGTCCCCATGGATTGGGGTTGG - Intronic
929744435 2:44641448-44641470 TACTGCCTTAGGTCTGGGGTTGG - Intronic
929909229 2:46074905-46074927 GATTCCCCACGATCTGGTGTAGG - Intronic
931650471 2:64463985-64464007 TCATCCCCAAGGCCTGTGGTTGG - Intergenic
932493256 2:72134406-72134428 TCTTCCCCAAGGGCTGAGGCTGG + Intronic
932671911 2:73744939-73744961 CATTTGCCAAAGTCTGGGGTTGG + Intergenic
933051369 2:77606694-77606716 TATTTCCTAAATTCTGGGGTGGG - Intergenic
933664849 2:84956592-84956614 TATTACTTTAGGTCTGGGGTAGG - Intergenic
936456053 2:112675182-112675204 TGATCCCCAAGGTTTGAGGTGGG + Intergenic
938072704 2:128317050-128317072 TTCTCCCCAAAGTCTGGGCTGGG - Intronic
940786278 2:157984838-157984860 AATTCCCCCAGGTCTTGTGTGGG + Intronic
941331412 2:164182057-164182079 TATTGCCAAATGACTGGGGTGGG - Intergenic
941966531 2:171306048-171306070 TATTCCCCAAGCTCATGGGTTGG + Intergenic
943123073 2:183761631-183761653 TAATCCCCAAGGTTGGAGGTGGG - Intergenic
943968251 2:194367185-194367207 TAGCCCCCACGGTCTGGTGTTGG - Intergenic
947805795 2:232967041-232967063 TAATCCCCAATGCCTGAGGTGGG + Intronic
1168976007 20:1966361-1966383 TATGCCCCTAGATCTGGAGTGGG + Intergenic
1169269117 20:4185984-4186006 TAATCCAGCAGGTCTGGGGTGGG - Intronic
1169918037 20:10703295-10703317 TAATCCCCAAGGTTGGAGGTGGG + Intergenic
1174501922 20:50991440-50991462 TCATCCCTCAGGTCTGGGGTGGG + Intergenic
1175314284 20:58036498-58036520 AATTTCCCATGGTCTGAGGTTGG - Intergenic
1175750510 20:61493846-61493868 TGTTCTCCCAGGACTGGGGTGGG - Intronic
1176117485 20:63439405-63439427 TGTTCCCCAAGGACTGGAGTGGG - Intronic
1179418916 21:41220363-41220385 CACTCCCCAAGGTTGGGGGTGGG + Intronic
1179671712 21:42954082-42954104 TTTTTCCCAATATCTGGGGTGGG + Intergenic
1180153722 21:45966837-45966859 CTTTCCCCAGGGTCTAGGGTGGG - Intergenic
1181807615 22:25384483-25384505 TACTGCCCAAGCTCTGGAGTAGG - Intronic
1182189743 22:28446430-28446452 TAATCCCCAATGTCAGAGGTGGG + Intronic
1182735291 22:32528868-32528890 TCTTACCCAAGGTCTGAGGGGGG + Exonic
1182806216 22:33072790-33072812 TATGCCCTGTGGTCTGGGGTGGG - Intergenic
1184095191 22:42312606-42312628 CATTCCCCAGGGTGTGGAGTGGG + Intronic
1184849509 22:47112259-47112281 TGTTCCCCAAGGTGCGGGCTGGG + Intronic
949700911 3:6756817-6756839 TAGTCACCAAGGGCTGGGGAAGG + Intergenic
949811328 3:8009734-8009756 TTTTTCCCAAGGCCTTGGGTTGG + Intergenic
950706239 3:14784271-14784293 TATTTCCCAAGGCCTGAGCTGGG - Intergenic
952045036 3:29308677-29308699 TATGGCCAAAGGTCTGGAGTTGG + Intronic
952205883 3:31181303-31181325 TTTTCCCCAAGGAATGGGGCAGG - Intergenic
952331947 3:32371817-32371839 TACTTTCAAAGGTCTGGGGTGGG - Intergenic
953385532 3:42503789-42503811 GATTACTCAAAGTCTGGGGTAGG - Intronic
953404009 3:42651528-42651550 GAATCCCCAGGGTGTGGGGTGGG - Intergenic
954433090 3:50481669-50481691 TATTCTCCCAGCTCTGGGGAAGG + Intronic
956420246 3:69080040-69080062 TGGTCCCCTAGGCCTGGGGTGGG + Intronic
958012833 3:87902385-87902407 TTTTCCCCATGCTGTGGGGTAGG - Intergenic
958101687 3:89019928-89019950 TAATCCCCAATGTCAGAGGTGGG + Intergenic
