ID: 1155195183

View in Genome Browser
Species Human (GRCh38)
Location 18:23467577-23467599
Sequence CTGTGTAAATTCATTAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155195183_1155195184 -1 Left 1155195183 18:23467577-23467599 CCAAGATTAATGAATTTACACAG 0: 1
1: 0
2: 0
3: 23
4: 211
Right 1155195184 18:23467599-23467621 GAATCAAAGATAATGCTGCATGG 0: 1
1: 0
2: 1
3: 13
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155195183 Original CRISPR CTGTGTAAATTCATTAATCT TGG (reversed) Intronic
901722744 1:11213176-11213198 CTGTTTCAATGGATTAATCTTGG - Intronic
901864945 1:12099695-12099717 GTGTGTAAGTACACTAATCTAGG - Intronic
901961711 1:12831592-12831614 CTGACTCAATCCATTAATCTGGG - Intergenic
901968319 1:12886383-12886405 CTGACTCAATCCATTAATCTGGG - Intronic
901969791 1:12898452-12898474 CTGATTCAATCCATTAATCTGGG - Intronic
901983722 1:13056650-13056672 CTGACTCAATCCATTAATCTGGG - Intergenic
901985009 1:13068496-13068518 CTGATTCAATCCATTAATCTGGG + Intronic
901985272 1:13070649-13070671 CTGATTCAATCCATTAATCTGGG + Intronic
901989753 1:13103096-13103118 CTGATTCAATCCATTAATCTGGG + Intergenic
901992059 1:13123656-13123678 CTGATTCAATCCATTAATCTGGG - Intergenic
901996538 1:13156120-13156142 CTGATTCAATCCATTAATCTGGG - Intergenic
901998093 1:13170122-13170144 CTGACTCAATCCATTAATCTGGG + Intergenic
901998362 1:13172269-13172291 CTGATTCAATCCATTAATCTGGG + Intergenic
902015381 1:13303328-13303350 CTGATTCAATCCATTAATCTGGG + Intergenic
902016854 1:13315400-13315422 CTGACTCAATCCATTAATCTGGG + Intronic
902029336 1:13410269-13410291 CTGATTCAATCCATTAATCTGGG + Intergenic
905087572 1:35395524-35395546 AAGTGTAAAATCATTAATCTAGG - Intronic
905376306 1:37523338-37523360 CTTTCTGAATTGATTAATCTTGG + Intergenic
906320989 1:44815348-44815370 TTGTATAAATTCATTTATCCTGG + Intronic
907212381 1:52834769-52834791 CTGAGTAAAGTCAATATTCTAGG - Intergenic
908107871 1:60864425-60864447 CTTTTTAAATACATTAATTTTGG - Intergenic
908654947 1:66378570-66378592 CTGTTTTAATTCATTACTTTTGG + Intergenic
911564478 1:99447023-99447045 CTGTGTACTTTCATTTCTCTTGG - Intergenic
912969349 1:114266008-114266030 CTGTGTCATTTAATTAATCTGGG - Intergenic
915812408 1:158928083-158928105 CTGTGTAATATCTTTAATTTTGG - Intergenic
916004983 1:160651938-160651960 CAGTGTTACTTCATTGATCTTGG + Intergenic
924646188 1:245879005-245879027 CAGTGTTATTTCTTTAATCTAGG + Intronic
1063475682 10:6326824-6326846 CTGTGTATTTTCATTAATTTTGG - Intergenic
1064558901 10:16576160-16576182 CTTTGTAAATTACTCAATCTCGG + Intergenic
1064734611 10:18368985-18369007 CACTGTAAATTCATTAACTTAGG + Intronic
1064815455 10:19256603-19256625 CTGAGAAAATTAATTAATTTGGG - Intronic
1066268786 10:33801672-33801694 TTGTGTAAAGACATTAAGCTTGG - Intergenic
1066419683 10:35253217-35253239 CTTTGTAAATTTGTTAAACTAGG + Intronic
