ID: 1155181955

View in Genome Browser
Species Human (GRCh38)
Location 18:23355723-23355745
Sequence AGAATTGCTATGTAAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155181955 Original CRISPR AGAATTGCTATGTAAAAATC AGG (reversed) Intronic
905494434 1:38373485-38373507 AGAGTTATTATCTAAAAATCTGG + Intergenic
906361989 1:45168819-45168841 AGTTTTGCTATGTAGAAATTTGG - Intronic
908353304 1:63307625-63307647 AGAATTTCATTGTATAAATCAGG - Intergenic
910705890 1:90129226-90129248 AGAATAGCTATAGAAATATCAGG + Intergenic
910973080 1:92876536-92876558 AGAATTGCCATATAAAAGCCTGG - Intronic
912637455 1:111311167-111311189 AGAATTGCTTTGTAGAAGTCAGG + Intronic
913449459 1:118983378-118983400 AGACATTCTATGTAAAACTCCGG - Intronic
915194058 1:154176020-154176042 AGAATTGCTATTTAGAAAACAGG + Intronic
919018952 1:192078275-192078297 AGATTTGCTTTGTAAAATTGAGG - Intergenic
919081100 1:192866770-192866792 ATAGTTGCTTTGTCAAAATCAGG - Intergenic
919370522 1:196719365-196719387 AGAATTGCTATGTAGAAGATTGG + Intronic
919635121 1:199996379-199996401 AGAATTGTTTTGTAGAGATCAGG + Intergenic
921322516 1:213955765-213955787 AGAATGGTTAAGTAAATATCTGG + Intergenic
922383259 1:225055189-225055211 GGAAATGCTATGTAGAAATACGG - Intronic
923004697 1:230037965-230037987 AGATTTGCTATGCAATATTCAGG - Intergenic
923940878 1:238825125-238825147 AGAGTTGCTAATTAAAAATCAGG - Intergenic
924367876 1:243315349-243315371 ACAATTACTATGTAAAAAAGTGG - Intronic
1063241558 10:4174948-4174970 AGAATTTCTCCGTGAAAATCAGG + Intergenic
1063671357 10:8102538-8102560 AGAATTGAATTGAAAAAATCTGG + Intergenic
1064066173 10:12183685-12183707 AAGATTGCTATGCAAAAATCTGG + Intronic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1065051738 10:21799616-21799638 AAAATGCCTATGTAAAAATGTGG - Intronic
1065559188 10:26945311-26945333 AAGATTAGTATGTAAAAATCTGG - Intergenic
1067818381 10:49502191-49502213 AGAATTGCTTTGCAAAATACTGG - Intronic
1067964903 10:50900363-50900385 AGAATTGCTTTCTAATAATGCGG + Intergenic
1069012693 10:63392140-63392162 ATAATTGGTATGTGAAAAACTGG + Intronic
1073757301 10:106594255-106594277 AGAAGTGGTATGTAAAAAAAAGG - Intronic
1073846253 10:107558475-107558497 AGCATTGCAAAGTAAAAATTAGG + Intergenic
1074330514 10:112502919-112502941 AGAATCACTATGTAAAAACATGG - Intronic
1074447388 10:113531626-113531648 AGAAATGCCACTTAAAAATCTGG - Intergenic
1074724724 10:116296340-116296362 AGAAATGCTATGTAATGATCAGG - Intergenic
1075291903 10:121238216-121238238 AGGATGGCTATGGAGAAATCAGG - Intergenic
1075881748 10:125858206-125858228 AGAATTGCCAGGTGAAAAACAGG - Intronic
1076055000 10:127365521-127365543 AAAATTGCTATTAAAGAATCAGG + Intronic
1079928645 11:26529020-26529042 AGACTTGGTATGTGAAAGTCTGG - Intronic
1081013405 11:37844623-37844645 AAAACTGTCATGTAAAAATCAGG - Intergenic
1081351772 11:42062567-42062589 TGACATGCTATGTAAAGATCTGG + Intergenic
1081889539 11:46529336-46529358 ATTGTTGCTATTTAAAAATCAGG + Intronic
1082690499 11:56297081-56297103 ATGATTGCTATGTAGCAATCTGG - Intergenic
1086695568 11:89841192-89841214 AGAAATGCAATGTAATAATTTGG - Intergenic
1086710585 11:90003291-90003313 AGAAATGCAATGTAATAATTTGG + Intergenic
1087222529 11:95561794-95561816 AGAATTGCCATAGAAAATTCAGG + Intergenic
1087237140 11:95732797-95732819 AAAAGTGCTATGAGAAAATCTGG - Intergenic
1090756845 11:129799308-129799330 AGAAGTGAAATCTAAAAATCTGG + Intergenic
1091645219 12:2267958-2267980 AGAATGGGTATTTAAAAAACAGG + Intronic
1091800679 12:3322879-3322901 AAAATTGCCATGATAAAATCTGG + Intergenic
1092692997 12:11135735-11135757 AGAAATCCTTTGGAAAAATCTGG + Intronic
1093013335 12:14131057-14131079 AGCATTGGTTTGTAATAATCTGG + Intergenic
1094039467 12:26107807-26107829 AGAATTGCTTTGGAGGAATCTGG + Intergenic
1094216285 12:27946154-27946176 AAAATTGGAATGTAAATATCAGG - Intergenic
1094549636 12:31438279-31438301 ATATTTGCTCTTTAAAAATCTGG - Intronic
1095321084 12:40828071-40828093 AGTATTGCTATGTAGACAGCCGG + Intronic
1096757071 12:53808546-53808568 ACAATTGCTATGTGAAGAACAGG - Intergenic
1097344960 12:58480930-58480952 TGAATAGCTATGTAATAATGTGG + Intergenic
1097651357 12:62301518-62301540 AGTATTGATATGTAAAAACATGG + Intronic
1098821900 12:75242705-75242727 AAAATTGCAATGTATAAACCTGG + Intergenic
1099022175 12:77420215-77420237 AAAATTTTTATGTAAAAGTCAGG + Intergenic
1099123149 12:78718362-78718384 AAAACTGCTTTGTAAATATCTGG + Intergenic
1100108823 12:91211991-91212013 AAAATAGCTATGTAATAATAAGG + Intergenic
1101073730 12:101105778-101105800 AGAATTGCAAAATATAAATCTGG + Intronic
1101578566 12:106020653-106020675 AGTATTGCTTTGTACAATTCTGG - Intergenic
1103835267 12:123814546-123814568 CAAATTGCTATGAATAAATCAGG - Intronic
1104148389 12:126057158-126057180 AGAAAAGTTATGTAAATATCCGG - Intergenic
1105053493 12:133077021-133077043 AGAATTGCTTTATAAAAATCAGG + Intergenic
1106298085 13:28436530-28436552 AAAATTCCCATATAAAAATCTGG - Intronic
1109939820 13:69346958-69346980 TGAATTGATATGGAAAAATTGGG + Intergenic
1110012017 13:70348445-70348467 AGAATTGCCAAGTAAAGCTCTGG + Intergenic
1110867682 13:80415515-80415537 AGGATTGCAATATAAAAATCTGG + Intergenic
1111903441 13:94228266-94228288 TGAAATGCTATGAAAAAATGAGG + Intronic
1113273609 13:108703265-108703287 AGAATACATATGTAAATATCAGG + Intronic
1114607999 14:24013751-24013773 AGAACAGGTATGGAAAAATCAGG - Intergenic
1115934907 14:38541619-38541641 ATAATTTATATTTAAAAATCAGG + Intergenic
1120614302 14:86683762-86683784 AGAATGGCTTTTTAAAAATAGGG + Intergenic
1120673086 14:87387108-87387130 AGGATTGCTATTTTAAAATAAGG + Intergenic
1126653518 15:50951622-50951644 AAAATTTTTAAGTAAAAATCTGG - Intronic
1126899442 15:53298163-53298185 AGACTTGCTATGCAAACATGAGG + Intergenic
