ID: 1155191162

View in Genome Browser
Species Human (GRCh38)
Location 18:23432116-23432138
Sequence TCTTATATGGAGAAAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 478}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155191158_1155191162 0 Left 1155191158 18:23432093-23432115 CCCTACTTTTCTGATATTTTTAT 0: 1
1: 0
2: 9
3: 121
4: 1184
Right 1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG 0: 1
1: 0
2: 0
3: 54
4: 478
1155191159_1155191162 -1 Left 1155191159 18:23432094-23432116 CCTACTTTTCTGATATTTTTATT 0: 1
1: 1
2: 16
3: 149
4: 1636
Right 1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG 0: 1
1: 0
2: 0
3: 54
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155191162 Original CRISPR TCTTATATGGAGAAAAGGAA AGG Intronic
901655138 1:10765003-10765025 CCTTATCTGGAGAGAAGAAATGG - Intronic
902890978 1:19443423-19443445 TCTTATTTTAAAAAAAGGAATGG - Intronic
903200570 1:21734617-21734639 TCTGAATTGGAGAAAAGAAATGG - Intronic
904851185 1:33460941-33460963 TCTTCTATGGAGAGAAGAGAAGG + Intergenic
906298103 1:44661514-44661536 TCTTAAAAGGAGAAATGGATAGG + Intronic
906582264 1:46945903-46945925 TGTTATATGGTGAAAAGTCAGGG + Intergenic
906601335 1:47131966-47131988 TTTTATATGGTGAAAAGTCAGGG - Intergenic
907008346 1:50938749-50938771 TCATATATGGTGAAAGGTAAGGG + Intronic
907907826 1:58800176-58800198 TCATATAGTGAGTAAAGGAAAGG - Intergenic
908249085 1:62251097-62251119 TCTTCTTTGGAGAAAAGGGCAGG + Intronic
909159873 1:72133400-72133422 TCTTTTATGAAGGTAAGGAAAGG + Intronic
909387693 1:75078659-75078681 TCTGAAATGGAGAACAGAAATGG + Intergenic
909791896 1:79690064-79690086 TTTTATATAGAGAAAATGAAGGG + Intergenic
913261097 1:116998831-116998853 TCTAATCTGGAGAGAATGAATGG - Intergenic
913515583 1:119602860-119602882 TCTCCTATGGTGAAAAGGTAGGG + Intergenic
914353849 1:146864517-146864539 TTGTATATGGTGAAAAGTAAGGG + Intergenic
918986932 1:191643198-191643220 TTTTATATACAGAAATGGAAGGG - Intergenic
919021925 1:192116777-192116799 TGATCTATGGAGAGAAGGAAAGG - Intergenic
919242490 1:194933267-194933289 TCATATATGGTGAAAGGCAAGGG - Intergenic
919267172 1:195284566-195284588 TTTTATATGGAGAGATGTAAGGG + Intergenic
919382454 1:196875735-196875757 TTTTATCTGTAGAAAAGAAAAGG - Intronic
920007410 1:202843549-202843571 TATTATATGGAGAATAGAGATGG + Intergenic
920038386 1:203080471-203080493 TCCTAGAGGGAGCAAAGGAAAGG - Intergenic
920871922 1:209802042-209802064 TTCTGTATGGAGAAAAGGAGGGG + Exonic
921435609 1:215116951-215116973 TTTCATGTGGAGAAAAGAAATGG - Intronic
922709221 1:227814602-227814624 TCTCAGATGGAGATAAGGACTGG - Intergenic
923301165 1:232642052-232642074 TGTTGCATGGAGAAAAGGCATGG - Intergenic
924271326 1:242335840-242335862 TCTAATATGATGAAAAAGAAAGG + Intronic
1063345000 10:5303388-5303410 TCTTTGATGGAGAAGATGAAAGG + Intergenic
1063472287 10:6297775-6297797 TGGGATATGGAGAGAAGGAAAGG - Intergenic
1064295472 10:14075264-14075286 TACTATATTGAGAAGAGGAAAGG + Intronic
1064968222 10:21036675-21036697 GCTTATATGGAGTAAAAGGAGGG - Intronic
1065035282 10:21631729-21631751 TCTTATCAGGAGAACAGCAAGGG + Intronic
1065169797 10:23015137-23015159 TCTAATATGGAGAAGAGAAAGGG + Intronic
1065459161 10:25937713-25937735 TCATAAAGGGAGAAAATGAATGG + Intronic
1065553286 10:26890009-26890031 TCTTACATCCAGACAAGGAAGGG + Intergenic
1065578993 10:27152858-27152880 TGCTATATGGAGAATAGGAGAGG - Intronic
1065782334 10:29181677-29181699 TCTTATAGAGAAAAAAGGAAGGG - Intergenic
1066376566 10:34862721-34862743 AATTAAATGGAGAAAAGAAAGGG - Intergenic
1066581659 10:36888387-36888409 TCTTACATCCAGAAAAGGGAGGG + Intergenic
1066694553 10:38066245-38066267 TCTTAACTGGAGAAACAGAAGGG + Intergenic
1066997963 10:42580932-42580954 TCTTAACTGGAGAAACAGAATGG - Intronic
1067695423 10:48531804-48531826 TGTTTTTTGGGGAAAAGGAATGG + Intronic
1067917915 10:50420823-50420845 TCTATGATGGAGAAAGGGAAAGG + Intronic
1068103316 10:52582640-52582662 TCTTACATGGAGACAGGGCAGGG + Intergenic
1068328816 10:55534050-55534072 TTGTATATGGTGAAAAGTAAGGG - Intronic
1073453631 10:103623621-103623643 TCTTATAAGGACAAAAGGGTAGG + Intronic
1073661803 10:105483956-105483978 TTGTATATGGTGAAAAGTAAGGG + Intergenic
1073823717 10:107295183-107295205 TCATATATGGTGAAAGGTAAGGG - Intergenic
1073930930 10:108575901-108575923 TCTTCTATGGAAAACAGGCATGG - Intergenic
1075794570 10:125109926-125109948 TACTTTATGGAGAAAAGGAAGGG + Intronic
1075975370 10:126689592-126689614 TCTTTTTTGAAGAAAGGGAAGGG - Intergenic
1076099245 10:127761633-127761655 ACTTATATGTAGAACAGAAAAGG - Intergenic
1076245913 10:128947618-128947640 TCTTAACTGGGGCAAAGGAAGGG + Intergenic
1077660910 11:4067776-4067798 TCTTATACGGATTAAGGGAAGGG + Intronic
1077869455 11:6249877-6249899 TCTTTTAGGGAGATAAGGAAAGG + Intergenic
1078006972 11:7539556-7539578 TCTAAAAGGGAGAAAATGAAAGG - Intronic
1078036331 11:7809181-7809203 TTGTATATGGTGAAAAGAAAGGG - Intergenic
1078139976 11:8685135-8685157 TATTATCTGGAGAACATGAAGGG - Intronic
1078411900 11:11129636-11129658 TCATATTTGGAGTAAAGGACAGG + Intergenic
1078829541 11:14966360-14966382 TCTTATATGGAGGAAGGGCAGGG + Intronic
1079184615 11:18225273-18225295 TTGTATATGGTGAAAAGTAAGGG + Intronic
1079655534 11:22982508-22982530 TTTTCTATAGAGAAAAGGAAAGG + Intergenic
1080814056 11:35736860-35736882 TGTTAAATGAACAAAAGGAAGGG - Intronic
1080929186 11:36789730-36789752 TATTTTATGGAGGAATGGAAAGG + Intergenic
1081228914 11:40560613-40560635 GATTATTTTGAGAAAAGGAAAGG + Intronic
1081265631 11:41017660-41017682 ACTACTATGGAGAAAAGTAAGGG + Intronic
1081956737 11:47099019-47099041 TTTTTAATGGAGAACAGGAATGG - Intronic
1085119741 11:73959399-73959421 GCGGATATGGAGAAAGGGAAGGG - Intronic
1085730375 11:78992814-78992836 TCTTATAATGAGAAAAGCAAAGG - Intronic
1085931511 11:81088857-81088879 TCTTATCTGTAAAACAGGAATGG + Intergenic
1085948691 11:81303732-81303754 TTTTATATGGAGAGAAGGTCAGG - Intergenic
1086113894 11:83227085-83227107 TCTTATAAGCAGAAAAGGAGAGG + Intronic
1086258653 11:84910995-84911017 TATTATGTAGAGGAAAGGAAAGG + Intronic
1086380605 11:86248587-86248609 TAATATATGGAGTAAAGGAATGG + Intronic
1086453745 11:86941878-86941900 TGTTAGATGGAGAAACTGAAGGG - Intronic
1086491965 11:87364604-87364626 GCCTATAAGGAGAACAGGAAGGG - Intergenic
1086659788 11:89401194-89401216 TATTATATGCAGAAGAGGCATGG - Intronic
1087270937 11:96111011-96111033 TCTTTGATGGAGAAAATGATAGG - Intronic
1087334194 11:96822542-96822564 TCCTATATGAATAAAAGCAATGG - Intergenic
1087533245 11:99410389-99410411 TCTTTTATGAAAACAAGGAAAGG - Intronic
1088147451 11:106699262-106699284 TTTTTAATGGAGAAAGGGAAAGG + Intronic
1088148825 11:106718919-106718941 TCTCATATGTAGAAAAGAATTGG + Intronic
1088487864 11:110358417-110358439 TCTTATCAGTAGAAAAAGAAGGG + Intergenic
1089374476 11:117984933-117984955 TCTGAAATGCAGAAAAGGCAAGG + Intergenic
1090236728 11:125153761-125153783 CCTTAAAGGGAGAAAAGAAAGGG - Intergenic
1091696439 12:2631141-2631163 TCTAAGATGGAGAAAGGAAAAGG - Intronic
1092051191 12:5471601-5471623 TCTTCTTTGGAGATAAGAAAAGG + Intronic
1092272678 12:7036115-7036137 TTTTATTTGGAGAATAAGAATGG + Intronic
1092808511 12:12250118-12250140 TATTAGAAGTAGAAAAGGAAAGG - Intronic
1093360191 12:18216445-18216467 TCTTCTTTGGAGAAATTGAATGG - Intronic
1094720709 12:33060629-33060651 TTTTCTAGGGAGAAAAGGTAGGG + Intergenic
1095333012 12:40991391-40991413 TCTTATATGGAAAAAAAAAAAGG - Intronic
1095526418 12:43131114-43131136 TCATATTTGGAGAAAAAGCATGG + Intergenic
1095703158 12:45211448-45211470 TTTTATGTGGCGAAAAGAAATGG - Intergenic
1097606343 12:61759105-61759127 TATTATATGTTGAAAAAGAAAGG + Intronic
1097752010 12:63365955-63365977 TCCTCTATGGAGGAGAGGAATGG - Intergenic
1097933257 12:65214339-65214361 TCTTATGTGAAGATAAGGACTGG + Intronic
1098154467 12:67583103-67583125 TCTTCAGTGGAGAGAAGGAAAGG + Intergenic
1098708716 12:73725867-73725889 TCTAAAATGAGGAAAAGGAAAGG + Intergenic
1098717982 12:73856505-73856527 TTGTATATGGTGTAAAGGAAGGG + Intergenic
1098948327 12:76612727-76612749 TATTAGAAGGAGAGAAGGAAGGG - Intergenic
1099627368 12:85091672-85091694 TTGTATATGGTGAAAAGTAAAGG + Intronic
1100289979 12:93204508-93204530 TCTTATTTGGAGAAACTGAATGG + Intergenic
1101560325 12:105851157-105851179 TCCCATAAGGAGAAAAGGAATGG + Intergenic
1104500602 12:129282013-129282035 ACCTATAAGGAGACAAGGAAGGG - Intronic
1104506616 12:129338134-129338156 TCCTAAATGGAGAATGGGAAAGG - Intronic
1105654338 13:22419765-22419787 TCTCAGATGAAGGAAAGGAAAGG + Intergenic
1105713913 13:23041971-23041993 TCTTATATGTAGAAAACCTAGGG - Intergenic
1105941765 13:25153951-25153973 TCTTAGATGCAGACAAGGGAAGG + Intergenic
1106845032 13:33729440-33729462 TGTTCTATTGAGAAATGGAAAGG + Intergenic
1106978341 13:35248758-35248780 TGGTATATGGAGAAAGGTAAGGG - Intronic
1107197722 13:37673515-37673537 TTTTTTAAAGAGAAAAGGAAAGG + Intronic
1108132984 13:47323382-47323404 TTTGATATGTAGAGAAGGAAAGG - Intergenic
1108220394 13:48227905-48227927 TTTTAGTTGGAGAAATGGAAAGG - Intergenic
1108502727 13:51083347-51083369 TCTTAACTGGGGAAAGGGAAAGG + Intergenic
1108586994 13:51878688-51878710 TGATATATGGAGAAAGGTAAGGG + Intergenic
1108787150 13:53918564-53918586 TTGTATATGGAGAAGAGGAAGGG + Intergenic
1108952355 13:56111130-56111152 TCTCAGAAGGAGAAAAGAAAGGG - Intergenic
1109642990 13:65216145-65216167 GCTTCTATGAAGGAAAGGAAAGG - Intergenic
1110287999 13:73772508-73772530 TCTCAGATGTGGAAAAGGAAAGG + Intronic
1110459121 13:75724671-75724693 TCTTCTAAGGAGAAAAACAATGG - Intronic
1111094783 13:83498938-83498960 TTTTATATGCAAAAAAGAAAAGG + Intergenic
1111863132 13:93733815-93733837 GCTGAGATAGAGAAAAGGAATGG + Intronic
