ID: 1155174086

View in Genome Browser
Species Human (GRCh38)
Location 18:23287970-23287992
Sequence GAAATTATGAGAGCTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155174086 Original CRISPR GAAATTATGAGAGCTGTAGA GGG (reversed) Intronic
902181461 1:14692319-14692341 GAAAAAATGAGAGCCGAAGATGG - Intronic
904091137 1:27945821-27945843 GAAGTTATGAGGGCTGAAGGTGG + Intronic
905097404 1:35485582-35485604 GAAAATAAGAGAGCCATAGAAGG - Intronic
908966832 1:69775632-69775654 AAAATTAGGAGAGCTATATAAGG + Intronic
909327474 1:74369068-74369090 CAATTTCTGAGAGCTGAAGATGG - Exonic
910498557 1:87861930-87861952 GAAATTATGACAGCTCCAGGAGG + Intergenic
911285918 1:95992016-95992038 GAAATCATGTGAGCTTGAGAAGG + Intergenic
912194079 1:107377365-107377387 GAAATTAGGTGGGCTTTAGAGGG - Intronic
914760379 1:150593855-150593877 CAAATTAAGAGAGCTGAAGAAGG + Intergenic
916604963 1:166332617-166332639 GACATTATAAGAGATGTATATGG + Intergenic
917027060 1:170656094-170656116 GAAATTTAGAGATTTGTAGAAGG + Intergenic
918597706 1:186311069-186311091 GTAATTCTGCGAGCTGGAGATGG - Exonic
918947112 1:191081127-191081149 GAAATTATGAGAGCCCTACCAGG - Intergenic
920427090 1:205887097-205887119 GAAGTTATGAGAACTGTAGAGGG + Intergenic
920767133 1:208844052-208844074 GAAATTATGAGGGCTGCAGGAGG + Intergenic
922334520 1:224607909-224607931 AAAATTTTGAGTGCTGTAAAAGG - Intronic
1064102141 10:12473033-12473055 GAAGTCAGGAAAGCTGTAGATGG + Intronic
1064940422 10:20728198-20728220 GAACTTTTCAGAGCTGCAGAGGG + Intergenic
1067962214 10:50866782-50866804 GAAGTTATGAGAATGGTAGAAGG + Intronic
1069150890 10:64958285-64958307 GAACTTGTGGGAGCTTTAGAAGG + Intergenic
1069830768 10:71280961-71280983 GAAATAAACAGAGCTGAAGAAGG - Intronic
1070506373 10:77116894-77116916 GAACAAATGAGAGCTGTTGAAGG - Intronic
1070802287 10:79250824-79250846 GAAATTCTGGGAGCTGGGGAAGG + Intronic
1072380292 10:94861378-94861400 GAAAATATTAGAGCTAAAGAGGG + Intergenic
1072775291 10:98185379-98185401 GTAATGATAAGAGCTGTAGTAGG + Intronic
1072896652 10:99373061-99373083 GAAATGATGAGAGCTTTGGAGGG + Intronic
1073459311 10:103657362-103657384 GAAATTATGCCTGCTGGAGAGGG + Intronic
1073855132 10:107664675-107664697 GAAACTATGAGAGGCATAGATGG + Intergenic
1077572807 11:3354236-3354258 TAGATTATGAGGACTGTAGATGG + Intronic
1079124798 11:17710943-17710965 CACATTATGAGAGAGGTAGATGG + Intergenic
1079980093 11:27141920-27141942 CAAATTATGAGAGTTCCAGAAGG + Intergenic
1082729959 11:56783856-56783878 GAAATTATCAGATTTGTATAAGG - Intergenic
1085147618 11:74216006-74216028 AATATTATTAGAGCTGAAGAGGG + Intronic
1085177310 11:74501253-74501275 AAAATTATTAGAGATGGAGAAGG - Intronic
1089371488 11:117962499-117962521 GATATTATCAGAGCTAGAGAAGG + Intergenic