1127190701 15:56527940-56527962 AGAATGGTTATGAAAACATCCGG + Intergenic
1127512441 15:59656279-59656301 AAATTTGCTAAGTAAATATCAGG - Intronic
1127578906 15:60318883-60318905 AGCATTGCCATTTTAAAATCGGG - Intergenic
1127905161 15:63371007-63371029 TGAATTGCAATATAAAAAGCAGG - Intronic
1128432044 15:67605643-67605665 AGAAATGCTGTATAGAAATCTGG - Intronic
1128951509 15:71888664-71888686 AGAACTGCCAATTAAAAATCAGG - Intronic
1129649906 15:77477593-77477615 AGAATTCCTCTGTAAATATAGGG - Exonic
1131366866 15:91848830-91848852 AGAATTGATATGAGAAAACCAGG - Intergenic
1133653235 16:7833070-7833092 AGAACTGCAATGGATAAATCCGG - Intergenic
1134018253 16:10904180-10904202 ACAATATCTATGTAAAAATCAGG - Intronic
1140719909 16:77762273-77762295 GGAATTGGTTTGTAGAAATCAGG - Intergenic
1141452157 16:84111861-84111883 AAAATTGAAATGTAAAAATTTGG - Intronic
1142606796 17:1086370-1086392 AGCAATGCTATGTGTAAATCGGG - Intronic
1146048306 17:29529144-29529166 AAAATTGCTTTGTAGAAATGGGG + Intronic
1146232561 17:31126409-31126431 AAAATTGCTATGAATCAATCAGG - Intronic
1148522156 17:48288260-48288282 ATTATTGCTATTTAAAAATAAGG - Intronic
1151413144 17:73944248-73944270 AGATGTGCTTTGCAAAAATCAGG - Intergenic
1153023810 18:656331-656353 AGAATTGTTATCTAAAGATCTGG - Intronic
1155181955 18:23355723-23355745 AGAATTGCTATGTAAAAATCAGG - Intronic
1157267783 18:46243627-46243649 AGAATTGAAATGGAAAATTCAGG - Intronic
1157976457 18:52333150-52333172 ATAATGGGTATGTAAAATTCTGG - Intergenic
1158800373 18:60900633-60900655 AGAATAGCTATGTTAACACCTGG + Intergenic
1159595995 18:70383334-70383356 AGGATTTCTCTGTAAAAATGAGG + Intergenic
1160138576 18:76297268-76297290 ACACTTGCTATCCAAAAATCAGG - Intergenic
1163887104 19:19975699-19975721 AGAATAGATTTTTAAAAATCTGG + Intergenic
1165566457 19:36733209-36733231 TGAAATGCTCTGTAAATATCAGG - Intronic
929168358 2:38906226-38906248 AGGATTGCTATCTAACTATCTGG + Intronic
929420506 2:41785274-41785296 GTAATTGCTATGAAATAATCTGG - Intergenic
930260627 2:49141847-49141869 AGAATGGGCATGTTAAAATCAGG + Intronic
930690430 2:54357521-54357543 TGAAATGCTATGTAACAAACTGG - Intronic
932222058 2:70007112-70007134 ATAAATGCTAGCTAAAAATCTGG + Intergenic
932942546 2:76184995-76185017 AGAATCACTCTATAAAAATCTGG - Intergenic
933120747 2:78534321-78534343 AGAAATTATATGTAAAAATATGG + Intergenic
933348123 2:81116439-81116461 AGAATTATTATGTAAAAGACAGG - Intergenic
933427224 2:82128582-82128604 AGAGTTATTATGTAAAAATCTGG - Intergenic
933866785 2:86526492-86526514 AGAATTGCTAAGTAAGTAGCTGG - Intronic
935485122 2:103643871-103643893 AGACATGCTATGTACAAATTAGG - Intergenic
936526677 2:113246230-113246252 AGTATTGCTATTTAAAAATCAGG + Intronic
937343676 2:121109204-121109226 AAAATTGTTTTGTAAAAAGCAGG + Intergenic
937751549 2:125480383-125480405 AGCATTGCCATGGAAAATTCAGG + Intergenic
937999068 2:127718069-127718091 AGAAGTGCTGAATAAAAATCTGG + Intronic
