ID: 1155192206

View in Genome Browser
Species Human (GRCh38)
Location 18:23439990-23440012
Sequence TGATATGTGAATACGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155192206_1155192211 16 Left 1155192206 18:23439990-23440012 CCTTCCTCCGTATTCACATATCA No data
Right 1155192211 18:23440029-23440051 AATTTGTTGCCTCACGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155192206 Original CRISPR TGATATGTGAATACGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr