ID: 1155175532

View in Genome Browser
Species Human (GRCh38)
Location 18:23298245-23298267
Sequence TCACCTCCCATGTGTACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155175532_1155175541 14 Left 1155175532 18:23298245-23298267 CCTCAGGTACACATGGGAGGTGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1155175541 18:23298282-23298304 GGGCTCGATACCTTCCCTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1155175532_1155175538 -6 Left 1155175532 18:23298245-23298267 CCTCAGGTACACATGGGAGGTGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1155175538 18:23298262-23298284 AGGTGAGAAGGCAGGGAGGCGGG 0: 1
1: 0
2: 36
3: 442
4: 3242
1155175532_1155175539 12 Left 1155175532 18:23298245-23298267 CCTCAGGTACACATGGGAGGTGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1155175539 18:23298280-23298302 GCGGGCTCGATACCTTCCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 32
1155175532_1155175536 -10 Left 1155175532 18:23298245-23298267 CCTCAGGTACACATGGGAGGTGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1155175536 18:23298258-23298280 TGGGAGGTGAGAAGGCAGGGAGG 0: 1
1: 2
2: 10
3: 198
4: 1618
1155175532_1155175540 13 Left 1155175532 18:23298245-23298267 CCTCAGGTACACATGGGAGGTGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1155175540 18:23298281-23298303 CGGGCTCGATACCTTCCCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1155175532_1155175537 -7 Left 1155175532 18:23298245-23298267 CCTCAGGTACACATGGGAGGTGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1155175537 18:23298261-23298283 GAGGTGAGAAGGCAGGGAGGCGG 0: 1
1: 3
2: 31
3: 229
4: 1917
1155175532_1155175542 21 Left 1155175532 18:23298245-23298267 CCTCAGGTACACATGGGAGGTGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1155175542 18:23298289-23298311 ATACCTTCCCTTGGGGAAGAAGG 0: 1
1: 0
2: 2
3: 14
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155175532 Original CRISPR TCACCTCCCATGTGTACCTG AGG (reversed) Intronic
900814383 1:4832185-4832207 TCACCTTCCAGGTGCACCTCTGG - Intergenic
901184855 1:7366348-7366370 TCACCTCCCCTGTGTCCATGTGG - Intronic
902194557 1:14788777-14788799 TGACCTCCCACGTGTACAAGTGG - Intronic
902863431 1:19261857-19261879 TTCCCTACCATGTGTAGCTGTGG + Intergenic
903214104 1:21833668-21833690 CCACCTCCCATCTGTGCCTCAGG + Intronic
903566588 1:24271349-24271371 TCAGCTCCTCTTTGTACCTGTGG + Intergenic
903693027 1:25187449-25187471 TCATCTCCCCTGTGGACCTGAGG - Intergenic
904935515 1:34127193-34127215 TTAGCTCCCATGGGGACCTGGGG - Intronic
905212200 1:36382013-36382035 TGAGCTCCCATGTGTGGCTGGGG - Intronic
906031575 1:42724717-42724739 TAATATCCCATGTGCACCTGAGG - Intergenic
907371935 1:54009458-54009480 TCACCTGCCATGACTGCCTGAGG + Intronic