939842672 2:147207582-147207604 GGAATTGCTAACTAATAATCTGG - Intergenic
939892748 2:147756949-147756971 AGAACTGATATGTAATAATTTGG - Intergenic
940958923 2:159760538-159760560 AGCATTGGTATTTAAAAACCAGG + Intronic
941289443 2:163657389-163657411 TGAATTCCAATGAAAAAATCTGG + Intronic
941893910 2:170610427-170610449 GGACTTGCTATGTAAACATAAGG - Intronic
942198013 2:173541965-173541987 AGAGTAGCTATGTGATAATCAGG + Intergenic
942410821 2:175707683-175707705 AGAATTCCTATATATAAAGCGGG - Intergenic
942768145 2:179481977-179481999 AGACATACTATGTAATAATCTGG + Intronic
943260550 2:185655510-185655532 AGAAATTCTATGAAAAAAACTGG + Intergenic
944191999 2:197013403-197013425 AAAATTGATATTTAAAAAACTGG + Intronic
944242094 2:197496501-197496523 AGAATTGCTATGTATATCTAGGG - Intronic
944524059 2:200600140-200600162 AGAATTGGTTTGTTCAAATCAGG + Intronic
944917015 2:204371359-204371381 GGCATTGATATGTAAAATTCTGG - Intergenic
945662738 2:212706475-212706497 AAAATTGCCATGTACAAATAAGG - Intergenic
945777495 2:214125526-214125548 AGAATTTCTAAGAAAAAATAAGG + Intronic
946577358 2:221090041-221090063 AAAATTGATATGTACAAGTCAGG + Intergenic
946865005 2:224034830-224034852 AGAAATGCTTTGTAAACAGCAGG + Intronic
948986879 2:241531013-241531035 AGACTTTCCATGCAAAAATCAGG - Intergenic
1169646694 20:7818997-7819019 AGAATTTATATGTTAAAGTCTGG + Intergenic
1170302965 20:14906535-14906557 GGAAGTGCTACGTAAAAACCAGG - Intronic
1172923574 20:38509676-38509698 AGAATTACTATATAAAAGACAGG - Intronic
1174344484 20:49919867-49919889 AGAAATTTTATTTAAAAATCTGG - Intergenic
1179242844 21:39607209-39607231 AAAATTTCTATTTAAAAATTTGG - Intronic
1180677017 22:17593845-17593867 AGAGTTCCTGTGTACAAATCTGG + Intronic
1182582029 22:31319826-31319848 AAGATTGCTATCTAAAAAGCTGG + Intergenic
1184005249 22:41703088-41703110 TAAATTGCTATGTAAATATAGGG + Intronic
949254023 3:2023564-2023586 ACAACTACTCTGTAAAAATCTGG - Intergenic
949568143 3:5264547-5264569 AGTATTGCTAGGTAAAGATGTGG + Intergenic
950989216 3:17414126-17414148 AGAATTGCAATGAAATGATCTGG - Intronic
952080887 3:29756170-29756192 AGAATCGATATGCAAAAATAAGG - Intronic
952391293 3:32882840-32882862 AGAATTGCTATTAAAAATTGGGG - Intronic
954309631 3:49755473-49755495 AGGAATGCTAAGTAAAATTCTGG + Intronic
954564127 3:51583992-51584014 AGAATTGCTGTTTTAGAATCTGG + Intronic
954829304 3:53405620-53405642 AGAATTGCTATGTATAGTTGGGG - Intergenic
955105539 3:55894335-55894357 ACCATTGCTATGCAAAAATTAGG + Intronic
956827080 3:73007377-73007399 AGAATTTCTTTGTAATAATGCGG - Intronic
957069216 3:75552668-75552690 AGAACAGGTATGGAAAAATCAGG + Intergenic
958431031 3:94041561-94041583 AGAATAGCTCTTTAAAAATTGGG - Intronic
958705392 3:97647533-97647555 AGAATTGGCATGTAAAAACAAGG - Intronic
959465227 3:106678373-106678395 AGAATTTCAATGCAAAATTCTGG - Intergenic