1089600133 11:119608997-119609019 GATATTATGAGAGTTCCAGAAGG - Intergenic
1089797895 11:120997882-120997904 GAAATTAAAAGAGCTGTTAAAGG - Intergenic
1090516477 11:127433510-127433532 GAAATGATCAGACCTGTTGATGG - Intergenic
1091229131 11:133976504-133976526 GGAATTAAGGGAGATGTAGATGG + Intergenic
1091427332 12:402467-402489 GAAATTATGAGGGTTGTGGAGGG + Intronic
1097535479 12:60864839-60864861 GAAACTAGGAGTGCGGTAGATGG - Intergenic
1105783708 13:23726859-23726881 GAAGTTTTGAGAGGTGAAGACGG - Intergenic
1107019147 13:35733701-35733723 GTAACTCTGAGAGCAGTAGATGG - Intergenic
1107651623 13:42550794-42550816 CAAATTATGAGAATCGTAGATGG - Intergenic
1109992394 13:70075113-70075135 CAAATTATGAGACTTGAAGAGGG + Intronic
1110371714 13:74747952-74747974 GAAATCATTAGAGCAGGAGAAGG + Intergenic
1110425560 13:75362500-75362522 GAACTTCTGAGAGTTGTAAAAGG + Exonic
1111569408 13:90062125-90062147 GAAAAGATGAGATATGTAGAAGG - Intergenic
1115777493 14:36731768-36731790 GAACTCCTGAGATCTGTAGAGGG - Intronic
1116036289 14:39631105-39631127 AAAATTCTGAGAGCTGGAAAAGG - Intergenic
1116163153 14:41296048-41296070 AAAATAATGACAGCTGTAGAAGG + Intergenic
1117586101 14:57207053-57207075 GACATTATGGCAGCTTTAGAAGG - Exonic
1118063406 14:62165130-62165152 GCAATGATGAGAGGTGTAGGAGG + Intergenic
1118642110 14:67802499-67802521 GAAGTCATGAGATATGTAGAAGG - Intronic
1120482090 14:85063092-85063114 TTAATTATGAAAGCTTTAGATGG - Intergenic
1120672143 14:87374731-87374753 GAAATTATAGGGGATGTAGAAGG - Intergenic
1120746177 14:88153913-88153935 GAAATAATGTGAGCTGATGAAGG - Intergenic
1121401289 14:93679840-93679862 GAAATGATGATCGCTGTCGAAGG - Intronic
1121831560 14:97056659-97056681 GAAATTATTGGAACTGGAGAGGG - Intergenic
1123139117 14:106058132-106058154 GAGATTATGAGAGCTGTGGGAGG + Intergenic
1123197820 14:106633461-106633483 GAGATTGTGAGAGCTGTGGGAGG + Intergenic
1124557795 15:30744057-30744079 AAAATTATGTGAGCAGGAGAAGG + Intronic
1124673441 15:31661599-31661621 AAAATTATGTGAGCAGGAGAAGG - Intronic
1127403309 15:58613813-58613835 CATATTATAAGAGCTGCAGAAGG + Intronic
1129147051 15:73657689-73657711 GAAAAAATAAGAGCTGTGGAAGG - Intergenic
1129929083 15:79394103-79394125 AAAATGCTGAGAGCTGAAGAGGG + Intronic
1129983371 15:79895126-79895148 GAGATTATGAGACCTGTCCAAGG + Intronic
1130094013 15:80842865-80842887 GGATTCATGAGACCTGTAGAGGG + Intronic
1130171461 15:81519089-81519111 GAAGTTACAAGAGGTGTAGAGGG + Intergenic
1131447993 15:92515423-92515445 GAAGTTATGAGAACTGTAGAGGG - Intergenic
1131760294 15:95615574-95615596 GAAATTCTGATAGATGTAGTGGG - Intergenic
1134053188 16:11151894-11151916 GTAGTTCTGAGAGCTGGAGACGG + Intronic
1136079784 16:27844395-27844417 GAAGTTAGGCGAGCTGTGGAGGG - Intronic
1138109426 16:54311862-54311884 GAAATCATCAGAGTTCTAGATGG - Intergenic