1112606499 13:100911878-100911900 TCTTAAAAGAAGTAAAGGAAGGG - Intergenic
1113355059 13:109571146-109571168 ACTTATATAGAGAAAAGAGAAGG - Intergenic
1113637071 13:111926976-111926998 TCCTGTGTGGAGAAAGGGAAAGG + Intergenic
1114127903 14:19751992-19752014 TCTTATATGCTGAAAAGCAAGGG - Intronic
1114356791 14:21918630-21918652 TCAAATATGGACAAAAGGCAAGG + Intergenic
1114831897 14:26153812-26153834 TCTTATGTGGAGGAAGAGAAGGG - Intergenic
1114894747 14:26973556-26973578 TGTTATATGCAGAAAAAGATAGG - Intergenic
1115155482 14:30334152-30334174 TGTCATCTCGAGAAAAGGAAAGG + Intergenic
1115940669 14:38605422-38605444 TCTTATATCCTGAAAAAGAATGG + Intergenic
1116023321 14:39486952-39486974 TCTTATCGGGTGAAAAGGAGGGG + Intergenic
1116280081 14:42895552-42895574 TCATATATGGTGAAAAGTAGGGG + Intergenic
1117461057 14:55945222-55945244 TCTTACCTGGAAAAGAGGAAAGG - Intergenic
1117654617 14:57942049-57942071 TTTTAAGTGGAGAAAAAGAATGG - Intronic
1118861558 14:69668206-69668228 TCTTCTGTGGAGAAAAGAGAGGG + Intronic
1120213366 14:81656342-81656364 TTTTATCTGGGGAAAAGAAATGG - Intergenic
1120347048 14:83303817-83303839 TCTTTTATGAAGAAATGGATTGG + Intergenic
1121188592 14:92001166-92001188 TTTAAAATGGAGAAAAGAAACGG - Intronic
1121882405 14:97512733-97512755 ACTTATTTGGAGAAAAGCAAAGG + Intergenic
1202928383 14_KI270725v1_random:15212-15234 TGGAATATGGAGAAAAGGAAAGG - Intergenic
1123493858 15:20803653-20803675 TCATATATCAAAAAAAGGAAAGG + Intergenic
1123550356 15:21372735-21372757 TCATATATCAAAAAAAGGAAAGG + Intergenic
1123571353 15:21613449-21613471 TCTTACATGCTGAAAAGCAAGGG - Intergenic
1123607470 15:22048801-22048823 TCTTACATGCTGAAAAGCAAGGG - Intergenic
1124105449 15:26733609-26733631 TGTTTTATGCAGAAAAAGAAAGG + Intronic
1124455924 15:29842812-29842834 TCTTCTATGTGGAAAAGAAAGGG - Intronic
1125016738 15:34945786-34945808 TTTTAAATGAAAAAAAGGAATGG - Intronic
1125069864 15:35541173-35541195 TTTTATAGGAAGAAATGGAAAGG - Intronic
1125087899 15:35752415-35752437 CCGCACATGGAGAAAAGGAAAGG - Intergenic
1125993685 15:44135263-44135285 TCACAAATGGAGAAAAGGAAAGG + Intronic
1126398261 15:48242370-48242392 TCTTATAAGCAGAAGAGGACTGG - Intronic
1126455203 15:48853807-48853829 TTGTATATGGTGAAAAGTAAGGG - Intronic
1126526765 15:49664875-49664897 TTTGATATGGGGGAAAGGAAAGG + Intergenic
1126625913 15:50686083-50686105 TTTTACATGGAAAAAAGGGAGGG - Intronic
1126721236 15:51582591-51582613 ACTAAAATGGAGAGAAGGAATGG - Intronic
1126875440 15:53035965-53035987 TCACCTATGGAGAAAAGGTAAGG - Intergenic
1126988110 15:54338619-54338641 TCAAATATGAAGAAAAGGTATGG - Intronic
1128004154 15:64222386-64222408 TCTTCTAAGGAGAAAAAAAACGG - Intronic
1128268093 15:66284702-66284724 TCTTGTTTGTAGAAATGGAAGGG + Intergenic
1128414408 15:67431219-67431241 TTTTATATGAGGAACAGGAATGG - Intronic
1129098789 15:73238613-73238635 TATCATTTGGAGAACAGGAAAGG + Intronic
1129818238 15:78575085-78575107 TTTAGTATGGTGAAAAGGAAAGG - Intronic
1130537318 15:84796584-84796606 TCTGATATCGATAAAAGGAAAGG + Intronic
1130581625 15:85142532-85142554 TCATAAATGGAAAAAAGCAAAGG + Intergenic
1131618516 15:94042332-94042354 TCTTATCAGGAGAAAAGGAGGGG - Intergenic
1132135477 15:99333698-99333720 TCTTAAATGGAGAAAAGGGCTGG - Intronic
1132233794 15:100204047-100204069 GCTTCTACTGAGAAAAGGAAAGG - Intronic
1202958699 15_KI270727v1_random:99989-100011 TCATATATCAAAAAAAGGAAAGG + Intergenic
1202979707 15_KI270727v1_random:340580-340602 TCTTACATGCTGAAAAGCAAGGG - Intergenic
1133962893 16:10510063-10510085 CCTTATTTGGAAAAAAGGATCGG + Intergenic
1134532635 16:14996217-14996239 TCTTATATTGATAAATGGAGTGG + Intronic
1137735002 16:50717223-50717245 TCTTAGACACAGAAAAGGAAAGG - Intronic
1138929972 16:61641499-61641521 TCTTATTTTGACAAAAGGAAAGG + Intergenic
1139127244 16:64093380-64093402 TAGTATATGGAAAAAATGAACGG + Intergenic
1139196711 16:64927730-64927752 TTTTATATGGTGAAAGGTAAGGG - Intergenic
1139980173 16:70851003-70851025 TTGTATATGGTGAAAAGTAAGGG - Intronic
1140946795 16:79776191-79776213 TCAGATATGGAGAAAAACAAAGG - Intergenic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1141906832 16:87032322-87032344 TATTAAAAGGAGAAAAGGAAAGG - Intergenic
1144602864 17:16633906-16633928 TCTCATTTGGAGAATGGGAAAGG - Exonic
1144714902 17:17427107-17427129 TCTTATATAGGGCCAAGGAAGGG + Intergenic
1146792164 17:35757675-35757697 ATTTGTATAGAGAAAAGGAATGG - Intronic
1147414494 17:40278732-40278754 TCATATTTGGAGAAAGGGCAAGG + Exonic
1151029466 17:70719418-70719440 GGCTATATGGAGAAAAGAAATGG + Intergenic
1151968112 17:77442550-77442572 TCTTAATAGGAAAAAAGGAAGGG + Intronic
1153016764 18:589720-589742 TCTAACATGCAGAAAGGGAAAGG - Intergenic
1153492985 18:5669201-5669223 TCTTAAAGGGAAAAGAGGAAAGG + Intergenic
1154377258 18:13820617-13820639 CCTTACTTAGAGAAAAGGAAAGG - Intergenic