960044729 3:113185944-113185966 AGGACTGCTATGCTAAAATCAGG + Intergenic
960189858 3:114690495-114690517 AGGAATGCTCTGTACAAATCAGG - Intronic
961096527 3:124161236-124161258 ATAACTGCTCTGTAAATATCTGG - Intronic
961367649 3:126410720-126410742 AGAATAGCAATGTAAAGAGCAGG + Intronic
962654398 3:137528336-137528358 AGAATTTCTATGTTATGATCTGG - Intergenic
962953224 3:140240829-140240851 AGTAGTGCCACGTAAAAATCTGG - Intronic
963254491 3:143131203-143131225 TGCATTGCTATGTTAAAATGTGG + Intergenic
963703674 3:148658798-148658820 ATACTTGCTCTGGAAAAATCAGG + Intergenic
964343196 3:155730230-155730252 AGAATTCTTATGAACAAATCAGG - Intronic
964345192 3:155748022-155748044 AGAGATGATATGTAGAAATCTGG - Intergenic
965327746 3:167328754-167328776 GGAATGGCTATGTAAAGATATGG - Intronic
965461686 3:168973132-168973154 ACAATTACCATGTAGAAATCTGG + Intergenic
967153896 3:186674977-186674999 AGAAGTGCTTTAGAAAAATCAGG - Intronic
967537214 3:190619907-190619929 AGAATTGCTTTCTAAATAGCAGG + Intronic
967598751 3:191359145-191359167 AGAATTGAAATGTAAATTTCAGG + Intronic
969752707 4:9124096-9124118 AGAACAGCTACGAAAAAATCAGG + Intergenic
970293109 4:14598555-14598577 AAAAAAGCTATGTAAAAATCTGG - Intergenic
970940388 4:21626124-21626146 AGGATTGCCAAGTAAAATTCAGG - Intronic
971741617 4:30528560-30528582 GGAAATGCTATGAAAAAATTAGG - Intergenic
971902813 4:32683532-32683554 ATAATTGATATATAAAAATAAGG - Intergenic
972054808 4:34786899-34786921 AGTATAGCTATGTAAATATTAGG + Intergenic
973064035 4:45764964-45764986 AGAATTGCTCTGAAACTATCTGG + Intergenic
973077337 4:45945863-45945885 AGAATTTCAATGTATAAATTAGG - Intergenic
974288508 4:59900689-59900711 AGAATAGCCATGCAAAGATCTGG - Intergenic
974512149 4:62857016-62857038 ACTATTAATATGTAAAAATCTGG + Intergenic
974665554 4:64956810-64956832 AGAAGAGCAATGTAGAAATCTGG + Intergenic
974672448 4:65049660-65049682 AAATGTGCTATGTAAATATCTGG - Intergenic
974909651 4:68101615-68101637 AAAATTGTCATGTACAAATCAGG - Intronic
975319060 4:72989289-72989311 AGAATTGCTCTGTTTAAATTTGG - Intergenic
975985719 4:80199951-80199973 ATAAGAGCTATGCAAAAATCAGG + Intronic
976568368 4:86578860-86578882 AGATTTTCTGTTTAAAAATCTGG + Intronic
977149685 4:93494980-93495002 AAAATAGCTATGGGAAAATCAGG + Intronic
978173632 4:105704147-105704169 AGAATTGCTGTGTAAATAGAAGG - Intronic
980635226 4:135493560-135493582 AGACTTAAAATGTAAAAATCAGG - Intergenic
980638667 4:135542973-135542995 AGAATTGCTATGCCAAAATATGG + Intergenic
980746909 4:137030038-137030060 AGAATAGCCAAGAAAAAATCTGG - Intergenic
980874747 4:138650071-138650093 AGAATTGATATGTATAATTTTGG - Intergenic
981231193 4:142357480-142357502 AGAATTGCCATGTAAATATATGG - Intronic
981341987 4:143632281-143632303 GAAAGTGCTATGCAAAAATCAGG + Intronic
982196052 4:152915613-152915635 AGAACGGCTATTTAAAAAACTGG - Intronic
