ID: 1155177008

View in Genome Browser
Species Human (GRCh38)
Location 18:23309763-23309785
Sequence CACAAGGTCATCATACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155177006_1155177008 9 Left 1155177006 18:23309731-23309753 CCAGCTGTGATTATCTGTAGAAA 0: 1
1: 0
2: 4
3: 16
4: 170
Right 1155177008 18:23309763-23309785 CACAAGGTCATCATACCAGCAGG 0: 1
1: 0
2: 1
3: 2
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155177008 Original CRISPR CACAAGGTCATCATACCAGC AGG Intronic
904776780 1:32913849-32913871 CACAAAGTCATCATGACAGTTGG + Intergenic
905400913 1:37702595-37702617 CACAAGGACAGAATTCCAGCTGG + Intronic
905877194 1:41439815-41439837 CACAAGGTCTTGCTTCCAGCTGG - Intergenic
907084855 1:51662064-51662086 CACAAGGTGACCATACGACCTGG - Intronic
909029366 1:70521870-70521892 CACGAGGTCACGATATCAGCAGG + Intergenic
914831640 1:151174857-151174879 CACCATGTCATCATATCAGAAGG - Exonic
915025594 1:152826743-152826765 CAAAGGGTCATCATATGAGCTGG - Intergenic
918433496 1:184486736-184486758 AACAGGCTCATGATACCAGCTGG - Intronic
920505634 1:206513469-206513491 GAGAAGGAAATCATACCAGCTGG - Intronic
922617733 1:226973071-226973093 CAAAGGGGCATCATGCCAGCAGG - Intronic
923010033 1:230081246-230081268 CACTCGGTCCTCACACCAGCTGG - Intronic
1069579012 10:69552442-69552464 CACAAGGTCAGGCTACCAGCTGG + Intergenic
1071431479 10:85610421-85610443 AACAAAGTCATCATACCTCCTGG - Intronic
1074709259 10:116163583-116163605 CACAAGGCCACCATCCCCGCGGG + Intronic
1076450373 10:130553134-130553156 CCCAAGGTCACTATCCCAGCAGG - Intergenic
1078918858 11:15808090-15808112 CACCAGGCCATCAGCCCAGCAGG + Intergenic
1081084962 11:38787846-38787868 CACATGGCCATCAGAGCAGCTGG + Intergenic
1081506704 11:43724720-43724742 CACAAGGTGATGGTACTAGCAGG - Intronic
1085350687 11:75796309-75796331 CCCAAGGTCATCCTTGCAGCTGG + Exonic
1086937528 11:92761455-92761477 TCCAAGGTCAACATTCCAGCAGG + Intronic
1087161131 11:94949223-94949245 CACAAAGTCATGATACCGGATGG + Intergenic
1087287990 11:96286888-96286910 TACATGGTCACCATATCAGCCGG + Intronic
1102218754 12:111180119-111180141 CACAAGGTCAGAAGCCCAGCAGG - Intronic
1103268147 12:119648285-119648307 CACAAGGTCAACATCCTAGGGGG - Intergenic
1103440273 12:120957808-120957830 CCCAAGGGGATCACACCAGCTGG + Intergenic
1106339524 13:28815654-28815676 CACAAGGACATAATACCACTTGG - Intergenic
1110065976 13:71105879-71105901 CTCCAGGTCAGCATAACAGCAGG - Intergenic
1111020310 13:82439623-82439645 CATAAGGTCAACACATCAGCTGG - Intergenic
1122124428 14:99571400-99571422 CACTTGGTCATCACAGCAGCTGG - Intronic
1123389441 15:19854800-19854822 CACCAAGTCATGATACCAGAAGG - Intergenic
1125024195 15:35013967-35013989 TCCAAGATCAACATACCAGCAGG - Intergenic
1127509112 15:59622824-59622846 CACAGGGTCTTCATATCAGAGGG + Intronic
1129087143 15:73106678-73106700 CCCAAAGTCATGATGCCAGCTGG - Intronic
1131052074 15:89355089-89355111 CAAAAAGTCATCATACAACCAGG + Intergenic
1131992640 15:98105705-98105727 CACCAAGTCAGCATCCCAGCTGG + Intergenic
1132098290 15:99004769-99004791 CACCAAGTCAGCATCCCAGCTGG - Intronic
1133065380 16:3202999-3203021 AACAAGATCAGCATCCCAGCTGG + Intergenic
1135360834 16:21813358-21813380 CACAAGGTCATCATACCTACAGG + Intergenic
1139962204 16:70724474-70724496 CACAAGGTCATCTTTTCACCTGG + Intronic
1143106293 17:4532053-4532075 CTCAAAGTCATCATCCCATCTGG + Intronic
1146624615 17:34425765-34425787 CACAAGGTCATAAAGCAAGCTGG - Intergenic
1148044212 17:44732525-44732547 AACAGGATCATCATACTAGCTGG - Intronic
1151412928 17:73943003-73943025 CACAAACCCATCATACCTGCTGG - Intergenic
1152677752 17:81650525-81650547 CCCAAGCTCATCACACCAGGGGG - Exonic
1153769215 18:8401734-8401756 CACGAGGCCAGCACACCAGCGGG - Intronic
1153992190 18:10410410-10410432 TACAGGGACATCAGACCAGCTGG - Intergenic
1154998466 18:21663818-21663840 CAGAAGGTCAACATGGCAGCCGG + Intronic
1155177008 18:23309763-23309785 CACAAGGTCATCATACCAGCAGG + Intronic
1167627053 19:50597845-50597867 CTCAAAGTCATCATGACAGCTGG - Intergenic