1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG + Intronic
1155378633 18:25191263-25191285 TCATGGATGGAGAAAATGAATGG - Intronic
1155444226 18:25893992-25894014 TCTGATATGATGAAAAAGAATGG + Intergenic
1155661295 18:28251924-28251946 TCTTATAGGGGGAAGAGGAAAGG + Intergenic
1156576950 18:38328165-38328187 CCTTAGATGGGGAAAAGGGAAGG + Intergenic
1156911970 18:42421874-42421896 TTATATATGGAGAAAAATAAGGG + Intergenic
1157115385 18:44857802-44857824 TCTTATTTGGAGAAGAGGTCTGG + Intronic
1157918482 18:51692819-51692841 GCTTAAATGGACAAAAGTAATGG + Intergenic
1158980263 18:62753691-62753713 TGTTATATCCTGAAAAGGAAGGG - Intronic
1159242940 18:65766690-65766712 TTTTATATGGGGAGAAGGAAGGG + Intronic
1161054525 19:2183510-2183532 GCTTTTCTGGAGAAATGGAAAGG - Intronic
1163229200 19:15988500-15988522 TATTTCCTGGAGAAAAGGAAGGG + Intergenic
1165285150 19:34835696-34835718 TCTTGTGTGCAGAAAAGGCATGG + Intergenic
1166488835 19:43239745-43239767 TCTTCTTTGGAGAAATGGGAGGG + Intronic
1167874519 19:52400343-52400365 TCTTACATGGAGCACAGAAAAGG - Intronic
1168566998 19:57433681-57433703 CTTTATATTCAGAAAAGGAAAGG - Intronic
1168574864 19:57501081-57501103 GTCCATATGGAGAAAAGGAAAGG + Intronic
926178199 2:10616101-10616123 TCTTCTCTGGAGTAAATGAAAGG + Intronic
926869446 2:17396871-17396893 TGTCATATGGAGAAAAGTATAGG - Intergenic
927070242 2:19521166-19521188 TTTTATATGGTGAAAGGTAAAGG - Intergenic
927328414 2:21833538-21833560 TCTTCTTTGCAGAAAAGGCAGGG - Intergenic
928525771 2:32138832-32138854 TTGTATATGGTGAAAAGTAAGGG + Intronic
928648873 2:33384198-33384220 TCTTAAATTGAAAAAAGAAAAGG - Intronic
928956872 2:36878276-36878298 TTCTATATAGTGAAAAGGAAAGG - Intronic
929230738 2:39557246-39557268 AGTAATATGGAGAAAAGGCAGGG - Intergenic
930158823 2:48132308-48132330 TCTTTTAAGAAGAAAAGAAAAGG - Intergenic
930373957 2:50540570-50540592 TCTTTTAATGACAAAAGGAAAGG + Intronic
930705850 2:54504118-54504140 TCTGATTAGGAGAAAAGTAAGGG + Intronic
930934812 2:56935785-56935807 CTTATTATGGAGAAAAGGAAAGG + Intergenic
930992905 2:57682054-57682076 TATTTGAGGGAGAAAAGGAAGGG - Intergenic
931171609 2:59809295-59809317 TCTTATTTGGAGAAAAGATACGG + Intergenic
932088098 2:68780338-68780360 TCTGGTAAGGAGAGAAGGAAAGG - Intronic
933215883 2:79629556-79629578 GCTGAGATGGAGCAAAGGAAAGG + Intronic
933324774 2:80821232-80821254 TGTTTTCTGGAGTAAAGGAAAGG + Intergenic
934479233 2:94619488-94619510 TCTTATCTATAGAAAAGAAAAGG - Intergenic
934685918 2:96321671-96321693 TCACATGAGGAGAAAAGGAAAGG + Intergenic
934888016 2:98041427-98041449 CTTTAGATGGAGAAAAGGAAAGG - Intergenic
935208380 2:100917052-100917074 TCTTATTAGAAAAAAAGGAAAGG + Intronic
937099189 2:119255566-119255588 TGTTATTTGGAAAAAAGGAGGGG - Intronic
938324497 2:130389373-130389395 TATTACATGAATAAAAGGAATGG + Intergenic
939542945 2:143515766-143515788 ACTTATATGTAGAAAATCAATGG + Intronic
939621518 2:144425095-144425117 GCTTATTTGGAGCAAATGAAGGG + Intronic
939919795 2:148095868-148095890 TCTTATGTGGGGAGAAGGAAGGG + Intronic
939956601 2:148532585-148532607 TCAGATATGGGGAGAAGGAAGGG + Intergenic
941092131 2:161189807-161189829 TTGTATATGGAGAAAGGCAAGGG - Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941419761 2:165268724-165268746 TCTTATCTGTAGATGAGGAACGG + Intronic
943000551 2:182323324-182323346 TCTTATTTGGAGAGAAGAAATGG - Intronic
943278512 2:185899830-185899852 TTTTATATGGAAAAAAAGGAAGG - Intergenic
943399846 2:187394063-187394085 TCTTAAAAGAAGAAAAGAAAGGG + Intronic
944968474 2:204963249-204963271 TCTTATGTGGATAAAATGTATGG + Intronic
945263705 2:207869382-207869404 TGGTATATGGAGAAAGGGAAAGG - Intronic
945652391 2:212579403-212579425 CCTTATGTGGAGGAAAGCAAAGG - Intergenic
945687440 2:212988830-212988852 TCTTATATGGAGGAAAACAATGG - Intergenic
945840014 2:214876402-214876424 TATGATAAGGAGAAAAGAAAGGG + Intergenic
946030408 2:216699268-216699290 TTTTCTTTGGAGAAAAGGTATGG + Intergenic
946616001 2:221510949-221510971 TCATATATGTATAAAGGGAATGG + Intronic
946679571 2:222199119-222199141 TCTCATCTGTACAAAAGGAATGG + Intergenic
947288804 2:228547910-228547932 ACTTATGTGGAGAGAAGAAAGGG + Intergenic
947626193 2:231620577-231620599 CCCTATATGGAGGAAAGGATGGG - Intergenic
948693532 2:239721386-239721408 CTTTATGTGGAGACAAGGAAAGG + Intergenic
1168868709 20:1110582-1110604 TGTCATATGGAGAAAGAGAAGGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1169854322 20:10086905-10086927 TGCTATATGGGGAAAAGTAAAGG + Intergenic
1170415233 20:16132745-16132767 TCTTATAGGGAGAAAATTGAGGG - Intergenic
1170579588 20:17687765-17687787 TCTTGTCTTGGGAAAAGGAAGGG + Intergenic
1172617563 20:36299200-36299222 TCTCACATGGAAGAAAGGAAAGG - Intergenic
1174662676 20:52227841-52227863 TCTTAGAGGGAGCAAAGGCAGGG - Intergenic
1175093770 20:56525545-56525567 TCTTTCAGGTAGAAAAGGAAGGG + Intronic