958602759 3:96319123-96319145 TAATCCCCAAGGTTGGAGGTGGG + Intergenic
959291282 3:104477576-104477598 TATTCTGCTAGGTTTGGGGTTGG - Intergenic
960890021 3:122438083-122438105 TAATCCCCAAGGTTGGAGGTGGG + Intronic
961166104 3:124764940-124764962 ACTTCCACAAGGTCTGGGCTGGG + Intronic
962940465 3:140120544-140120566 CATTCCCCAACCTCTGGGGAGGG - Intronic
964092274 3:152891677-152891699 TAATCCCCAATGTTGGGGGTGGG - Intergenic
964394791 3:156234129-156234151 AATTCCCCAGGGGCTGGGGTTGG + Intronic
965763178 3:172102679-172102701 TAGTGCCCAAGGTCTGGGCAAGG + Intronic
968062135 3:195733633-195733655 TACTCCCCCAGGTCTTGGTTTGG + Intronic
968184359 3:196621721-196621743 TACTTCCCTAGGTCTGGGGGAGG - Intergenic
968654905 4:1774250-1774272 AAATCCCCAAGGTCTGGAGTTGG - Intergenic
969908026 4:10415825-10415847 TATTCCCACAGGATTGGGGTGGG - Intergenic
974268541 4:59618432-59618454 AAGTCCCCAAGGTCTGTAGTTGG + Intergenic
975526317 4:75354314-75354336 GATGCCCCAAGTTCTGTGGTAGG + Intergenic
977723878 4:100271481-100271503 TAATCCCCAAGGTTGGAGGTGGG + Intergenic
981076981 4:140602003-140602025 TCTTCCCCATGGGCTGGGATTGG + Intergenic
981083048 4:140654221-140654243 CTTTCCCCATTGTCTGGGGTCGG + Intronic
981194532 4:141903127-141903149 TAATCCCCAATGTTGGGGGTGGG - Intergenic
981698643 4:147583941-147583963 TTATCCCCTAGGTCTGTGGTAGG + Intergenic
985520535 5:372171-372193 TCCTCCCCCAGGGCTGGGGTGGG + Intronic
988808854 5:34765754-34765776 TTTTCCCCATGGTCTTGGGAAGG - Intronic
989150964 5:38299465-38299487 TAATCCCCAATGTCAGAGGTGGG + Intronic
989489335 5:42032324-42032346 AGTTCCCCCAGGTCTTGGGTGGG + Intergenic
989776809 5:45219034-45219056 GATTTCCCGAGGTCTGGGGCAGG + Intergenic
992402873 5:76427669-76427691 TGTTCCCGCAGGTCTGGGCTGGG + Intronic
994457322 5:100027946-100027968 TAATCCAGAAGGTCTAGGGTAGG + Intergenic
995946991 5:117659887-117659909 TCTTCCCCAATGTCTGTGCTTGG - Intergenic
997672037 5:135683202-135683224 TATTGACCAAGGAATGGGGTGGG + Intergenic
998110125 5:139494941-139494963 TATTCTCCAAGGTCTGCTTTTGG - Intergenic
1001326825 5:170734456-170734478 TAATTCCATAGGTCTGGGGTAGG + Intronic
1002008592 5:176257629-176257651 TAATCCCCAAGGTTGGAGGTGGG - Intronic
1002218130 5:177654622-177654644 TAATCCCCAAGGTTAGAGGTGGG + Intergenic
1002991306 6:2241499-2241521 TAATCCCCAAGGTTGGAGGTGGG + Intronic
1003746107 6:9004392-9004414 TAATCCCCAATGTTTGGGGAGGG + Intergenic
1004288789 6:14347769-14347791 TATTCCCAAAGGTATGGAGAAGG - Intergenic
1005029942 6:21499400-21499422 TGATTCCGAAGGTCTGGGGTGGG - Intergenic
1008215082 6:48778529-48778551 TATTCCCCATGGCCTGGGGGTGG + Intergenic
1009462732 6:63933598-63933620 TCTTCCCAGAGGTCTGGGGTGGG + Intronic
1009476744 6:64101685-64101707 CATTCTCCAAAGACTGGGGTGGG + Intronic
1011597518 6:89030131-89030153 AAATCCCCAAGGACTGGGGAGGG - Intergenic
1013813348 6:114069386-114069408 TTTTACCCAAGGGCTGTGGTTGG + Intronic
1014014780 6:116517811-116517833 CCTTCCCCAAGGTCTGGGAGTGG - Exonic