1068186309 10:53591013-53591035 TTGAGTGAATTTATTAATCTTGG + Intergenic
1069310141 10:67024814-67024836 CTTTTAAAATTCATTAATATTGG - Intronic
1070383675 10:75904185-75904207 CTGTGTATATTTACCAATCTTGG + Intronic
1072007533 10:91267946-91267968 TTGTATAAATAAATTAATCTTGG - Intronic
1073367175 10:102952667-102952689 CTGTTTAAATTCATTAGTTGGGG + Intronic
1073890613 10:108096750-108096772 CTGTGTAACTTCATTCTTCCTGG - Intergenic
1074545512 10:114399303-114399325 CTGTGTACCCTCATTACTCTTGG - Intronic
1075909412 10:126111144-126111166 CTGTGCTAATTCATGAATTTAGG + Intronic
1079808681 11:24967259-24967281 ATCTGTACATTCATTAATTTAGG + Intronic
1081129694 11:39363808-39363830 CTGTGGAATTTCATTAATCAGGG - Intergenic
1081436304 11:43031171-43031193 TTCTGTGAATTAATTAATCTGGG + Intergenic
1082570993 11:54739951-54739973 CTTTATAAATTAATGAATCTGGG + Intergenic
1082758075 11:57097673-57097695 CTGTTTAATTTAATTAATCCTGG - Intergenic
1082921852 11:58504210-58504232 ATGTGAAAATTCATAAATCAGGG - Intergenic
1087016955 11:93563343-93563365 CTGTGTGAAATCATTTTTCTTGG - Intergenic
1088408243 11:109504644-109504666 CCGTGTACATTCTTTTATCTGGG + Intergenic
1089229342 11:116957754-116957776 AGGTGTAAATTACTTAATCTTGG - Intronic
1093666402 12:21818302-21818324 CTCTGTAAATTGATTGAACTTGG - Intronic
1094279000 12:28713987-28714009 GTGTGTAAATTCATTAAAACAGG - Intergenic
1097911590 12:64975727-64975749 CTGAGTAAGTTACTTAATCTTGG + Intergenic
1097944840 12:65355753-65355775 CTGTGTAAATTCAGACTTCTGGG - Intronic
1098013108 12:66075417-66075439 TTAGGTAAATTAATTAATCTGGG - Intergenic
1101223270 12:102662478-102662500 CTGGGTATATTTATCAATCTTGG - Intergenic
1104653320 12:130554062-130554084 ATCTGTAAACTCATTGATCTCGG + Intronic
1105473781 13:20714269-20714291 CTGGGGAAATTCGTTCATCTGGG - Intronic
1106615247 13:31320481-31320503 CTCTAGAAATTCATTCATCTAGG + Intronic
1106857848 13:33872313-33872335 CAGTGTAAACTCATCACTCTTGG + Intronic
1106951470 13:34889219-34889241 TTGTGTAAGTTCAGGAATCTAGG - Intergenic
1108074446 13:46665364-46665386 GTTTGTAAATTCCTTAATTTAGG + Intronic
1108140026 13:47410811-47410833 GTGTTTAAATTCATGCATCTAGG - Intergenic
1108862709 13:54882026-54882048 ATGTTTAAAGTCATTACTCTGGG - Intergenic
1109313957 13:60727698-60727720 CTGTGTGACTTCATTCTTCTTGG - Intergenic
1111711235 13:91816867-91816889 CTTGGTAAATTGATTAACCTGGG + Intronic
1112110161 13:96287874-96287896 CTGTGAGAATTAAATAATCTAGG - Intronic
1112900109 13:104347424-104347446 CTATGTAAATTCATCATTCTTGG - Intergenic
1115024555 14:28727680-28727702 CTGACTAGATTCAGTAATCTTGG - Intergenic
1115518250 14:34206755-34206777 ATGTTTATATTCATTAATCCTGG - Intronic
1116981201 14:51172594-51172616 CTCTGTGAATTCACTACTCTAGG + Intergenic
1117052258 14:51873084-51873106 AAGTTTAAATTGATTAATCTTGG + Intronic
1118895666 14:69943366-69943388 CTGTGTAAATTCAGTGGTCATGG + Intronic