1140487494 16:75305192-75305214 GAAAATATGAAAGATGTAGCAGG + Intronic
1140659111 16:77170412-77170434 GGAATTTTTAGAGCTGTGGATGG + Intergenic
1140659115 16:77170438-77170460 GGAATTTTTAGAGCTGTGGATGG + Intergenic
1143733106 17:8892352-8892374 GAAATTATGCAAGCTGGTGAGGG - Intronic
1148642770 17:49200818-49200840 GAACATGTGAGAGCTTTAGAGGG + Intergenic
1149142505 17:53450575-53450597 AAAATTATAAGTGCTGTAAAAGG + Intergenic
1149539537 17:57458619-57458641 GAGAGTATTAGAGCTGGAGAGGG - Intronic
1150854934 17:68743308-68743330 GAATGTATGAGAGATGTTGACGG + Intergenic
1152580002 17:81161697-81161719 GAAGTTATGAGACCTGTCCATGG + Intronic
1153466057 18:5389050-5389072 ATAATCATGAGAGCTGTTGAGGG + Intergenic
1153492854 18:5667405-5667427 GAAAGTATGAGTGGTCTAGATGG - Intergenic
1155107286 18:22680082-22680104 AAAATTATGAGAGGTCTGGAAGG - Intergenic
1155174086 18:23287970-23287992 GAAATTATGAGAGCTGTAGAGGG - Intronic
1155744624 18:29338496-29338518 CATAATATGAGAGCTGTAGTAGG - Intergenic
1156289384 18:35732680-35732702 GAAATGATGAGAACAGCAGAAGG - Intergenic
1156410337 18:36822136-36822158 GAAATTTTGAGAGCTGTGACTGG + Intronic
1156788331 18:40942192-40942214 GAAAATATGTGATCTGTAAAAGG + Intergenic
1161122607 19:2537770-2537792 GAAATTATGAAAGGTCTTGAGGG + Intronic
1164042596 19:21506641-21506663 GAAATTTTGTAAGCTGAAGATGG - Intronic
1164697406 19:30256138-30256160 TAAATTCTGTGAGCTGCAGAAGG - Intronic
925239994 2:2316655-2316677 GAAATAATGCCAGCTGTAGGTGG - Intronic
929324606 2:40593531-40593553 GAAATTATCAGAACTCTAAAAGG - Intronic
930413780 2:51063076-51063098 AAAATGATGACAGCTGTTGAGGG + Intergenic
931007431 2:57867928-57867950 GAAATAATGAAAGCTGCAGTAGG + Intergenic
931180771 2:59898387-59898409 TAAAATATGACACCTGTAGATGG - Intergenic
932513126 2:72315750-72315772 GAGATGAAGAGAGCTGTAAAAGG + Intronic
932531802 2:72542131-72542153 AAAATTAAGAGACCTGTAAAAGG - Intronic
936646835 2:114382066-114382088 GAAATAATGAGAACTGTCAATGG - Intergenic
939524981 2:143281996-143282018 AAACTTATGAGTACTGTAGATGG - Intronic
939542287 2:143508914-143508936 GAAACTATGAAAACTGAAGACGG + Intronic
940508560 2:154585233-154585255 GAAGTTATGAGAACTGTAGAGGG + Intergenic
941812256 2:169766986-169767008 GAAATTATTAGAGCTGCTGAAGG + Intronic
943751954 2:191518725-191518747 GGAATTTTGAGAGGTGTGGAAGG + Intergenic
944174144 2:196811152-196811174 GAAATTATGCCAGGCGTAGAGGG + Intergenic
944657938 2:201895147-201895169 GAAGATATGAGAGCTATAGGAGG + Exonic
946887638 2:224239598-224239620 GAAAGTATGTGAGGAGTAGATGG - Intergenic
946980398 2:225207314-225207336 GAAATTCTATGGGCTGTAGAGGG + Intergenic
1169409741 20:5357773-5357795 TAAATTAAGAGAGCTGATGAGGG - Intergenic