908904215 1:68989355-68989377 TCAGCTCCTCTTTGTACCTGTGG - Intergenic
911213064 1:95163340-95163362 TCAGCTCCATTGGGTACCTGAGG + Intronic
912925805 1:113911958-113911980 TCATCTCCCATGGGTACCAAGGG - Exonic
912978352 1:114349353-114349375 TCACCCCACATTTGTCCCTGGGG - Intergenic
916511640 1:165476903-165476925 GCAACTCCCATGTGGTCCTGTGG - Intergenic
917523611 1:175768179-175768201 TCACCTGCCCTCTGTACCGGAGG - Intergenic
918297260 1:183168788-183168810 TCTCCTCCCATGTCAACCTAAGG - Intergenic
921167708 1:212518835-212518857 TCACTCCCCGTGTGTAACTGGGG - Intergenic
922469333 1:225866291-225866313 TCCCCTCCCCTGTGAAGCTGTGG + Intronic
922796470 1:228342041-228342063 TGACCTGCCAGGTGCACCTGGGG + Intronic
1063981315 10:11454248-11454270 TCACTTCCCACTTGTGCCTGTGG + Intronic
1066998637 10:42585957-42585979 TCTCTTTCCATGTGAACCTGTGG + Intronic
1067677543 10:48397509-48397531 ACTCCTCCCAAGTCTACCTGCGG - Intronic
1069227409 10:65960739-65960761 TCACCTCCCACTTGTAAGTGAGG + Intronic
1069371660 10:67754229-67754251 TCAGCTCCCACTTGTACATGCGG - Intergenic
1070601532 10:77869503-77869525 CCACACCCCATGTTTACCTGGGG - Intronic
1070853873 10:79590018-79590040 CCAGCTCCCCTTTGTACCTGTGG - Intergenic
1071365552 10:84896852-84896874 TCACTGGCCATGTGCACCTGGGG + Intergenic
1076731792 10:132442853-132442875 TCGCTGCCCATGTGAACCTGTGG - Intergenic
1077081696 11:727273-727295 TGGCCTCCCCTGTGCACCTGGGG + Exonic
1079752877 11:24220648-24220670 TCACCTCCTCTTTGTACCTCTGG - Intergenic
1081003139 11:37699708-37699730 TCTCCACCCATGTGGAACTGTGG - Intergenic
1081775170 11:45671465-45671487 CCACCTCCGATGTCTGCCTGTGG - Intergenic
1083151650 11:60795414-60795436 TCAGCTCCCAGGTGTGCGTGGGG - Intronic
1083724226 11:64619976-64619998 GCAGCTCCCATGAGTCCCTGGGG - Intronic
1089596231 11:119582493-119582515 GCATCTCCCATGTGTACATGAGG - Intergenic
1090500087 11:127252708-127252730 TCACTCCCCATGTGCACATGGGG - Intergenic
1090519480 11:127463059-127463081 TCACCTCCCATGTTCATCTCAGG + Intergenic
1090913064 11:131138457-131138479 TCACCTCACATCTGTATCCGAGG + Intergenic
1091999993 12:5024066-5024088 TCTGCTCCCATTTGTCCCTGTGG + Intergenic
1092847759 12:12600128-12600150 CCACCTCCCAGGGGCACCTGTGG + Intergenic
1095510011 12:42941044-42941066 CCAGCTCCTATTTGTACCTGTGG + Intergenic
1096036682 12:48477810-48477832 TCATCTCCCCTTTGTACCTCTGG - Intergenic
1097749883 12:63340426-63340448 CCACCTCCTCTGTGTACCTCTGG - Intergenic
1098014147 12:66086597-66086619 TCTCCTCTTATGTGTACCTCTGG + Intergenic
1098378620 12:69844361-69844383 CCACCTCCTATTTCTACCTGGGG + Intronic
1102010967 12:109618079-109618101 TCACCTCCCACCAGGACCTGAGG + Intergenic
1104628842 12:130382250-130382272 TCACTTCCCATGTGGACCTTGGG + Intergenic