1122016144 14:98798334-98798356 CGCTGTAAATTTATTAGTCTGGG + Intergenic
1126766219 15:52014046-52014068 CTTTGTACATTCTTTCATCTGGG + Intronic
1127225312 15:56920770-56920792 CTGTTTAAACTTAATAATCTTGG + Intronic
1128585440 15:68845409-68845431 CTGTATGAATTTATTATTCTAGG + Intronic
1129948770 15:79566270-79566292 CTGGGTAAATTCACCAATATAGG + Intergenic
1133883626 16:9806025-9806047 TTGTGAAAATTCATCAATGTTGG - Intronic
1135338614 16:21627227-21627249 CTGTGTAGATTCATGAATGCTGG + Intronic
1143755918 17:9067512-9067534 CTGTGTAAATTAATGTATCCCGG - Intronic
1144033122 17:11340233-11340255 TTGTCTTAATTCATTAATTTGGG - Intronic
1150363379 17:64558794-64558816 CTTTGGAAATTCACTAGTCTAGG + Intronic
1150905341 17:69330156-69330178 CTTTATAAATTCCCTAATCTTGG + Intergenic
1151303686 17:73248735-73248757 CTGTGTAAGTGGATTAACCTCGG + Exonic
1151520840 17:74628376-74628398 CTTTATAAATTGATTAATTTAGG - Intergenic
1155175232 18:23296015-23296037 TTGTGTAAATTCATTTATTTTGG + Exonic
1155195183 18:23467577-23467599 CTGTGTAAATTCATTAATCTTGG - Intronic
1155651361 18:28146757-28146779 CTGTGTAAATTAATTAGTTGAGG + Intronic
1156385347 18:36599698-36599720 CTGTGTGTATTTATTTATCTGGG + Intronic
1157909670 18:51604033-51604055 TTTTGTAAATTCATAAATTTAGG + Intergenic
1158201214 18:54942934-54942956 CTGTATATATTCATAAATCCAGG + Intronic
1158226847 18:55210231-55210253 TAGTGTAAATACTTTAATCTGGG - Intergenic
1158322020 18:56273858-56273880 CTTTGTAAATTCCCCAATCTCGG + Intergenic
1159262212 18:66029018-66029040 CTGAATAAATTCATTAATAAAGG + Intergenic
1163259975 19:16183165-16183187 TTGTGTTCATTCATTTATCTAGG + Intergenic
1167097422 19:47381817-47381839 CTGTGTATTTTTATTAATCTGGG + Intronic
925523871 2:4778304-4778326 CTTTATAAATTAACTAATCTCGG - Intergenic
925711368 2:6744151-6744173 ATGTGTAATTTCATTAATCAGGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929207958 2:39319742-39319764 CTTTGTAATTTCATTTGTCTAGG - Intronic
929278277 2:40049188-40049210 CAGAGGAAATTCATTAATGTCGG - Intergenic
929292811 2:40212868-40212890 ATGTGTAGATTCATAAATTTAGG + Intronic
931976246 2:67646957-67646979 CTGTGTAACCTCATTTTTCTTGG - Intergenic
932146380 2:69322014-69322036 ATGTTTAAATTCATCAAGCTAGG + Exonic
932863685 2:75319954-75319976 ATTTTTAAATGCATTAATCTAGG - Intergenic
933828808 2:86189481-86189503 CTGTGTAACAGCATTAATCATGG - Intronic
938111131 2:128565810-128565832 ATCTGTAAATTCATTTAACTGGG - Intergenic
939180977 2:138802567-138802589 CTGTGTAACCTCATCAAACTGGG + Intergenic
939907436 2:147934342-147934364 CTCTGTTAATTCATGGATCTTGG + Exonic
940799918 2:158122219-158122241 CTGTGTAGATTCTTTCTTCTGGG - Intronic
943990889 2:194690746-194690768 ATCTGTAAATACATTAATTTTGG + Intergenic
945562460 2:211355745-211355767 CTGTGCAAATTCCTGAATCACGG - Intergenic
946441657 2:219702023-219702045 CTGTTTAAAGACATTCATCTAGG - Intergenic