1017846118 6:158260055-158260077 TCTTCCCAGAGGTCAGGGGTGGG + Intronic
1018161943 6:161053323-161053345 TAATCCCCAATGTTGGGGGTGGG - Intronic
1020063389 7:5169243-5169265 AATCACCCAAGGTCAGGGGTTGG + Intergenic
1026942105 7:74293140-74293162 TAATCCCAAAGGTATGGGATCGG - Intronic
1028264412 7:88705416-88705438 TATTCCTCATGGCCTGGGGGTGG - Intergenic
1029241411 7:99165884-99165906 TAATCCCCAACGTTGGGGGTGGG + Intergenic
1030879422 7:114858756-114858778 TTATTCCAAAGGTCTGGGGTGGG - Intergenic
1031474022 7:122201071-122201093 TGTTCAGCAATGTCTGGGGTGGG - Intergenic
1034477681 7:151296229-151296251 TAATCCCCAAGGTTGGAGGTGGG - Intergenic
1034826237 7:154266322-154266344 TATTCACCAAGATCTGGCGCAGG + Intronic
1035070878 7:156144069-156144091 TATTTCACGAGCTCTGGGGTGGG + Intergenic
1035819505 8:2576956-2576978 TAATCCCCAATGTTGGGGGTGGG - Intergenic
1038543205 8:28406147-28406169 GATTCCCCAAGGCCTGGGATTGG + Intronic
1042861246 8:73316272-73316294 TAATCCCCAAGCTTTGGGGGAGG - Intronic
1043287023 8:78545212-78545234 TTTTCTCCAAAGACTGGGGTTGG - Intronic
1043398909 8:79864776-79864798 TTTTCCCACAGGTCTGGGCTTGG - Intergenic
1045425742 8:102064248-102064270 TATTCCCAGAGCTCTGGGGCTGG - Intronic
1046084122 8:109410618-109410640 TAATCCCCAAAGTGTGAGGTAGG - Intronic
1046571158 8:115967885-115967907 TATTCCCAAGAGTCTGGGATAGG + Intergenic
1046642217 8:116744920-116744942 TTTTCTCCAAGGTATGGGCTAGG + Intronic
1047059414 8:121207461-121207483 TATTCCCCAAGGTATGGACAAGG + Intergenic
1048546166 8:135389453-135389475 TATTTCCCAAGATCTGGGTCAGG + Intergenic
1049973336 9:840332-840354 TAATCCCCTAGGTCTGGAGGCGG + Intergenic
1052002456 9:23302263-23302285 TAATCCCCAATGTTTGGGGAGGG - Intergenic
1052018954 9:23503045-23503067 TAATCCCCAATGTTTGGGGAGGG - Intergenic
1052378662 9:27745658-27745680 GTTTGCCCAAGGACTGGGGTTGG + Intergenic
1053354353 9:37433612-37433634 TATTTCAGCAGGTCTGGGGTGGG + Intronic
1055068738 9:72145661-72145683 AATTCCCCAACTACTGGGGTGGG - Intronic
1055302126 9:74892588-74892610 AATTCCCCCAGGCCTTGGGTGGG - Intergenic
1056101495 9:83304424-83304446 TAATTCAAAAGGTCTGGGGTGGG - Intronic
1059461322 9:114432295-114432317 AATTCCCTTAGGTCTGGGGCAGG + Intronic
1059461698 9:114434970-114434992 TGGTCTCCAAGGTCTGGAGTGGG - Intronic
1187419307 X:19121658-19121680 TGATCCCGCAGGTCTGGGGTGGG - Intronic
1190949475 X:55128981-55129003 GGTTCCCAGAGGTCTGGGGTGGG + Intronic
1193520669 X:82525335-82525357 AATTCCCCAGAGACTGGGGTGGG + Intergenic
1194348332 X:92793892-92793914 TATTCCCCATGGCCTGTGGTGGG + Intergenic
1195814466 X:108869801-108869823 TACTCCCCAACTTCTGGGGAAGG + Intergenic
1196672704 X:118385983-118386005 TATTCTCCAAATTCTGGGGGAGG + Intronic
1197785316 X:130192072-130192094 TGTGCCTCTAGGTCTGGGGTGGG + Intergenic
1199834300 X:151573239-151573261 TAATCCCCGAGGTTGGGGGTGGG - Intronic
1199975379 X:152892151-152892173 CAGTCCCCAAGGCCTGGGATGGG + Intergenic
1200656659 Y:5910520-5910542 TATTCCCCATGGCCTGTGGTGGG + Intergenic
1201362054 Y:13163222-13163244 ACTTCCCCATGGCCTGGGGTCGG + Intergenic