1107928135 13:45283495-45283517 TCAGCTCCCATGTGTTTTTGTGG - Exonic
1112043403 13:95571150-95571172 TTACCTACCATGTGTCACTGTGG - Intronic
1112312893 13:98335286-98335308 TCCCCAGCCATGTGGACCTGTGG - Intronic
1112498209 13:99922242-99922264 TCATTTTCCATGTGTCCCTGTGG - Intergenic
1113162773 13:107401171-107401193 TCACCTACCAGGTGAAACTGAGG - Intronic
1114223078 14:20714246-20714268 TCCCCTCCCATGTGGTACTGGGG - Intergenic
1115068685 14:29295950-29295972 TCCCCAGCCATGTGTAACTGTGG - Intergenic
1116035772 14:39625603-39625625 TCATCTCCCATGTATACATGGGG - Intergenic
1116307372 14:43275317-43275339 CCACTTCCCATGTGGACATGTGG - Intergenic
1117163763 14:53014284-53014306 GTATCTCCCATGTATACCTGAGG - Intergenic
1117892953 14:60446612-60446634 TCAGCTCCTCTTTGTACCTGTGG - Intronic
1118065314 14:62184474-62184496 TCACCTCCCACGTGATTCTGAGG + Intergenic
1118066832 14:62201701-62201723 TCAGCTCCCCCGTGTACCTCTGG + Intergenic
1118734944 14:68694638-68694660 GCACCTCCCACTTGGACCTGCGG + Intronic
1122424212 14:101596284-101596306 CCACTTCCCATGTCTACTTGGGG - Intergenic
1123097732 14:105774351-105774373 CCACCTGCCCTGTGCACCTGTGG + Intergenic
1125332643 15:38597325-38597347 TCACCTTCCATGTCGACCAGGGG - Intergenic
1129111467 15:73339722-73339744 TCAGCTCTCATGTGGACCTAGGG + Intronic
1130996837 15:88908806-88908828 TTACCTCCCAAGTGGCCCTGGGG - Intronic
1131507706 15:93031633-93031655 TCACCTCTCACCTGCACCTGTGG - Intergenic
1132869632 16:2110073-2110095 GCACCTACCATGTGCAGCTGCGG - Exonic
1133068447 16:3227872-3227894 TAAACTCCCATGTGTATTTGAGG + Intronic
1133233773 16:4378457-4378479 TCACCCCCCATATGGACATGGGG + Intronic
1133479930 16:6160442-6160464 TCACTTCCCTTTTGTATCTGGGG + Intronic
1134350413 16:13432294-13432316 TCACCTGCCCAGTGTTCCTGGGG - Intergenic
1134717784 16:16365526-16365548 GCACCTACCATGTGCAGCTGCGG + Intergenic
1136293698 16:29290304-29290326 TCAACTCCCACGTATTCCTGGGG + Intergenic
1136580016 16:31145785-31145807 TCACCTGGCAGGTGTCCCTGCGG + Exonic
1141548289 16:84786971-84786993 TCATCACTCATGTGCACCTGTGG - Intergenic
1142099581 16:88264310-88264332 TCAACTCCCACGTATTCCTGGGG + Intergenic
1142386976 16:89771670-89771692 ACACCTACCATGTGTTCCCGTGG + Exonic
1146937472 17:36821251-36821273 TCACCCACCCTGTGTCCCTGTGG + Intergenic
1150457224 17:65316404-65316426 TCGCCTCCCTTTTGTACCAGTGG - Intergenic
1151878975 17:76883472-76883494 TCACACCTCATGTGTCCCTGGGG - Intronic
1152428890 17:80236473-80236495 TCACCTCCCTTGTTTCCCTGTGG + Intronic
1153561247 18:6374016-6374038 TCATCTTCCATGTGTATCAGTGG + Intronic
1154057768 18:11028015-11028037 TAACCTGCCAAGTGTCCCTGTGG + Intronic
1154111121 18:11569332-11569354 TCACTGCCCCTGTGTACCAGTGG - Intergenic
