ID: 1155197222

View in Genome Browser
Species Human (GRCh38)
Location 18:23486443-23486465
Sequence CAAAATCAGGAGGAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 1, 2: 5, 3: 37, 4: 493}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155197222 Original CRISPR CAAAATCAGGAGGAGAAGGC TGG Intronic
900553684 1:3269342-3269364 CACAGTCAGGAGGAGCAGTCAGG + Intronic
900572501 1:3365454-3365476 CAATATAAGGAGGAAGAGGCGGG - Intronic
900732558 1:4271826-4271848 CAACATCAGGTGGGAAAGGCTGG + Intergenic
901296022 1:8161513-8161535 CAAAGGCAGGAGGGGTAGGCTGG - Intergenic
902043746 1:13510645-13510667 CAAATGCAGGAGGAGGAGGGAGG + Intronic
902446903 1:16472871-16472893 AAAACTCAAGAGGAGAAGGAAGG + Intergenic
903259546 1:22123989-22124011 CAGAACCAGGTAGAGAAGGCTGG - Intronic
903389792 1:22955580-22955602 CACAGGCAGGAAGAGAAGGCAGG - Intronic
904108601 1:28107057-28107079 CAAAAACAGCAGTAAAAGGCAGG + Intergenic
904534454 1:31190031-31190053 AAAAATCAGCAGGACAAGGAGGG - Intronic
904930820 1:34086273-34086295 CAAAATCTGATGGAGAAGACTGG + Intronic
906930890 1:50168215-50168237 CAAACTGGGGAAGAGAAGGCAGG + Intronic
907124322 1:52035763-52035785 CATAAGGAGGAGGAAAAGGCAGG - Intronic
907700271 1:56779645-56779667 CAAAATGATGGGGAGAAGGATGG - Intronic
907830463 1:58060037-58060059 CCAAGCCAGGAGGAGCAGGCTGG + Intronic
908689100 1:66757042-66757064 CAAAAGCAGTAGGAGAAGAAAGG - Intronic
909966570 1:81919402-81919424 AAAAATTAGGAGGAGAAGAAGGG - Intronic
910756965 1:90704495-90704517 AAAAATCAGGAGGACAAGGCAGG + Intergenic
911175163 1:94811178-94811200 GAAAATAAGGGGGAGAAGGAGGG - Intergenic
912374745 1:109201046-109201068 GAAACACAGAAGGAGAAGGCAGG - Intronic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
912776569 1:112509387-112509409 CAGCAGCAGGAGCAGAAGGCAGG - Exonic
914766390 1:150641235-150641257 CGAATTGAGGAGGGGAAGGCTGG - Intergenic
914939579 1:152011065-152011087 TAAAATCAAGAGTAGAAGCCAGG + Intergenic
915507444 1:156366795-156366817 GAAAACAAGGAGGAGTAGGCTGG - Intronic
915518306 1:156426650-156426672 CAAAATCAGGGGCCGAAAGCTGG + Intronic
916158566 1:161884775-161884797 CAAAATCAGAGTAAGAAGGCAGG + Intronic
916560836 1:165933150-165933172 AGAATTCAGGAGGAGAAGACAGG + Intergenic
916745819 1:167684103-167684125 CCAAATTAGGAAGAGAAGCCAGG + Intronic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
917169621 1:172156614-172156636 AAAAAACAGGAGGAGGAGGAGGG - Intronic
917612231 1:176700258-176700280 CAATATCTGGAGCAGGAGGCTGG + Intronic
917820795 1:178761805-178761827 TAAAAACAGGAGGTGAAGGCGGG - Intronic
920273110 1:204782003-204782025 CACACTCAGGAGCACAAGGCAGG - Intergenic
921458055 1:215395410-215395432 AAAAATGAGGAGGAGTTGGCTGG - Intergenic
922962428 1:229659892-229659914 CTAACACAGGAGGAGCAGGCAGG - Exonic
923013553 1:230108092-230108114 TAAACACAGAAGGAGAAGGCAGG + Intronic
1063225759 10:4013414-4013436 CAAAGTGGGGAGGAGAAGGAAGG - Intergenic
1063418581 10:5892262-5892284 GAAAAACAGGAGGAAAAGGAAGG - Intronic
1063495220 10:6501467-6501489 GAGGAGCAGGAGGAGAAGGCGGG + Intronic
1065210985 10:23402799-23402821 GAAAAGCTGGAGGAGCAGGCAGG + Intergenic
1065214927 10:23439674-23439696 TCGAAGCAGGAGGAGAAGGCGGG - Exonic
1065662636 10:28021588-28021610 CAAGATCACAAGGAGAAGTCGGG - Intergenic
1065725925 10:28668031-28668053 CAAAATCGGGTGGTGATGGCTGG - Intergenic
1065800661 10:29348897-29348919 CAAACCCAGGAAGAGAAGGGTGG + Intergenic
1066288867 10:33995753-33995775 CAAAAACAGAATGGGAAGGCAGG + Intergenic
1067203132 10:44192239-44192261 AAAAATGAAGAGGAGAAGGATGG + Intergenic