948532421 2:238618325-238618347 CTGTATAAATTAACTAGTCTGGG - Intergenic
1170399501 20:15965255-15965277 CTTTGTAATTTCAATATTCTTGG - Intronic
1170992167 20:21312902-21312924 CTGTGTTATTTAATTTATCTAGG - Intronic
1171423042 20:25031876-25031898 CTGTGTTGATTCAGAAATCTGGG - Intronic
1173885677 20:46457004-46457026 CTGTGTACATTCTTTGATGTTGG + Intergenic
1179153665 21:38831153-38831175 TTGTGTAAAGTCAGTAACCTGGG + Intergenic
1179233099 21:39523153-39523175 CTGTTTAGATTCTTTCATCTGGG + Intergenic
1179400079 21:41075724-41075746 CTGTGTAACCTCATTCTTCTTGG + Intergenic
1183617026 22:38952018-38952040 CTGTGTAAATTCTTTATTTCTGG + Intergenic
949248998 3:1960131-1960153 CTGTGTAGTTGCATTTATCTTGG - Intergenic
953490879 3:43349361-43349383 CTGTGTAAATTCCTTCCTGTAGG + Exonic
955569499 3:60289325-60289347 TTCTGTAAATCCATTTATCTAGG - Intronic
957141458 3:76363853-76363875 CTCTTTAAATTTCTTAATCTGGG + Intronic
957997337 3:87707278-87707300 CTGCGTGAATTCATTACTGTGGG - Intergenic
958516401 3:95121653-95121675 CTGTGCAAATTCAATTCTCTAGG + Intergenic
958624989 3:96612477-96612499 CTGTGCAAATTCAGTAAGCAAGG + Intergenic
960065113 3:113363383-113363405 ATTTGAAAATTCATTAAGCTTGG + Intronic
961983841 3:131111012-131111034 CTGTGTACATACATTTATATTGG + Intronic
962467140 3:135670887-135670909 CTTTGTAGCTTCATAAATCTGGG - Intergenic
964019260 3:151987936-151987958 CTGTGCATATTTATGAATCTTGG - Intergenic
965653869 3:170963295-170963317 TTGTGTACATTCATTAATGAAGG + Intergenic
965938862 3:174150585-174150607 CTGTGTAACTTTCTTAATTTGGG - Intronic
966000931 3:174947601-174947623 CTTTATAAATTTATTATTCTTGG + Intronic
966035540 3:175409661-175409683 ACTTGTAAATTCATTAATTTAGG + Intronic
970835845 4:20406088-20406110 CTGTGTAAATCTATTGACCTGGG - Intronic
972181145 4:36467325-36467347 CTGTGTAATTTATTTAATCTAGG - Intergenic
972264410 4:37445164-37445186 CAGTGTAAATCCATTGATGTAGG - Exonic
974636805 4:64574371-64574393 ATGTGTGATTTTATTAATCTTGG + Intergenic
975637125 4:76461866-76461888 CTGTGCAGATTTATTCATCTTGG - Intronic
976705230 4:88013162-88013184 CTTTGTATTTTCATTACTCTGGG + Intronic
976877596 4:89873672-89873694 CTGTGTAAATAAAATAATCAGGG + Intergenic
976984096 4:91271165-91271187 GTGGGTAAATTGAATAATCTAGG + Intronic
979532040 4:121779181-121779203 CTGCCTAAATTAATAAATCTTGG + Intergenic
981036136 4:140170675-140170697 CTTTGTAAATTTATTCATTTAGG + Intergenic
981241828 4:142486203-142486225 CTTTGGAAATTCCTAAATCTTGG - Intronic
983035477 4:162860274-162860296 TTGTATAAATTCATTAATTCTGG + Intergenic
983404310 4:167307380-167307402 CTGTTAAAATTCAATAAACTGGG - Intergenic
984197356 4:176675217-176675239 CTATGTAATTTCTATAATCTTGG - Intergenic
984843562 4:184091038-184091060 CATTGTAAATACATTATTCTTGG - Exonic
985235689 4:187871427-187871449 TTGTGTAAACTCATTACTATAGG - Intergenic