1175918286 20:62437854-62437876 TCTTCTTTAGAGAAGAGGAAGGG + Intergenic
1175970957 20:62686639-62686661 TATTATAAGGTGAAAAGAAAAGG + Intergenic
1176360132 21:5988264-5988286 TGTGACATGGAGAATAGGAAGGG + Intergenic
1176590409 21:8643855-8643877 TGGAATATGGAGAAAAGGAAAGG - Intergenic
1177071548 21:16515026-16515048 TTGTATATGGTGAAAAGTAAAGG + Intergenic
1177112420 21:17044454-17044476 TCTTTTAAGGAGAAAACTAAAGG - Intergenic
1177162743 21:17565727-17565749 TCATATATCAAAAAAAGGAAAGG - Exonic
1177960018 21:27652279-27652301 TGTTAAATGGAGACTAGGAAGGG + Intergenic
1178195666 21:30342185-30342207 TCTTGAATGGAGATGAGGAATGG - Intergenic
1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG + Intronic
1178931410 21:36821861-36821883 GCTAAAATGGAGAAAGGGAAGGG + Intronic
1179398603 21:41063399-41063421 TGTTATTTGAAGAAAGGGAAGGG + Intergenic
1179574927 21:42301999-42302021 TCAAATATGGAAAAAAGAAACGG - Intergenic
1179763386 21:43550286-43550308 TGTGACATGGAGAATAGGAAGGG - Intronic
1179952760 21:44720062-44720084 TACTATATGGAGAAAAAGCAGGG - Intergenic
1180273239 22:10620888-10620910 TGGAATATGGAGAAAAGGAAAGG - Intergenic
1184565372 22:45288747-45288769 TGTTACATGGAGGAAAGAAATGG + Intronic
949136870 3:577820-577842 TGGAATATGGACAAAAGGAAAGG + Intergenic
949189318 3:1232794-1232816 TCTGAATTGGAGAAAAGGCAAGG + Intronic
950454786 3:13086210-13086232 TCCTATATGGAAAATGGGAAAGG + Intergenic
951032649 3:17899858-17899880 TCTTGTATTGAGAAAAAAAATGG + Intronic
951354945 3:21654528-21654550 ATTTACATGTAGAAAAGGAAGGG - Intronic
951732449 3:25825195-25825217 TTGTATATGGTGAAAGGGAAGGG - Intergenic
952282336 3:31935834-31935856 TTTCATATGTAGAAAGGGAAAGG + Intronic
952612150 3:35224993-35225015 TATTATGTGGAGGAGAGGAAAGG - Intergenic
954077860 3:48194453-48194475 TCTTCCATGGGGAAAAGGAGGGG - Intergenic
954792701 3:53144785-53144807 TCTTTTCTGGAGAAGAAGAAAGG - Intergenic
955020353 3:55114886-55114908 CCATAAAGGGAGAAAAGGAAGGG + Intergenic
955045526 3:55356166-55356188 TCTTATATGGTGTAAGGTAAGGG + Intergenic
955829883 3:62989930-62989952 TGTTTTGAGGAGAAAAGGAACGG - Intergenic
955881812 3:63554382-63554404 TTTTATATGGTGAAAGGTAAGGG + Intronic
955909387 3:63844685-63844707 TGTGAGATGGAGAAAAGAAATGG - Intronic
956864898 3:73359565-73359587 TTTTATATGGTGAAAGGTAAGGG - Intergenic
957425619 3:80035433-80035455 TCTAACAGGGAGAAAAGAAAAGG - Intergenic
957772688 3:84715028-84715050 TTTTATATGGTGAAAGGGAGGGG - Intergenic
958798075 3:98727804-98727826 TCTTCTAAGGAGAAAAGTTAAGG + Intergenic
959128351 3:102318967-102318989 TCATATATGGTCAAAAGTAAGGG + Intronic
959806501 3:110561432-110561454 ATTTATTTGGAGAAAAGAAAGGG - Intergenic
961433690 3:126901511-126901533 TCTGAGAGGGAGAAAAGGAATGG + Intronic
961957666 3:130820884-130820906 GTTTATATTGAAAAAAGGAAAGG + Intergenic
962510031 3:136089254-136089276 TTTTATATGGTAAAAAGTAAGGG + Intronic
962888469 3:139650177-139650199 TATTATATGGAGAAGAGAGAGGG - Intronic
963223011 3:142831718-142831740 ACTTATAAGCAGCAAAGGAAAGG + Intronic
963280882 3:143383887-143383909 CCTTATAAGGAGAACAGTAACGG + Intronic
964064916 3:152565442-152565464 TCCAATCTAGAGAAAAGGAAAGG - Intergenic
964616003 3:158665851-158665873 TATAATATAGATAAAAGGAAGGG + Intronic
964780917 3:160336974-160336996 TCAGATATGGAGAAAAGGAGAGG - Intronic
964963120 3:162453236-162453258 TCTTAGAAGGATAAAAGCAATGG - Intergenic
965121620 3:164565968-164565990 TCTAAAATTGAGAAAGGGAAAGG - Intergenic
965386577 3:168053739-168053761 TCTTTTATGGAGGAATGGGATGG - Intronic
966228692 3:177626672-177626694 TCTGGTACGGAGAAAAAGAATGG + Intergenic
966548189 3:181174882-181174904 ACTAGGATGGAGAAAAGGAAAGG - Intergenic
967088219 3:186112912-186112934 TCTTGTATGGGGGGAAGGAAGGG + Intronic
967358126 3:188596447-188596469 TTGTAGATGGATAAAAGGAATGG - Intronic
967511431 3:190318037-190318059 TTTAATATGGAGAAAAGCCAGGG - Intronic
968219949 3:196929574-196929596 TCTTATCTGAAGAGAAGTAATGG + Intronic
968358407 3:198126586-198126608 TTTTATATGGTGTAAAGTAAGGG + Intergenic
969634086 4:8355858-8355880 TCTTAGATAGAGAACAAGAATGG + Intergenic
969888667 4:10239584-10239606 GCTTTTAGGGACAAAAGGAAAGG + Intergenic
969901171 4:10351098-10351120 TCTTATATGGAGAAAATTTAAGG - Intergenic
970515818 4:16829128-16829150 TCTTCTCTGGAGAAATGAAAAGG + Intronic
970771141 4:19614241-19614263 TCTTTTATGTATAAAAGGGAAGG - Intergenic
971010089 4:22424614-22424636 TCTCAAATGGAGGAAAAGAAAGG + Intronic
971511230 4:27426799-27426821 TCTTTGATGAAGACAAGGAAAGG + Intergenic
971543574 4:27854677-27854699 AAATATATAGAGAAAAGGAAAGG + Intergenic
971627487 4:28941096-28941118 TATTATTTGAAGAAAAGAAAGGG + Intergenic
971661257 4:29419225-29419247 TATTATTTGGAGCAAATGAAAGG - Intergenic
971997426 4:33983211-33983233 TATTCTAGGAAGAAAAGGAATGG - Intergenic