1068698983 10:60000155-60000177 CAAAATAAGGATGTGAAGGGAGG + Intergenic
1069126952 10:64647438-64647460 TAAAATGAGTAAGAGAAGGCAGG + Intergenic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1069969981 10:72159045-72159067 AGAAATCAGGAGAAGAAGGTTGG + Intronic
1070547146 10:77461577-77461599 CTAAATCAAGGGTAGAAGGCTGG - Intronic
1070872763 10:79772118-79772140 CAAACTCAGGATGAGAAGCTGGG + Intergenic
1071412259 10:85408268-85408290 CCAAAGCTGGAGGAGAAGGCTGG + Intergenic
1071639687 10:87294267-87294289 CAAACTCAGGATGAGAAGCTGGG + Intergenic
1071655547 10:87443685-87443707 CAAACTCAGGATGAGAAGCTGGG - Intergenic
1073020198 10:100437080-100437102 GAAAAATAGGAGGTGAAGGCCGG + Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1074106036 10:110390354-110390376 CCATCTTAGGAGGAGAAGGCTGG - Intergenic
1074169329 10:110918381-110918403 AAAAATCAGAATGGGAAGGCAGG + Intronic
1074917589 10:117972241-117972263 CAAGAACAGGAGGAGAAGACTGG - Intergenic
1075965547 10:126608740-126608762 CAAAAACAGTATGAGAAGCCTGG - Intronic
1076067266 10:127458698-127458720 CAGAAGCAGGAGGTGAAGGAGGG + Intergenic
1076188156 10:128464624-128464646 CCTAATGAGGAGGGGAAGGCAGG - Intergenic
1076240000 10:128897715-128897737 CAGAATCAGGTGGGGAAGGAAGG - Intergenic
1076539814 10:131206809-131206831 CAAGATCATGAGGAGAGGGTGGG + Intronic
1078855660 11:15204751-15204773 GTAAATCAGGCGGAGAAGGCTGG - Intronic
1079884584 11:25971254-25971276 CAAAATTATGGGGAGAAAGCAGG + Intergenic
1082193759 11:49277384-49277406 CAAAATTTGGAGGTGAAAGCAGG + Intergenic
1082816324 11:57512267-57512289 CAGCACCAGGTGGAGAAGGCAGG + Intronic
1082825266 11:57573049-57573071 AAAAATGAGGGTGAGAAGGCCGG + Intergenic
1083205172 11:61144452-61144474 CAGAAGCAGGAGGAGAACGCAGG + Intronic
1083759066 11:64806024-64806046 AAAAATTAGGAGGAGAGGGGAGG + Intronic
1084531023 11:69727799-69727821 CATCACCAGGAGGGGAAGGCTGG + Intergenic
1085023845 11:73225250-73225272 CAAAGTCAGGAGGAGGAGCTGGG - Intronic
1085024979 11:73231108-73231130 CAAAACCAGGGCGAGGAGGCCGG - Intronic
1085514082 11:77102385-77102407 CAGGAGCAGGTGGAGAAGGCAGG - Intronic
1086672381 11:89563673-89563695 CAAAATTTGGAGGTGAAAGCAGG - Intergenic
1087113650 11:94499314-94499336 CCAAATCAGTAGGATTAGGCAGG - Exonic
1087700289 11:101429603-101429625 AAAAACCAGGAGCAGAAGGTAGG - Intergenic
1088559578 11:111099093-111099115 CTAATTCAGGAAGAGGAGGCGGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1089173153 11:116529362-116529384 CAAAATCAAGAAGGGAAGACGGG + Intergenic
1089188284 11:116635872-116635894 AAAAGGCAGGTGGAGAAGGCAGG + Intergenic
1089879731 11:121762300-121762322 AAAAATCAGGAGGGGATGGGAGG + Intergenic
1090033582 11:123228922-123228944 CAGGGTCAGGATGAGAAGGCAGG - Intergenic
1090144216 11:124302238-124302260 TGAAATGAGGAAGAGAAGGCAGG + Intergenic
1091412013 12:248029-248051 AAAAAGCAGGAGGAGAGGGAAGG + Intronic
1092168851 12:6360728-6360750 AACGAGCAGGAGGAGAAGGCAGG + Intronic
1092679219 12:10958889-10958911 AAAAATCTGGAGGAGAAGAATGG + Intronic
1093678671 12:21974552-21974574 CAAGATCAGGAGGTGAAGTTTGG + Intergenic
1093911922 12:24758139-24758161 CAAAATAATGAGGAGATGGTTGG - Intergenic
1094559125 12:31533613-31533635 CCAAATCAGCAGGATTAGGCAGG + Intronic
1095388650 12:41679045-41679067 TAAAACCAGGAGGAACAGGCTGG + Intergenic
1096340337 12:50793061-50793083 CATAATCAGGAGAAGAAAGGAGG - Intronic
1096502595 12:52073993-52074015 CGCACTCAGGAAGAGAAGGCTGG - Intronic
1097064067 12:56307374-56307396 GAAACTCAGGAGGCCAAGGCAGG + Intronic
1098197210 12:68014708-68014730 CAAAATCTGATGGAGAAGGTTGG - Intergenic
1098465030 12:70776788-70776810 CAAAAGAAGGGGGAGAAGTCAGG - Intronic