1174737778 20:52982062-52982084 AAAATTATGAGAGCAGGAGTTGG + Intronic
1175628249 20:60508167-60508189 GAAATAATGACACATGTAGAAGG - Intergenic
1177500818 21:21952122-21952144 GAAAATATGATAGCTTTACATGG + Intergenic
1179409722 21:41153452-41153474 AAAATGATTAGAGCTGTGGAAGG + Intergenic
1181688939 22:24547639-24547661 CACATTCTGAGGGCTGTAGAAGG + Intronic
1183001669 22:34864815-34864837 TTAATTATGAGATCTGGAGAAGG - Intergenic
1183622740 22:38983945-38983967 GAAATTCTCAGGGCTGTGGAGGG + Intronic
1183629157 22:39022693-39022715 GAAATTCTCAGGGCTGTGGAGGG + Intronic
956402834 3:68898078-68898100 GCAATCAGGAGAGCTGGAGAAGG + Intronic
958010146 3:87866781-87866803 GAATTTATTAGAGGTGTACATGG + Intergenic
958154671 3:89741104-89741126 GAAGTTTTTAGAGCAGTAGATGG + Intergenic
959236175 3:103725201-103725223 GAAATTTTGTGCACTGTAGAAGG + Intergenic
960571057 3:119185749-119185771 TAAATGTTGAGAGCTGTAGATGG + Intronic
960777566 3:121275775-121275797 GAAATTTTGAGAGATATATAGGG - Intronic
965537643 3:169840496-169840518 GAAATAAAAAAAGCTGTAGATGG - Intronic
967144493 3:186594999-186595021 GAACTCATGAGAGCTGTGCATGG + Intronic
969707858 4:8821501-8821523 GAAATGATGTGGGCTGGAGAAGG + Intergenic
970344709 4:15142256-15142278 GAAATTCTGGGATCTGTTGATGG + Intergenic
971170022 4:24224350-24224372 GAAATAAAGAGAGCTCTGGAAGG + Intergenic
973670127 4:53208663-53208685 GGAATTATGAGAGGTGTATATGG - Intronic
974334742 4:60527459-60527481 GAAATTATGAGTGTACTAGATGG + Intergenic
974509527 4:62820326-62820348 GACATTATGGCAGCTTTAGAAGG + Intergenic
976489268 4:85649410-85649432 GAAATTCTCACAGCTGTAAATGG + Intronic
977598404 4:98909727-98909749 AAAAAAATGAGAGCTGAAGATGG - Intronic
978040936 4:104061099-104061121 GAAATCCAGAGATCTGTAGAGGG - Intergenic
978758072 4:112325726-112325748 CCAATTATGAGAGCAGCAGATGG - Intronic
979670951 4:123359734-123359756 GAGAGTAGGAGAGCTGCAGATGG - Intergenic
979872347 4:125839995-125840017 GAAATTATGAAAACTGTAATAGG - Intergenic
980559392 4:134453278-134453300 GAGATTAAGAGATCTGTAGCTGG + Intergenic
980633226 4:135465747-135465769 GAAATTATGAGATCTGTGCTAGG + Intergenic
983683748 4:170383094-170383116 AATATTATTAGAGCTATAGATGG - Intergenic
984859421 4:184223807-184223829 AAAAATATGAGACCTGAAGAAGG + Intergenic
984898220 4:184560996-184561018 CACATTATTAGAGCTGTAAAAGG - Intergenic
985039285 4:185872833-185872855 AAAATAATGGGAGGTGTAGAGGG - Intronic
985280000 4:188276672-188276694 AAAATCATGAGTGGTGTAGAAGG + Intergenic
986548113 5:8921915-8921937 GAAATTATAAGAGTTCCAGAGGG + Intergenic
986810414 5:11352355-11352377 GAAACTATGAGAGCTATTTAAGG - Intronic
987229127 5:15874271-15874293 AAAATAATAAGAGCTGTATATGG + Intronic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
992299393 5:75363087-75363109 GCAAGTTTGAGAGCTGCAGAGGG + Intergenic