973067678 4:45817702-45817724 TCTTAGTTGTAGAAAAGGCAGGG + Intergenic
974001195 4:56512401-56512423 TTTTAAAAGGAGAGAAGGAAAGG - Intronic
974202910 4:58663944-58663966 TCCTAGATGTAGACAAGGAAAGG + Intergenic
974203278 4:58668355-58668377 TCCTAGATGCAGACAAGGAAAGG - Intergenic
974229713 4:59094140-59094162 TGTTATATGGGGAAAAAAAAAGG - Intergenic
974599287 4:64055596-64055618 TTTTATATGGTGAAAGGTAAGGG + Intergenic
974627642 4:64444697-64444719 TCCAATAAAGAGAAAAGGAAAGG - Intergenic
975639934 4:76490359-76490381 TCTGACATGCAGAAAAGGCAGGG + Intronic
975697003 4:77023425-77023447 TTATATATGGAAAAAAGTAAAGG - Intronic
976385765 4:84456230-84456252 GCCAAAATGGAGAAAAGGAAGGG + Intergenic
976511305 4:85912205-85912227 TCTAATATGGAGAAAAATATTGG - Intronic
976650710 4:87431111-87431133 TTTTATATGGTGAAAGGTAAGGG + Intronic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
976895364 4:90103641-90103663 TCTTGTGTAGAGAAATGGAAAGG + Intergenic
977409110 4:96638734-96638756 TCTTATATGAACAAGAGAAAAGG - Intergenic
978382530 4:108144624-108144646 TCTAATCTAGAGAGAAGGAAGGG + Intronic
978679652 4:111364342-111364364 TCATATATGGTGAAAAGTAAGGG - Intergenic
979663755 4:123288262-123288284 GCAGATATGGAGACAAGGAAGGG + Intronic
979716384 4:123844004-123844026 TCTTATTTGTAGATAAAGAAGGG + Intergenic
980825974 4:138073668-138073690 TCTTATCTGGGGAGAGGGAAGGG - Intergenic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
981825017 4:148930016-148930038 TCATATATGAAGAAAAGGCATGG + Intergenic
981930045 4:150179987-150180009 ACTTTTATGGAGTAAATGAATGG - Intronic
982121037 4:152144018-152144040 GTTTATGTAGAGAAAAGGAATGG + Intergenic
982982322 4:162155157-162155179 CATTATATGGCAAAAAGGAAGGG + Intronic
983331987 4:166341753-166341775 TGACATATGGAGAATAGGAATGG - Intergenic
983380752 4:166989950-166989972 TCTTATAAGTAGAAAGGGAAGGG + Intronic
983407648 4:167350203-167350225 TTGTATATGGTGAAAGGGAAGGG + Intergenic
983520783 4:168706631-168706653 TCAGAAATGGGGAAAAGGAAAGG + Intronic
984369271 4:178841210-178841232 GTTTATATGAAGAATAGGAATGG + Intergenic
985395800 4:189542316-189542338 TTATATATGGAGAAAAGAAGGGG - Intergenic
987206209 5:15628880-15628902 TCTTTTGTGGCCAAAAGGAAGGG - Intronic
987384655 5:17317758-17317780 TCTTATAAGGAGGGAAGGACTGG + Intergenic
987557442 5:19472629-19472651 TTTTGTATGGAGAAAAGAACTGG + Intergenic
988188154 5:27894269-27894291 GCATATATTGAGAAAAGGAATGG + Intergenic
988485526 5:31665411-31665433 TCTTTTATGGAGGCAAAGAAAGG + Intronic
988651474 5:33156718-33156740 TTGTATATGGTGAAAGGGAAGGG + Intergenic
989758103 5:44980643-44980665 TTGTATATGGTGAAAAGTAAGGG - Intergenic
990295499 5:54397741-54397763 TCTTTTATGGAAAGAAAGAAGGG - Intergenic
990822793 5:59861562-59861584 AATTATATGGAGAAAAAGAGAGG + Intronic
991423950 5:66471257-66471279 TTTTATAAGGAAAAAAGAAAAGG - Intergenic
991967447 5:72107287-72107309 TTTTATATGGAGACTAGGCAGGG - Exonic
992675497 5:79101954-79101976 TCTGATAGGAAGATAAGGAAAGG + Intronic
992944531 5:81796860-81796882 TCTTATCTTGAAAAAAGTAAAGG - Intergenic
993482931 5:88447645-88447667 TCTGGTATGGAGAGAAAGAAGGG - Intergenic
993707982 5:91193281-91193303 TATTATAGGGAGATGAGGAAGGG + Intergenic
995178502 5:109207252-109207274 TCTTATTTGGTGAGAAGTAAGGG - Intergenic
995631452 5:114137586-114137608 TTTTATATGCAGAAATGGCATGG + Intergenic
996531034 5:124527201-124527223 TCTTATGTGTAAAAATGGAATGG - Intergenic
996690273 5:126333094-126333116 TTTTATATTGGGAAAGGGAAAGG - Intergenic
996853423 5:127977989-127978011 TCTTTTACAGAAAAAAGGAATGG - Intergenic
999006330 5:147984057-147984079 TATTGTATGGAGAAAAGCCATGG + Intergenic
1000231772 5:159322239-159322261 TCTTCAATGTAGACAAGGAAGGG + Intronic
1000812430 5:165879376-165879398 TCTCACATGTAGAACAGGAAAGG + Intergenic
1001688243 5:173612060-173612082 TGTTCTCTGGAGAAAGGGAAAGG + Intronic
1003205343 6:4004589-4004611 TCTCAGCTGGTGAAAAGGAATGG + Intergenic
1003658918 6:8042298-8042320 TTTTATTTTGAGAAAAGAAAGGG - Intronic
1004123620 6:12850825-12850847 TCTTATAAGGAGAGAAGAAGAGG - Intronic
1004434658 6:15578727-15578749 TCTTCCATGCAGAAAAGCAATGG + Intronic
1004551276 6:16650229-16650251 TATTATATGGAGAGATGGAAGGG + Intronic
1004616741 6:17297854-17297876 TCTTGTATATAAAAAAGGAATGG - Intergenic
1004793620 6:19056553-19056575 TTGTATATGGTGAAAAGTAAGGG - Intergenic
1005362334 6:25042614-25042636 TCGTAGGTGGAGAAAAAGAATGG - Intergenic
1006391929 6:33763607-33763629 TGTTAAATTGAGAAATGGAAGGG - Intergenic
1007343274 6:41207628-41207650 CATTATCAGGAGAAAAGGAAGGG + Intergenic
1007442129 6:41871206-41871228 ACATATTTGGAGAAAAAGAAGGG + Intronic
1008315524 6:50035164-50035186 TTTTATATGGTGAAAGGTAAGGG - Intergenic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1008646201 6:53517417-53517439 TTTTATATTAAGAAAAGGTAGGG - Intronic