982369407 4:154618297-154618319 AGTATTGATATGTAAATATCAGG - Intergenic
982881406 4:160722877-160722899 AGAATAGCTATAAAAATATCAGG - Intergenic
983028919 4:162773534-162773556 AGGTGTGCTATGTAAAAGTCAGG - Intergenic
983169801 4:164522578-164522600 AGAATTTCTATGTATATATGTGG + Intergenic
983464956 4:168075592-168075614 TGAATTGCTATGTAAAGATTAGG + Intergenic
984116336 4:175685506-175685528 AAAATTTACATGTAAAAATCAGG - Intronic
984468117 4:180127627-180127649 AGAAATGCTAGGTAACAACCAGG - Intergenic
984740892 4:183161629-183161651 AGAAAAGGTATGTAAAAATATGG - Intronic
985102434 4:186471689-186471711 AAAATTGCTGTGAAAAAATGCGG - Intronic
986250305 5:6050465-6050487 AGAATAGCTATTTAAATATCAGG - Intergenic
987063329 5:14263142-14263164 ATATTTGGTATGGAAAAATCAGG - Intronic
988000814 5:25345764-25345786 AGGATTGCCTTGTAAAAGTCAGG - Intergenic
989175654 5:38522506-38522528 AGAAAAGATATGTAAAAATATGG - Intronic
989292615 5:39787463-39787485 AGACTTGTTATGAAAAGATCAGG - Intergenic
990073382 5:51812916-51812938 AAAATTCCTGTTTAAAAATCGGG - Intergenic
992687713 5:79214456-79214478 AGAAATGCTATTTATAAAACTGG + Intronic
993334601 5:86642503-86642525 ATAAGTGCTATGTAAAAATTTGG - Intergenic
993821444 5:92622214-92622236 AAATTTGCTAGGTAAAACTCAGG + Intergenic
994202357 5:96992179-96992201 AGAATTGCAATTTAATAATAAGG + Intronic
996553940 5:124758474-124758496 AAAATTTCTATGTTAAAAACTGG + Intergenic
997795612 5:136807167-136807189 TGAATTTCTAAGGAAAAATCCGG + Intergenic
999060898 5:148633875-148633897 AGAATTACTATGAAAAATGCTGG - Intronic
999352136 5:150882623-150882645 AAAATTGCTATGTAACCATCAGG + Intronic
999923683 5:156351399-156351421 AGATGTTCTAAGTAAAAATCTGG + Intronic
1000289069 5:159853192-159853214 AGAATGGCTATCAAAAAGTCAGG + Intergenic
1002472823 5:179447332-179447354 AGAAATTTTATATAAAAATCTGG - Intergenic
1002481399 5:179503330-179503352 AGAAATTTTATATAAAAATCTGG + Intergenic
1003399214 6:5778110-5778132 AGAATTGCTATTTGGGAATCTGG - Intergenic
1003718518 6:8674452-8674474 ACAATTGCTATGTAAACGTAAGG + Intergenic
1004036289 6:11927447-11927469 CAACTTGCAATGTAAAAATCTGG + Intergenic
1005421897 6:25659994-25660016 AGAATTTCCATGTAAGAAGCTGG + Intronic
1006562743 6:34927779-34927801 TGAATGGCTGTGTAAAAAACTGG + Intronic
1007066438 6:38995411-38995433 ATATTTGCTTTGTAAAAATGTGG + Intronic
1007671745 6:43560354-43560376 ATAACTGCTAAGTAATAATCTGG - Intronic
1008629863 6:53353222-53353244 AGAATTGTCATTTACAAATCTGG - Intergenic
1009786011 6:68340511-68340533 GAAACTGCTATGTAAACATCAGG + Intergenic
1009882501 6:69585778-69585800 AGAAGTGCTTTTTAAAAAGCAGG + Intergenic
1010011709 6:71055127-71055149 AAAATTATTATGTAAAAAGCCGG - Intergenic
1011132199 6:84063255-84063277 AACATTTCAATGTAAAAATCAGG - Intronic
1012034890 6:94122557-94122579 AGAATTGCCAGGTAAAATACAGG + Intergenic
1012626889 6:101415668-101415690 AAAATTGTTATGGAAAAATACGG - Intronic