992302357 5:75396163-75396185 GAAATTACCAGAGATTTAGAAGG + Intronic
992536356 5:77708267-77708289 GAAAAAATGAGAGCTGAAGACGG - Exonic
993437261 5:87913090-87913112 GACATTATGAGAGTTGCAGAAGG + Intergenic
995537469 5:113151811-113151833 GAAAATATGAAAGCTGAATAGGG + Intronic
996191900 5:120554812-120554834 GAAATTATGAGAGGTGTTTCTGG - Intronic
996465264 5:123794554-123794576 GGAGTTCTGAGAGCTGGAGATGG + Intergenic
997238132 5:132287137-132287159 GAAATCATGAGAGCAGGAAAGGG - Intronic
997670337 5:135666175-135666197 GAAGTTATGAGAGCTGGCCAGGG - Intergenic
998044398 5:138974641-138974663 GAAAGTATGAAAGCTGGAGAGGG + Intronic
998949620 5:147379779-147379801 TAAATTATCATAGCTGGAGACGG - Intronic
999269568 5:150288928-150288950 GAAATCAGGAAAGCTGTAGCGGG - Intronic
999809857 5:155117394-155117416 GAATTTATGTCAGCTGGAGAAGG + Intergenic
999909348 5:156180701-156180723 CAAATTATGAGACTTGAAGAGGG + Intronic
1000134936 5:158338221-158338243 GAAATTATCAGAGATAAAGAGGG - Intergenic
1000593394 5:163185672-163185694 GAAACTGTGCAAGCTGTAGAAGG - Intergenic
1001928083 5:175653687-175653709 GAAATTTTGAGAGCTGGACAGGG + Intergenic
1003958126 6:11184992-11185014 GAAATTCAGGGAGCTGGAGAGGG - Exonic
1004542227 6:16562025-16562047 GAAATGATCAGAGCAGTAGAGGG + Intronic
1009591315 6:65674172-65674194 CACATTATGAGAGTTTTAGAAGG + Intronic
1010927342 6:81758897-81758919 AAACTTATGGCAGCTGTAGAAGG + Intergenic
1012268731 6:97180897-97180919 GAAATGAAGAGAGATGTAGTTGG - Intronic
1012361395 6:98385439-98385461 GAAATTCTGAGATCTCTAGCTGG + Intergenic
1012890448 6:104891361-104891383 GAAATTATGAAAGCCTTACAGGG - Intergenic
1013776645 6:113686288-113686310 GAAATGATAAGAGTGGTAGATGG + Intergenic
1014390231 6:120852770-120852792 AAAATTATGAGTGCTACAGAGGG + Intergenic
1014522018 6:122455857-122455879 TAAATTATTAGAGTTTTAGATGG - Intronic
1014637740 6:123869394-123869416 GGGAGTATGAGAGCTGCAGAAGG - Intronic
1014872996 6:126619631-126619653 GAAATTAGAAGAGCTGTTTATGG + Intergenic
1015035102 6:128644205-128644227 GAAATTCTGAGAGCTAAAGATGG - Intergenic
1016225655 6:141733003-141733025 TAAAATATGACAGCTATAGATGG + Intergenic
1016852421 6:148634654-148634676 GAAATTATTAGAACTGGAAAGGG - Intergenic
1017653207 6:156601774-156601796 GATATTATGGGAGCTGGAGAGGG - Intergenic
1020787719 7:12591316-12591338 TAGATTATGAGAACTGTGGACGG + Intronic
1022143257 7:27512062-27512084 GTAACTAGGAGAGCTGTGGATGG + Intergenic
1022647254 7:32242889-32242911 GAGAGAATGAGAGCTGTACAAGG + Intronic
1023725147 7:43135627-43135649 GAAAAGATGATAGGTGTAGATGG - Intronic
1024260507 7:47570794-47570816 AAAATGATAAGAGCTTTAGAAGG - Intronic
1024858181 7:53806039-53806061 GAAATTATAAGACCTGAGGAGGG - Intergenic