1008663550 6:53694181-53694203 GCGCATATGGAGAAAAAGAATGG - Intergenic
1008792391 6:55252566-55252588 ACTTATTTGCAGAGAAGGAATGG + Intronic
1009024495 6:57982643-57982665 TTTTATATGAAGTAAAGAAATGG - Intergenic
1009200076 6:60734114-60734136 TTTTATATGAAGTAAAGAAATGG - Intergenic
1009343126 6:62583933-62583955 GCTTTCATAGAGAAAAGGAAAGG - Intergenic
1009488027 6:64250146-64250168 TCAGATCTGGAGAAAAGGATAGG - Intronic
1010137119 6:72568395-72568417 TCTTATTAGGAAAATAGGAAAGG + Intergenic
1010301228 6:74262610-74262632 TCTTACATTGAGAAATGCAACGG + Intergenic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1011489793 6:87879383-87879405 TTTTATCTGGAGAAAAGGTTTGG - Intergenic
1012070786 6:94612870-94612892 TTGTATATGGTGAAAAGGTAGGG - Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012191497 6:96286017-96286039 GTTTATATAGAGAAAAGAAATGG + Intergenic
1012944910 6:105455043-105455065 TCTTTTAAGCAGAAAGGGAAAGG + Intergenic
1013643244 6:112108781-112108803 TCTTTTAAGGAGATAAGGAAGGG + Exonic
1014179491 6:118369394-118369416 TTTTATATGGTGAAAGGAAAGGG - Intergenic
1014670308 6:124295855-124295877 TATTTTATGGAGAAGAGTAAAGG - Intronic
1015420244 6:132999403-132999425 TCCTAAATGTAGAAAAGCAATGG + Intergenic
1016387232 6:143540285-143540307 CCTGAAATGGAGAAGAGGAAGGG + Intronic
1017417031 6:154232095-154232117 TATTGTATGGAGAGAAGGAGGGG - Intronic
1017472191 6:154749933-154749955 ACTAATAGGGAGAAGAGGAAGGG + Intronic
1017541432 6:155407073-155407095 TCTTCTCTGGAGAAATGCAAGGG - Intronic
1017774547 6:157670618-157670640 GGTTATTTGGAGGAAAGGAAAGG - Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018619565 6:165716705-165716727 TCTGTTATGAAGAAAAGCAAGGG + Intronic
1018698748 6:166411009-166411031 TCTTCTATGGAGAAAATGTGAGG + Intronic
1019045943 6:169146190-169146212 TCAGATTTAGAGAAAAGGAATGG + Intergenic
1019812008 7:3171736-3171758 TCCTCTCTGGAAAAAAGGAATGG - Intronic
1019863763 7:3685658-3685680 TTTTAGAAGTAGAAAAGGAAAGG + Intronic
1021517789 7:21506388-21506410 TCCTAAATGGAAAAAAGAAAAGG - Intronic
1022484710 7:30769561-30769583 TCTTATATGTAGAGAGAGAAGGG - Intronic
1022893190 7:34722021-34722043 TATTTTATAGAGAAAAGGAGGGG + Intronic
1022901131 7:34811602-34811624 TCTTACATGGACAAGAGAAAGGG - Intronic
1023139648 7:37088987-37089009 TCGTATTTGGAGAAAAAAAAAGG + Intronic
1023701932 7:42900843-42900865 CCTCTTATGAAGAAAAGGAATGG + Intergenic
1024728035 7:52221791-52221813 CCTTATATTCAAAAAAGGAAAGG + Intergenic
1024824889 7:53379856-53379878 TCTTAGATTGAGGGAAGGAAGGG - Intergenic
1025159754 7:56646275-56646297 TCTAATATGAACAAAAGGTAAGG + Intergenic
1025726950 7:64073039-64073061 TCTAATATGAACAAAAGGTAAGG - Intronic
1026048785 7:66927345-66927367 TCTCATAAAGACAAAAGGAAAGG - Intronic
1028624612 7:92863707-92863729 TCTCAGATGGAGATGAGGAAGGG - Intergenic
1028735897 7:94211647-94211669 TTTTTTATGAGGAAAAGGAAAGG + Intergenic
1028803824 7:95000615-95000637 TCTTATATTGATAAAAGATAGGG + Intronic
1029867796 7:103654092-103654114 CCTTATATGAGGAATAGGAAAGG + Exonic
1029986829 7:104930376-104930398 TCTTACCTGGAGAAAAGGAGAGG - Intergenic
1030375308 7:108746501-108746523 TCTTACAGAGAGAAATGGAAGGG - Intergenic
1030604355 7:111623369-111623391 ATTTATATGGAATAAAGGAATGG - Intergenic
1031261203 7:119523451-119523473 TGTAATATTGACAAAAGGAAAGG - Intergenic
1031394521 7:121256400-121256422 TTGTATATGGTGAAAAGTAAGGG - Intronic
1032791986 7:135249062-135249084 TCTCACATGAAGAAAACGAAAGG + Intronic
1035131538 7:156659114-156659136 TTTCATATGGGGACAAGGAATGG - Intronic
1035910948 8:3565970-3565992 TATTATATTGATGAAAGGAATGG - Intronic
1037694073 8:21208302-21208324 TCAAATATGGAGAGAAGGACAGG + Intergenic
1039365968 8:36928151-36928173 TTTTATATTGAGAAAAATAATGG - Intronic
1039724194 8:40197740-40197762 TTTTATGTGGAGGAAAGGAATGG - Intergenic
1041017529 8:53606515-53606537 TTTTATATGGTGAAAAGAAGGGG - Intergenic
1041757004 8:61324723-61324745 TCTCATATGGAGATGAGGAATGG + Intronic
1041805115 8:61841258-61841280 TCTTATCAGGCAAAAAGGAAGGG - Intergenic
1041927945 8:63255964-63255986 TCTGATTTGGAGAAGAGGAAAGG - Intergenic
1042719229 8:71809051-71809073 CCTTATATGGAGAATTCGAAGGG - Intergenic
1043142846 8:76611912-76611934 TGTTACATCCAGAAAAGGAAAGG + Intergenic
1044120237 8:88385477-88385499 TCTTGTGTGGAAAAAAGCAAGGG - Intergenic
1044235870 8:89829382-89829404 TCTCATATGGTGATAATGAAAGG - Intergenic
1044360994 8:91283420-91283442 TCTTTTATGAACAAGAGGAATGG - Intronic
1045136796 8:99229583-99229605 TCTCATGTAGAGAAAAGGTATGG + Intronic
1045817156 8:106290270-106290292 TCGTATTTGGTGAAAAGTAAGGG - Intronic
1046077363 8:109329270-109329292 TCTTCAAAGGAGAAAAGGAGGGG + Intronic
1046325019 8:112630663-112630685 TCTGATATGGATAAAAAGAGAGG + Intronic
1047374211 8:124280885-124280907 TTTTTAATGGAGAACAGGAAAGG - Intergenic