1155175532 18:23298245-23298267 TCACCTCCCATGTGTACCTGAGG - Intronic
1155476571 18:26241162-26241184 GCAGCTCCCATTTGTACCTCTGG + Intronic
1156527255 18:37778594-37778616 CCACCTCCCTTCTGCACCTGAGG + Intergenic
1158481237 18:57823699-57823721 TCACCTTCCCTATGCACCTGTGG - Intergenic
1163732716 19:18959190-18959212 TCAGCCCCCATGAGTAGCTGGGG + Intergenic
1164820930 19:31250912-31250934 TCACCACCTAGATGTACCTGTGG + Intergenic
1164829323 19:31308618-31308640 ACACTACCCCTGTGTACCTGTGG - Intronic
1167120798 19:47515264-47515286 TCACCTCCCACGTGACCCTGTGG + Intergenic
926119734 2:10235459-10235481 GCACCTCCCAGGTGCACATGAGG - Intergenic
930747458 2:54899635-54899657 TCTCCTTCCATGTGCCCCTGTGG - Exonic
933118819 2:78509497-78509519 TCAGCTCCCATGTATAAGTGAGG - Intergenic
935584561 2:104789057-104789079 TCACCACCCAGGTGAGCCTGTGG + Intergenic
936460793 2:112712645-112712667 GCATCTCCCATGGGTCCCTGGGG + Intergenic
936473751 2:112822117-112822139 TCACCTCCTATTTGTACCCCAGG + Intergenic
939947306 2:148425449-148425471 TCACCTCCTCTTTGTACCTCTGG - Intronic
941461240 2:165774196-165774218 TCACCTCCTTTCTGTTCCTGAGG + Intronic
945023958 2:205602454-205602476 TCAGCTCCTCTTTGTACCTGTGG + Intronic
945969450 2:216221609-216221631 TCACCTCACCTGAGGACCTGTGG + Intergenic
948392437 2:237622231-237622253 TCACATGCCATGTGTGCCTCTGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170964189 20:21052023-21052045 TGACCTCCCAAGTCAACCTGAGG - Intergenic
1172288599 20:33758801-33758823 TCACCACGCATGTGTACCTTCGG - Exonic
1174188033 20:48720878-48720900 GCACCTCCCATGTCTGTCTGTGG - Intronic
1174200721 20:48804726-48804748 TCACCTCCCATGGGTAGCCCCGG - Intronic
1176693905 21:9950173-9950195 TTGTCTCACATGTGTACCTGTGG + Intergenic
1181396791 22:22628728-22628750 TCACCCCCCAGGTGTGCCTGTGG + Intergenic
1181499485 22:23307776-23307798 TCAACCCCCAGGTGTGCCTGTGG + Intronic
1181704914 22:24644286-24644308 TCACCCCCCAGGTGTGCCTGTGG + Intergenic
1181733838 22:24866868-24866890 TCACCTCCCATATGAACTGGGGG + Intronic
1182745448 22:32602252-32602274 TCACCTCCCCAGTGTGTCTGGGG + Intronic
1184012926 22:41762923-41762945 TCACCTCCCAAGTGTGAATGAGG + Intronic
1184441807 22:44521540-44521562 CCACCTCCCATGTGGCCCAGAGG + Intergenic
950026836 3:9825879-9825901 TCCCCTTCCATGTCTATCTGGGG - Exonic
950746937 3:15098170-15098192 TCACTTCACGTATGTACCTGCGG - Exonic
950916360 3:16649893-16649915 TCACCTCCCATTTTTACCAAAGG - Intronic
952766441 3:36958114-36958136 TCACCTCCCATGTGTAAACCTGG + Intergenic
954764039 3:52897749-52897771 TCACCTGGCCTGTCTACCTGCGG - Intergenic
954907795 3:54077497-54077519 CCATCTCCAATGTGTCCCTGAGG - Intergenic
956695565 3:71916378-71916400 TCAGCTCCCATGTCAACCTTGGG + Intergenic