985887378 5:2690018-2690040 GTGTGTAAATGCATGAATCAAGG + Intergenic
986408033 5:7446945-7446967 CTGTGGATACTCATTAATTTTGG - Intronic
987494921 5:18630898-18630920 CTGTGTTAATGCAATGATCTAGG + Intergenic
987926536 5:24349749-24349771 CTGTGCAAGTTAATTAATTTTGG + Intergenic
988878985 5:35479577-35479599 CTGTGTACATTCATTGTTCAGGG - Intergenic
988933279 5:36058311-36058333 CTCTGTTAATTCACTATTCTGGG - Intronic
989530849 5:42506390-42506412 TTTTGTTAGTTCATTAATCTTGG - Intronic
990434649 5:55776241-55776263 CTGTGGAAATTCTCTAAACTTGG + Intronic
991249738 5:64546309-64546331 CTCTGTCTGTTCATTAATCTTGG - Intronic
991558585 5:67924064-67924086 CTGGGCAAATTCCTTAATCTTGG + Intergenic
992248408 5:74852762-74852784 AAGTCTAAATTCTTTAATCTGGG - Intronic
993463071 5:88209482-88209504 TTTTGTAATTTCATTATTCTAGG - Intronic
994012904 5:94928182-94928204 ATTGGTAAATTCATTATTCTAGG + Intronic
994606844 5:101978597-101978619 ATGTGTAAAATGAATAATCTTGG - Intergenic
995241785 5:109893352-109893374 CTGTATAAATTACTTAGTCTTGG - Intergenic
996340449 5:122432716-122432738 CTGTGTACACTAATTAATGTTGG - Intronic
998614971 5:143730045-143730067 CTTTGTAAATTCTTTGATGTGGG + Intergenic
1003965561 6:11249279-11249301 CTTTTTAAACTCATTCATCTAGG - Intronic
1005420645 6:25645341-25645363 CTGTATACATTCATAAGTCTTGG - Intergenic
1005655642 6:27933728-27933750 CGGTGTAATATCATTAATGTTGG + Intergenic
1008837868 6:55859257-55859279 CTGTGTAAATGCATTAAAAAAGG + Intronic
1010383458 6:75250382-75250404 CTTTGTATATTCCTTAATGTTGG - Intergenic
1010468386 6:76196078-76196100 CTGTTTAAAATCATTAAGTTGGG + Intergenic
1010665453 6:78624507-78624529 CTTTGTAAGTTCAATAATGTGGG - Intergenic
1011144400 6:84196390-84196412 CTGTATAAATTACTTAGTCTTGG + Intronic
1012112839 6:95259297-95259319 CTGTGTAACCTCATTCGTCTTGG - Intergenic
1012708189 6:102561575-102561597 CATTCTAAATTCATTAAGCTCGG + Intergenic
1013452336 6:110296090-110296112 CTATGTAAGCTCATTAATCTAGG - Intronic
1014196401 6:118564860-118564882 ATGTGTAAATTTCTTAATCTGGG - Intronic
1018494241 6:164332261-164332283 CTTTGTAAATTCATATTTCTTGG - Intergenic
1018756812 6:166856990-166857012 CTGTGCATTTTCACTAATCTGGG - Intronic
1020416983 7:7957722-7957744 CTATGTTAGTTTATTAATCTGGG + Intronic
1020957207 7:14755066-14755088 CTTTGTAATTTTATTAATTTGGG + Intronic
1021085541 7:16418461-16418483 CTTTATAAATTACTTAATCTTGG - Intronic
1024879091 7:54065431-54065453 CTGTGTAATTTTTATAATCTTGG - Intergenic
1026372662 7:69717243-69717265 CTGTGTATATTTATTTATATGGG + Intronic
1027406532 7:77867896-77867918 CTTTGTAAATTCCTTAAACAGGG - Intronic
1027578515 7:79961842-79961864 CAGCTTAAATGCATTAATCTTGG + Intergenic
1028000699 7:85494544-85494566 CTGTGTATCTTCATTCTTCTTGG - Intergenic
1028861098 7:95651436-95651458 CTGTGTAATGTCATTACTCTGGG - Intergenic
1030434859 7:109503733-109503755 CTTTGTAAATTAACTTATCTAGG + Intergenic