1013099925 6:106977555-106977577 AGAACTGCAAAGGAAAAATCAGG - Intergenic
1013753277 6:113431872-113431894 AGACTTGCAATGTTAAAACCAGG - Intergenic
1014007316 6:116435204-116435226 AGAAATGCCATGTTAGAATCTGG - Intronic
1014426700 6:121315390-121315412 AGCATTGCTATGAAAATATTTGG - Intronic
1015490658 6:133821714-133821736 AAAAATGCTATGACAAAATCAGG + Intergenic
1017979195 6:159384379-159384401 AGAATTGCTATATCACACTCTGG + Intergenic
1018068683 6:160142134-160142156 GGAAGAGCCATGTAAAAATCTGG + Intronic
1019826844 7:3291597-3291619 AAAATACTTATGTAAAAATCAGG + Intergenic
1020398857 7:7751295-7751317 AGAGTTGGTATGTTAAAATAGGG + Intronic
1021287715 7:18802581-18802603 ATAATGGCTATTTAAAAATGTGG + Intronic
1021298689 7:18942460-18942482 AGAATTTCTGTGAAAAAATATGG + Intronic
1022568710 7:31429958-31429980 AACATTTCAATGTAAAAATCTGG - Intergenic
1022768699 7:33445364-33445386 AAAATTGCTATGAAAATAACAGG - Intronic
1024410860 7:49039439-49039461 AGAATTGCTATCTAAGAGTGAGG - Intergenic
1025970228 7:66316704-66316726 AGAATTGCTAAATAAAATACAGG + Intronic
1027459250 7:78432052-78432074 AAAATTGATTTTTAAAAATCAGG + Intronic
1027533219 7:79361998-79362020 AAAATTTCTAGGAAAAAATCTGG + Intronic
1028151066 7:87372545-87372567 TGAATCACTATTTAAAAATCAGG + Intronic
1030810137 7:113961802-113961824 AGAACTGCTTATTAAAAATCTGG + Intronic
1031390808 7:121212312-121212334 AAAATTGCAATTTATAAATCAGG + Intronic
1031657144 7:124371341-124371363 AGAAATGCTAAATAAAAATGTGG - Intergenic
1031797801 7:126198676-126198698 ATAATTTCTATTTAAAAATCAGG - Intergenic
1031958809 7:127970205-127970227 AGAATTCCTTTGGATAAATCAGG + Intronic
1032848425 7:135771761-135771783 AGAATTCTTATGTGCAAATCAGG - Intergenic
1033235130 7:139632100-139632122 AGAACTCCTTTGTAAAAACCAGG - Intronic
1035556847 8:573444-573466 AGAGTTACTATCTAAAAACCTGG + Intergenic
1035615480 8:997311-997333 AAAAATGCTATTTAAATATCTGG + Intergenic
1039239644 8:35542213-35542235 ATATTTGGTATGTAAAATTCCGG + Intronic
1039843115 8:41307748-41307770 AGAATTGCTCTTTAAACATAAGG + Intronic
1041434599 8:57824578-57824600 AGAATTGGTCACTAAAAATCTGG + Intergenic
1042663050 8:71176918-71176940 AGCATGACTATCTAAAAATCTGG + Intergenic
1043068082 8:75602077-75602099 AGAATGGCAATCAAAAAATCAGG + Intergenic
1043456936 8:80421837-80421859 AAAATTGGCATCTAAAAATCTGG + Intergenic
1043836727 8:85056149-85056171 AGAGTTACTGTGGAAAAATCTGG - Intergenic
1044352092 8:91178486-91178508 ACAATTACTATGTAAAATTGAGG + Intronic
1044498614 8:92923758-92923780 AAAATTGCTCTGGAAAATTCAGG - Intronic
1045765968 8:105669571-105669593 AAGATTACTTTGTAAAAATCTGG + Intronic
1046180623 8:110642224-110642246 ATAATTACTATGGAAAAAACAGG + Intergenic
1046286550 8:112100069-112100091 AGAATTGCTCTGTAAAATTATGG - Intergenic
1048113524 8:131493876-131493898 ATAATTGTCATGAAAAAATCAGG - Intergenic