956904360 3:73750314-73750336 TGACCCCCAAGGTGTACCTGGGG - Intergenic
957739545 3:84247079-84247101 TCACCTCAGATGTGTACCACTGG + Intergenic
961174361 3:124821583-124821605 CCCCTTGCCATGTGTACCTGGGG + Intronic
965765711 3:172128118-172128140 TCACCTACAATGTGTACCCTTGG + Intronic
968883184 4:3311913-3311935 TCACATCCCATCTGTGCCTCAGG + Intronic
970398118 4:15691395-15691417 GCACCTGCCCTCTGTACCTGGGG + Intronic
970601430 4:17643559-17643581 TCCCCTCCCATTGGTACCAGTGG + Intronic
971033025 4:22661384-22661406 TCACTTCACATGTGTGCATGTGG + Intergenic
971056457 4:22918832-22918854 TCACCTCACATAGATACCTGTGG + Intergenic
971265677 4:25094368-25094390 TCACCTTCCTTCTGTCCCTGGGG - Intergenic
971589857 4:28453517-28453539 TCCCCTGCCATGTGTCCATGTGG + Intergenic
973217819 4:47690703-47690725 TCTCCTCTCATGAGTATCTGTGG + Intronic
973303387 4:48615271-48615293 TCACCTCCCATGTGGACCTTTGG + Intronic
974876604 4:67710407-67710429 TCACCTCCCAAGTGTAACGAGGG - Intergenic
976224585 4:82785559-82785581 TTACCTCCCATGTATACCTGAGG + Intronic
979811015 4:125036276-125036298 TCCCCAGCCATGTGTAACTGAGG - Intergenic
980366528 4:131810370-131810392 TTGTCTCACATGTGTACCTGTGG + Intergenic
980681065 4:136160890-136160912 TCACCTCACATATTTATCTGTGG + Intergenic
986885931 5:12235820-12235842 TCACCAGCCATGTGGAACTGTGG + Intergenic
988911738 5:35850349-35850371 TCACCACAAATTTGTACCTGAGG + Intergenic
991072329 5:62497935-62497957 TCATATCCCATGTTTACATGTGG + Intronic
991614616 5:68483030-68483052 TCATATCCCCTGTGTACATGGGG + Intergenic
993984246 5:94578369-94578391 TCACCTCCTATTTCTAGCTGTGG - Intronic
996082881 5:119274694-119274716 TTCCCTGCCCTGTGTACCTGTGG + Intronic
998515588 5:142750856-142750878 TCACCTCCCCTGAGTCACTGGGG - Intergenic
1003598863 6:7500238-7500260 GGACTTCCCATGTGTCCCTGAGG - Intergenic
1004271994 6:14203897-14203919 TCACCTTCCATGGGTTCCTGGGG - Intergenic
1004742148 6:18472466-18472488 TCATCTCCCATCTGTACATTGGG - Intergenic
1007000515 6:38307928-38307950 TCACCTCACTTCTGTCCCTGGGG - Intronic
1007497188 6:42268310-42268332 TGAGCTCCCATGGGGACCTGGGG - Exonic
1007622847 6:43225466-43225488 CCTCCTCCCAAGTGTTCCTGGGG + Intergenic
1009746605 6:67825208-67825230 TCACCTCTCAGGTTTACTTGGGG - Intergenic
1014180955 6:118383788-118383810 TCAATTCCAATCTGTACCTGGGG + Intergenic
1017642526 6:156508132-156508154 TCACCTCCCATTTGTTCCCGAGG + Intergenic
1017967107 6:159276310-159276332 TCAGCTCCCATGGGTGACTGGGG - Intergenic
1018711870 6:166503231-166503253 TCAACTCACATGTGTGCCTGTGG + Intronic
1019053249 6:169200805-169200827 ACACATCCTCTGTGTACCTGGGG - Intergenic
1019628058 7:2031326-2031348 CCACCACCCACGTGTAGCTGTGG + Intronic
1023101922 7:36726611-36726633 TCACCTCCCTTTTCTAGCTGAGG - Intergenic