925966915 2:9074975-9074997 CACAAGGACAACATATCACCTGG - Intergenic
926503648 2:13684303-13684325 CCCAAGGACATGATACCAGATGG - Intergenic
934096938 2:88615396-88615418 CCCAAGGTGATCATACCAGGAGG + Intronic
935867641 2:107408281-107408303 CAGAGGCTCATCATTCCAGCAGG - Intergenic
942959619 2:181814167-181814189 CAAAAGGTCTTCATAACAACAGG + Intergenic
1172792102 20:37512823-37512845 CACCAGGTCAGCCAACCAGCAGG + Intronic
1175996743 20:62815371-62815393 CACAGGGTCATCTTGCCAGGTGG + Intergenic
1182328915 22:29536464-29536486 CACAAGCTTATCACACCAACTGG + Intronic
1183792577 22:40084910-40084932 CACAAAGGCATGATACCAGGAGG - Intronic
949929593 3:9068283-9068305 CTCAAGGTCAACAGCCCAGCTGG + Intronic
956790348 3:72675346-72675368 CACAAGGGCATGATCCCAGGAGG - Intergenic
957404940 3:79765326-79765348 AACAAAGTCATCTTACCAACTGG + Intronic
961939038 3:130618170-130618192 CACAAGGGCCTCAGAGCAGCAGG + Intronic
963397436 3:144751343-144751365 CCCAAGGTCATCATATTAGGAGG - Intergenic
965469667 3:169075157-169075179 GACAAGGTCATGACACTAGCTGG + Intergenic
972410155 4:38785675-38785697 CACAAGGTCATCATCCAATAGGG + Intergenic
977177719 4:93836462-93836484 CATAAGGGCATCATTCCAGGAGG + Intergenic
977858687 4:101928369-101928391 CACAAGACACTCATACCAGCTGG - Intronic
982381029 4:154747530-154747552 CACTTGGTCAGCAGACCAGCAGG - Intronic
985009559 4:185568580-185568602 CACAAGGTCAGAATAGCAGTGGG + Intergenic
989340197 5:40365398-40365420 CACAAGGTCATGAGAACAGGAGG - Intergenic
994165962 5:96608455-96608477 CACAAAGTCATAATACAAACAGG - Intronic
997057393 5:130460485-130460507 CACCAGCTCATAAAACCAGCTGG + Intergenic
1000457916 5:161475010-161475032 CAAAATGTCAACACACCAGCTGG + Intronic
1000980513 5:167811971-167811993 CACAAGGACGTCATTTCAGCTGG + Intronic
1002278235 5:178116495-178116517 CACTAGGTCATCATGCCACTGGG + Intronic
1006500688 6:34457139-34457161 CACAGGGTCTTCTTTCCAGCTGG - Intergenic
1007594434 6:43042940-43042962 CACAAAGTCATCATCCCGCCAGG + Exonic
1010244733 6:73653161-73653183 CACAATGTCAAGATATCAGCTGG + Intronic
1012228621 6:96734490-96734512 CACAATGTAATCATTTCAGCAGG + Intergenic
1012550486 6:100460905-100460927 GACAGGGTCATCAGAACAGCTGG - Intronic
1016154899 6:140793405-140793427 CACAAGGACATCACATGAGCAGG - Intergenic
1017268807 6:152482116-152482138 GACAAGCTCATCAAACCAGATGG - Intronic
1022688608 7:32622466-32622488 TACAAAGTCATCCTGCCAGCTGG + Intergenic
1022859044 7:34346787-34346809 CACATGGGCATTATACCAGGAGG - Intergenic
1022916244 7:34957084-34957106 TACAAAGTCATCCTGCCAGCCGG + Intronic
1023155482 7:37247403-37247425 CACCAGGCCATCTTAGCAGCTGG + Intronic
1023316097 7:38938797-38938819 CACAGGGTCTGCATTCCAGCGGG - Intergenic
1023761746 7:43470528-43470550 CTCCTGGTCATCACACCAGCAGG + Intronic
1026661604 7:72307781-72307803 CACAAGATCATCCCAACAGCCGG + Intronic
1026723672 7:72854417-72854439 CACAAGGACCTCATGACAGCTGG + Intergenic
1029392961 7:100287726-100287748 AACAAGAACATCACACCAGCAGG - Intergenic
1030229610 7:107193582-107193604 CCCAAGGTCATATTACTAGCTGG + Intronic
1032197535 7:129798281-129798303 CACACTGTCATAATTCCAGCAGG + Intergenic
1033510786 7:142058288-142058310 CACCATCTCATCATACAAGCTGG - Exonic
1033513590 7:142084604-142084626 CACCATCTCATCATACAAGCTGG - Intronic
1036086296 8:5616725-5616747 CTCAAGGTCTTCATATCAGGAGG + Intergenic
1043513420 8:80972830-80972852 CAAAAGTTCATCACACTAGCAGG + Exonic
1043776290 8:84273542-84273564 CACAAGGACATGATACAAGGAGG + Intronic
1048691183 8:136965355-136965377 CACAAGATCTTCATACTAGTAGG - Intergenic
1056750025 9:89343003-89343025 CACAATGTCATCATATCAAGTGG - Intronic
1057636566 9:96774902-96774924 ACCAATGTCATCACACCAGCTGG + Intronic
1059912218 9:119057184-119057206 CACTAAGTCATCATAACAGTGGG - Intergenic
1061753379 9:132796121-132796143 CCCAAGGTCATCTAGCCAGCTGG + Intronic
1193259446 X:79388169-79388191 CACAAGGTCATCATTCAGCCAGG - Intergenic
1197768571 X:130074634-130074656 CACAATGGCATCATAACAGACGG - Exonic