1028074155 7:86490510-86490532 GAAATAAGGAGAGCTTGAGATGG - Intergenic
1028192830 7:87872594-87872616 GAAATGATGAGAGTAGTAAATGG - Intronic
1031948552 7:127867318-127867340 AAAGTTATCAGAGTTGTAGAAGG - Intronic
1032951074 7:136913784-136913806 GAAATGATCAAAGGTGTAGATGG + Intronic
1037402879 8:18510578-18510600 GAAATTAAGATAGCTATAGAAGG + Intergenic
1038356341 8:26832545-26832567 GAAATTAAGGAAGCTGAAGATGG + Intronic
1041330937 8:56724259-56724281 CAAATAATAGGAGCTGTAGAAGG + Intergenic
1042838208 8:73096742-73096764 GATGCTATGAGGGCTGTAGAGGG + Intronic
1043200082 8:77357348-77357370 TAAATAATAAGAGCAGTAGACGG - Intergenic
1044323151 8:90828944-90828966 GAAATTATGAAAGTTTTATAAGG - Intronic
1046228169 8:111314177-111314199 GAAAGCCTGAGGGCTGTAGATGG + Intergenic
1046520207 8:115315524-115315546 GTAATTGTGAGAGATGAAGATGG - Intergenic
1048195004 8:132325215-132325237 CTAATCATGAGAGCTGCAGATGG + Intronic
1050140762 9:2513526-2513548 AAGATTGTGAGAACTGTAGAGGG - Intergenic
1050400215 9:5245331-5245353 TAAATTATGAGAGTCCTAGAAGG + Intergenic
1050447139 9:5736606-5736628 GAACTTCAGAGAGCTGTAGAGGG + Intronic
1051823752 9:21196155-21196177 GAAATTCAGAGAGCAGGAGATGG - Intergenic
1051825571 9:21214684-21214706 GAAATTCAGAGAGCAGGAGATGG - Intronic
1051826368 9:21224784-21224806 GAAATTCAGAGAGCAGGAGATGG - Intronic
1051827547 9:21236761-21236783 GAAATTCAGAGAGCAGGAGATGG - Intronic
1052415787 9:28175389-28175411 GAAGTTGTGAGAGCTTTGGAAGG - Intronic
1056119700 9:83475347-83475369 GAAATTAAGAATGCTATAGATGG + Intronic
1059761356 9:117340626-117340648 GATTTTATGAGAGCTGTCCAAGG - Intronic
1186213838 X:7278652-7278674 GATGTTGTGAGAGCTGCAGAAGG + Intronic
1187450517 X:19392278-19392300 CAGATCATGAGAGCTGTCGATGG - Intronic
1187875228 X:23798373-23798395 GAAATTAGAAAAGATGTAGAAGG + Intergenic
1188330650 X:28867008-28867030 GACAATATGAGAGTTGAAGAAGG + Intronic
1188683533 X:33041506-33041528 GAAAAAATGAGAGCTGAAGATGG + Intronic
1191778944 X:64846571-64846593 TAAATTGTGAGGGCTGTGGATGG - Intergenic
1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG + Intergenic
1194613537 X:96073734-96073756 AAAATTATTAGAGTTGTAGAAGG - Intergenic
1195016845 X:100789251-100789273 AAAGTTATGGGAACTGTAGAGGG + Intergenic
1196046565 X:111261925-111261947 GAAATTAAGAGAGGTGTATTGGG - Intronic
1196497087 X:116334537-116334559 GAAGTTATGAGAACTGTAGAGGG - Intergenic
1196846326 X:119899379-119899401 AAAATGAGGATAGCTGTAGAAGG + Intronic
1198160004 X:133998817-133998839 CTAATTATGAGAACTATAGATGG + Intergenic
1198801862 X:140456382-140456404 GACATTATCAGAGCTATATATGG + Intergenic
1198967218 X:142240187-142240209 GACACTATCAGAGATGTAGAAGG - Intergenic
1198982220 X:142411430-142411452 GACATTATTAGAGCTAAAGATGG + Intergenic