1048939081 8:139381302-139381324 TCAACTGATATGTAAAAATCTGG - Intergenic
1050868613 9:10537461-10537483 AAAATAGCTATGTAAAAATTGGG + Intronic
1051062168 9:13057058-13057080 AGAATTTCAATGTACAAATTTGG + Intergenic
1051692668 9:19732885-19732907 AGAATGGCAATTGAAAAATCTGG - Intronic
1051951763 9:22643889-22643911 AGAGTTGCTATGTAGAAAACAGG + Intergenic
1056056332 9:82827707-82827729 CGAAATGCTAAGTGAAAATCTGG + Intergenic
1056185795 9:84133812-84133834 AGAATTACAATGTAAAAAAGTGG + Intergenic
1057733537 9:97632767-97632789 ATAATTGTTATGTAAAAAGAGGG + Intronic
1058200858 9:102038357-102038379 AAAATTGATATATAAAAATTTGG + Intergenic
1059535282 9:115075021-115075043 AGAATTGGCATGTAAATGTCCGG + Intronic
1059576107 9:115490396-115490418 AAAATTGCTATTTAAAATTTTGG + Intergenic
1059668483 9:116471870-116471892 AGGTTTGAAATGTAAAAATCTGG - Intronic
1059831888 9:118105330-118105352 AAAATTGATAGGTTAAAATCAGG - Intergenic
1186236092 X:7511736-7511758 AGAATTTATATGCAGAAATCTGG + Intergenic
1186582047 X:10830553-10830575 AGAAATGCTGTGTACAAATTTGG + Intronic
1186712509 X:12214889-12214911 ATAATTGCTATGTAAAAAGAAGG - Intronic
1187016729 X:15336053-15336075 AGAATTGCCATATAAATAACAGG - Intergenic
1187305485 X:18091660-18091682 AGAATACCTAACTAAAAATCAGG + Intergenic
1187746969 X:22419801-22419823 AGAATTGATATGTAAATATTGGG + Intergenic
1188315470 X:28668026-28668048 AGAATTTCTATGTAGCAATTAGG + Intronic
1188519272 X:31019941-31019963 AGAATTGTTAAGCAAAAATGAGG + Intergenic
1188997308 X:36901443-36901465 AGAATGGCAATGTCAAAGTCTGG + Intergenic
1189164388 X:38846191-38846213 AGAAATGCTATGTAATGATGTGG + Intergenic
1189280068 X:39814971-39814993 AGAAATACTATGTAAAAGGCAGG + Intergenic
1189748848 X:44197854-44197876 AGAATTGTGATGTAAAAATTAGG - Intronic
1192093240 X:68182965-68182987 TGAATGGATATGTAAAAAGCAGG - Intronic
1192635204 X:72809047-72809069 AGTCTTGCTATGTCAAAATCAGG + Intronic
1192646511 X:72911756-72911778 AGTCTTGCTATGTCAAAATCAGG - Intronic
1192707268 X:73539643-73539665 AGAAATGCAATGTAAAAAAATGG + Intergenic
1194436050 X:93869422-93869444 AGATGTGTAATGTAAAAATCTGG - Intergenic
1194538525 X:95140817-95140839 AGATTTTTTATATAAAAATCTGG - Intergenic
1195625732 X:107004347-107004369 ACATTTGCTATGTCAAAATCGGG + Intergenic
1197149773 X:123207607-123207629 GAAACTGCTGTGTAAAAATCAGG + Intronic
1197228990 X:123982836-123982858 AGTATTGCTACCTAAAAATGAGG - Intronic
1198056157 X:132997319-132997341 AGAATTGCTATGAATAAATAAGG - Intergenic
1199689805 X:150300243-150300265 AGACATGCTATGTAGAAATATGG - Intergenic
1201352962 Y:13066552-13066574 AAATTTGCAATGTAAAAATATGG + Intergenic
1201986800 Y:19977554-19977576 AGAGTTGATATGAAAAAAACAGG + Intergenic
1202016002 Y:20407253-20407275 AGAAATGCTAGGTAAAAACTTGG + Intergenic
1202198187 Y:22318304-22318326 AGAACTGTTATGTAAAAATTTGG + Intronic