1048538242 8:135317737-135317759 TGTTGTAGGGAGAAAGGGAAGGG - Intergenic
1048679350 8:136822487-136822509 TTATATATGGCGAAAAGTAAGGG - Intergenic
1050224927 9:3442648-3442670 TCACAAAAGGAGAAAAGGAATGG + Intronic
1050458098 9:5853258-5853280 GCTTCTAGGCAGAAAAGGAAAGG + Intergenic
1051730284 9:20134805-20134827 TCTGCTATGCAGAAATGGAAAGG + Intergenic
1051954191 9:22670043-22670065 AATTATATGGAGAAAAGGTAGGG - Intergenic
1051989661 9:23137016-23137038 GCTTATTTGAAGAAAAGTAATGG - Intergenic
1052659323 9:31407895-31407917 AGTTATATGAAGAAAAGGAAGGG - Intergenic
1052727754 9:32250386-32250408 CTTAATATGGAGGAAAGGAAAGG + Intergenic
1053000552 9:34575106-34575128 TCTTGAATGGAGAGGAGGAAGGG + Intronic
1053492641 9:38521536-38521558 TATTATATGAAGCAATGGAAAGG + Intergenic
1053678593 9:40464077-40464099 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1053928579 9:43092431-43092453 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1054285131 9:63160865-63160887 TCTTATCTATAGAAAAGAAAAGG - Intergenic
1054291671 9:63299615-63299637 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1054389687 9:64604158-64604180 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1054506025 9:65912218-65912240 TCTTATCTATAGAAAAGAAAAGG - Intergenic
1055034915 9:71808317-71808339 GCTGACATGGAGAAAAGGACAGG - Intronic
1055432815 9:76261295-76261317 TCCTATTTGGAGAAAGGCAACGG - Intronic
1055654751 9:78441051-78441073 GCTGATATGGGGAAAAGGATAGG - Intergenic
1055932536 9:81574196-81574218 TCTTAGATAGAAAAAAAGAAAGG + Intergenic
1056728950 9:89147441-89147463 TCGCATATGCAGAAATGGAAGGG - Intronic
1056829413 9:89902732-89902754 TCTTATATTGTGTAAAGCAAAGG - Intergenic
1057672875 9:97110471-97110493 TATTATATGAAGCAATGGAAAGG + Intergenic
1059037635 9:110774710-110774732 TCTTATATGAAGAAAACAATGGG - Intronic
1059068171 9:111106782-111106804 TATTATAAGGAAAAAAGAAAGGG - Intergenic
1059228273 9:112693408-112693430 AAATATATGGAGAAAACGAATGG - Intronic
1059510945 9:114846169-114846191 TCTGATAAGAAGAAAAGTAAGGG + Intergenic
1060313780 9:122489258-122489280 TTATATATGGAATAAAGGAATGG - Intergenic
1062191059 9:135248111-135248133 CCCCAGATGGAGAAAAGGAAGGG - Intergenic
1062742277 9:138183132-138183154 TTTTATATGGTGTAAAGTAAGGG + Intergenic
1203620417 Un_KI270749v1:122520-122542 TGGAATATGGAGAAAAGGAAAGG - Intergenic
1185810404 X:3103754-3103776 TCTTATAGGTGGAAAAGGCATGG + Exonic
1187042510 X:15611858-15611880 TCATAGATGAAGAAAATGAAAGG + Intergenic
1187303632 X:18075277-18075299 TCTTTTATGGGGAAAATGAAAGG + Intergenic
1187665853 X:21608596-21608618 TCTCCTATGAAGAAAAGGAAGGG + Intronic
1188137494 X:26507274-26507296 TACTATCTGGAGAAAAAGAAAGG + Intergenic
1188162999 X:26825214-26825236 TCTTATGTAGAAAAAATGAAAGG + Intergenic
1188459472 X:30407079-30407101 TTTTATGTGTAGAAAAGTAATGG - Intergenic
1189000796 X:36942575-36942597 TCTTCTAAGAAGAAAAGGGAAGG - Intergenic
1189609762 X:42719673-42719695 TCTTCTTTGGAAAAAAAGAAAGG - Intergenic
1189658462 X:43272224-43272246 TTAAATATGGAGAAAAAGAAAGG + Intergenic
1190138728 X:47821140-47821162 TTTTAAATGAAGAAAAGAAATGG + Intergenic
1190914853 X:54803745-54803767 TCTGTTCTGGAGATAAGGAAAGG - Intergenic
1191614441 X:63153711-63153733 TTGTATATGGTGAAAAGCAAGGG - Intergenic
1191621855 X:63225215-63225237 TTGTATATGGTGAAAAGCAAGGG + Intergenic
1192085635 X:68094406-68094428 ACATATATGTAGAAATGGAAAGG - Intronic
1192290596 X:69790340-69790362 TGAAATTTGGAGAAAAGGAAGGG + Intronic
1192832007 X:74760416-74760438 TCTAATATGTTGAATAGGAACGG + Intronic
1192889694 X:75376574-75376596 TTGCATATGGAGAAAAGTAAGGG + Intronic
1193263297 X:79436636-79436658 TTATATATGGTGAAAAGTAAGGG - Intergenic
1193729475 X:85085614-85085636 TCTTTTATGCAGAAAAGGTATGG + Intronic
1194068005 X:89285279-89285301 TCTCATGGAGAGAAAAGGAAGGG - Intergenic
1194560689 X:95415945-95415967 TGTTAAAGGGAGAAAAGGAGGGG + Intergenic
1194805597 X:98323523-98323545 TTGTATATGGTGAAAAGGAGTGG - Intergenic
1195459435 X:105107450-105107472 TCTTATACTGAAAAAATGAAAGG - Intronic
1195500271 X:105589550-105589572 TTTTATATGGTGAAAAGAAGGGG + Intronic
1196178643 X:112667225-112667247 CCTTACATGGAGAAAAGCACTGG + Intronic
1196754204 X:119143601-119143623 TCCTTTCTGGAGAAGAGGAAAGG - Intronic
1197618978 X:128725530-128725552 TCTGAGAGGGAGAAAAGCAAGGG + Intergenic
1197636389 X:128919499-128919521 CATTATATGGGGAAATGGAAAGG + Intergenic
1197840529 X:130741410-130741432 TCTTAGAGGGAGAAAATGAAAGG - Intronic
1198171012 X:134105239-134105261 TCTCAAAAGGAGAAAAGGCAAGG + Intergenic
1198588154 X:138145867-138145889 TTTTATAAGGAAAAAGGGAAAGG + Intergenic
1200722149 Y:6619440-6619462 TCTCATGGAGAGAAAAGGAAGGG - Intergenic
1201270739 Y:12251549-12251571 TTTTATACTCAGAAAAGGAAAGG + Intergenic
1201369286 Y:13243777-13243799 TGTCATTTGGAGAAAATGAATGG + Intergenic