1024641046 7:51328881-51328903 TCACCTCCCAGGTGGAGATGTGG + Intergenic
1032292447 7:130600916-130600938 TCACCTCTCATGTATTCCTTTGG - Intronic
1035917103 8:3636530-3636552 TAACCTACCATCTGTTCCTGAGG + Intronic
1036939683 8:13039557-13039579 TCACCTCCCATTAGAACCCGTGG - Intergenic
1039044619 8:33438676-33438698 TCCCCAGCCATGTGTAACTGTGG - Intronic
1039429002 8:37511169-37511191 TCACCTCCCAACTGTAAATGGGG + Intergenic
1042245420 8:66705261-66705283 TCAGTTCCCATGTGTATCTGAGG + Intronic
1045615266 8:103901590-103901612 TAAGCTCCTATTTGTACCTGTGG + Intronic
1045959244 8:107947904-107947926 TCACCTCCCTTGGGTGCATGAGG + Intronic
1046814126 8:118565269-118565291 TCCCCAACCATGTTTACCTGTGG - Intronic
1047512814 8:125528711-125528733 GCACATCCCATGGGTTCCTGAGG - Intergenic
1047616731 8:126568723-126568745 TAACCTCCAATGTGTTGCTGTGG - Intergenic
1047906246 8:129476269-129476291 TGTCATCCCATCTGTACCTGGGG - Intergenic
1048304604 8:133275000-133275022 GCAACTCCCATGTGAATCTGAGG + Intronic
1050826076 9:9948178-9948200 TCACCTTCCTTGTGAACATGAGG + Intronic
1051658093 9:19401681-19401703 TCACCAGCCATGTGGAACTGTGG + Intergenic
1052488317 9:29130945-29130967 TCACAACACATGTGAACCTGTGG + Intergenic
1053630876 9:39936273-39936295 TTGTCTCACATGTGTACCTGTGG + Intergenic
1053774892 9:41527232-41527254 TTGTCTCACATGTGTACCTGTGG - Intergenic
1054213011 9:62314425-62314447 TTGTCTCACATGTGTACCTGTGG - Intergenic
1056030602 9:82549463-82549485 TCACCTGCCATGGCTTCCTGAGG + Intergenic
1057857316 9:98611436-98611458 TCACATCCCAAGTGCACCCGAGG + Intronic
1060602657 9:124888450-124888472 TCCCCTTCCCTGTGTACCTGTGG - Intronic
1060732643 9:126048133-126048155 TCACCAGCCATGTGAACCTCAGG - Intergenic
1062138776 9:134944111-134944133 TCACCTCCCAGGTTTCCCTGAGG + Intergenic
1187665174 X:21600030-21600052 TCACTTCCCAAATGTACCTGAGG + Intronic
1188382026 X:29506770-29506792 TCACCTCCCCTTTGTATCTCTGG + Intronic
1188797219 X:34481695-34481717 ACTCCTCCCCTGTGCACCTGAGG + Intergenic
1189227946 X:39429199-39429221 TTACCTCCCACTTGTACCAGAGG + Intergenic
1190558093 X:51658121-51658143 CATCCTCCCATGTGAACCTGGGG - Intergenic
1191161789 X:57337319-57337341 TCAGCTCCTCTTTGTACCTGTGG - Intronic
1191729095 X:64314708-64314730 TGACCGCACATGTGTACGTGGGG - Intronic
1191864535 X:65693189-65693211 TCTCCTTCCATGTATACATGGGG + Intronic
1192061634 X:67833474-67833496 TCAGCTCCTGTTTGTACCTGTGG - Intergenic
1192075564 X:67992320-67992342 TCACCTCCTCTTTGTACCTCTGG - Intergenic
1193094459 X:77531196-77531218 TCAGCTCCTCTTTGTACCTGTGG - Intronic
1193512076 X:82414974-82414996 TCACCATCCATGTTTACATGGGG + Intergenic
1199364755 X:146967890-146967912 GCACTTCTCATGTGTCCCTGTGG - Intergenic