1031485602 7:122319631-122319653 GTGTATAAAATCTTTAATCTTGG - Intronic
1031847417 7:126822814-126822836 ATATGTAGATGCATTAATCTAGG - Intronic
1033618275 7:143038270-143038292 ACTTGTAAAATCATTAATCTAGG - Intergenic
1034571327 7:151958775-151958797 CTGTGTAACCTCATTCTTCTTGG - Intronic
1035852042 8:2929992-2930014 CTGTGTTAAATAATTAGTCTAGG + Intergenic
1038111363 8:24503190-24503212 CTGAGAAAATTCAGTAAACTAGG + Intronic
1040381772 8:46879931-46879953 CTGGGCATATTTATTAATCTTGG + Intergenic
1040472716 8:47748621-47748643 ATGTGTAAAATGATTGATCTGGG - Intergenic
1043662267 8:82758470-82758492 CTGTGTAACCTCATTTTTCTTGG - Intergenic
1045551348 8:103175491-103175513 ATGTGTAAATCCATTAATTTGGG + Intronic
1046405849 8:113770761-113770783 CTGTGTAAATTACTCAGTCTTGG + Intergenic
1047028509 8:120850796-120850818 CTGTGTAAATGCCTTGATTTTGG - Intergenic
1047348524 8:124051457-124051479 CTGTGTAAGCTACTTAATCTGGG + Intronic
1048086304 8:131184639-131184661 CTCTGTAAATCCATTAAACTAGG + Intergenic
1048150364 8:131887803-131887825 CACTGTAAAGTCATTAATATGGG + Intergenic
1048930012 8:139307014-139307036 GTGAGGAAATTCATTAATCTGGG - Intergenic
1052021265 9:23528239-23528261 TTATGTAAATTCATTATTTTTGG - Intergenic
1056025231 9:82487395-82487417 ATGTGTAAATTTATTTATCTAGG - Intergenic
1056524196 9:87427658-87427680 TTGTGTAAATTCACAAAGCTAGG + Intergenic
1058875724 9:109243468-109243490 CTTTGAAAATTTATTCATCTCGG + Intronic
1186203829 X:7180793-7180815 CAGTATAAAATTATTAATCTTGG - Intergenic
1186311411 X:8323451-8323473 CTGTGCAACTTCATTCTTCTTGG + Intergenic
1186978841 X:14937588-14937610 CTGTGTAAATGTTTTAATCTGGG + Intergenic
1187150614 X:16678382-16678404 CTGTGAAATTTCATGAAGCTTGG - Exonic
1188180604 X:27050732-27050754 CTGTGTGAGCTCATTCATCTTGG + Intergenic
1188992435 X:36838384-36838406 ATGTGTGATTTCATTGATCTAGG - Intergenic
1190201992 X:48369726-48369748 GTGTGTAAATAAATTAATCTAGG - Intergenic
1190208546 X:48425687-48425709 GTGTGTAAATAAATTAATCTAGG + Intergenic
1190668840 X:52720336-52720358 GTGTGTAAATAAATTAATCTAGG - Intergenic
1190670577 X:52738068-52738090 GTGTGTAAATAAATTAATCTAGG + Intergenic
1191754284 X:64577321-64577343 CGGTGTAACTTCATTCTTCTTGG + Intergenic
1192332377 X:70186670-70186692 CTGTTAAAATACATTAATTTAGG - Intronic
1193056950 X:77162397-77162419 CTTTATAAATTCATAAATCTGGG - Intergenic
1196501823 X:116392641-116392663 GTTTGTAAAATGATTAATCTTGG - Intergenic
1196752016 X:119126656-119126678 GTGTGTAAATCCATTGATGTGGG - Intronic
1198257907 X:134941136-134941158 CTGTGTAACTTCACCAATGTGGG - Intergenic
1198820927 X:140647834-140647856 CTGTGTGAATTCATTGATAATGG + Intergenic
1199389566 X:147263254-147263276 CTTTGTAAATTGCTTAGTCTTGG + Intergenic
1201576454 Y:15466320-15466342 CAGTATAAAGTTATTAATCTTGG - Intergenic
1202202093 Y:22363916-22363938 CTGTCAGAATTTATTAATCTTGG - Intronic