1099436978 12:82657290-82657312 CAGAATAAGGAGGACAGGGCTGG - Intergenic
1100008667 12:89925713-89925735 AAAAATTATAAGGAGAAGGCTGG + Intergenic
1100037506 12:90270901-90270923 AAAAAGCAGCAGGAGAAGGAAGG - Intergenic
1100727204 12:97421193-97421215 CAAAAGGATGAGGAGAAGGAAGG + Intergenic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101723496 12:107371007-107371029 CAAAGGGAGGAGGAGAAGGGGGG - Intronic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102146569 12:110659008-110659030 CAATTTCAGGAGCAGAAGGAAGG - Intronic
1102162942 12:110784027-110784049 CAAAATAAAGATGAGAAGCCAGG - Intergenic
1102280480 12:111614945-111614967 CAAGAACAGCAAGAGAAGGCAGG + Intergenic
1102341406 12:112124838-112124860 CAAAATATGGAGGCCAAGGCGGG - Intergenic
1103804608 12:123562702-123562724 CAAAAGGAGGGGGAGCAGGCCGG + Intergenic
1104077779 12:125405662-125405684 CAAAATCACAAGGTGGAGGCAGG - Intronic
1104575585 12:129963308-129963330 CAGAAGCAGGAGGGGAAGCCAGG - Intergenic
1105383246 13:19906805-19906827 CAAAACTAGGAGGGGAAGGTGGG - Intergenic
1105497159 13:20940549-20940571 TAAAATTAGGAAGAAAAGGCTGG + Intergenic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1107713067 13:43169794-43169816 TGAACTCAGGAGGAGGAGGCTGG - Intergenic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108448075 13:50528982-50529004 CCAAATCATGTGGAGAAAGCTGG + Intronic
1109638738 13:65158675-65158697 TGAACTCAGGAGGCGAAGGCTGG - Intergenic
1109707849 13:66122004-66122026 CAAAAACAGGAGGGAAAGACTGG + Intergenic
1109720474 13:66269285-66269307 CAAGAGCAAGAGGATAAGGCAGG + Intergenic
1109729031 13:66385838-66385860 CAAAATCAGGTTGAGAACTCTGG + Intronic
1110073731 13:71212040-71212062 AGAAATTAGGAGGAGGAGGCAGG - Intergenic
1111757208 13:92413793-92413815 CAAAAGCAGGATGAGAAGAGGGG + Intronic
1111953845 13:94734264-94734286 TAAAATCAGGAATAGAAGGGAGG - Intergenic
1112311086 13:98318051-98318073 AAAAAGGAGGAGGAGAAGGAAGG - Intronic
1113258650 13:108535097-108535119 AAAAAGGAGGAGGAGAAGGAGGG - Intergenic
1113312914 13:109149714-109149736 GAAAAAGAGGAGGAGAAGGCAGG - Intronic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114871948 14:26669241-26669263 CAAAATAAGGGAGAGAAGGAGGG + Intergenic
1114885439 14:26843913-26843935 AAAAAGCAGGAGGAGAGGGGAGG - Intergenic
1115539574 14:34407352-34407374 AAAAATCAGGATGAAATGGCAGG + Intronic
1116167225 14:41349694-41349716 CAAAATCAGGGAGAGAGGCCGGG + Intergenic
1116403941 14:44545069-44545091 AAAAACCAGGAGGAAAAAGCTGG + Intergenic
1116862265 14:50003964-50003986 CCAAACCAGGTGGAGAACGCTGG + Intronic
1116942984 14:50809336-50809358 CAGATCCTGGAGGAGAAGGCAGG - Intronic
1117247148 14:53897442-53897464 CAAAATGAGGAGGAGAAGGGAGG + Intergenic
1117505989 14:56403559-56403581 CAAAAGCAGGAAGGGAAGGAAGG - Intergenic
1117599085 14:57355059-57355081 CCAAATCAGAAGTAGAAAGCTGG - Intergenic
1120044483 14:79790863-79790885 CAAGATCGGGAGGCCAAGGCGGG - Intronic
1120218164 14:81703150-81703172 TAAAGTCAGGAGGAGGAGGGGGG + Intergenic
1120259153 14:82160343-82160365 CACAATCATTAGGAGAAGGAAGG - Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1121735569 14:96215710-96215732 CAGAAACAGGAAGAAAAGGCAGG + Intronic
1121804787 14:96808262-96808284 CAAAAACAGGGGCAGAAAGCAGG - Intronic
1122016909 14:98804006-98804028 CAAAATCAGGTGGATATGGATGG + Intergenic
1122454870 14:101842346-101842368 CTGAAACAGGAGGAGAGGGCAGG + Intronic
1122847276 14:104506754-104506776 CCAAAGCAAGAGGAGAAGACAGG + Intronic
1126119706 15:45240702-45240724 AAAACTCAGGAGGAAAAAGCAGG - Intergenic
1126814521 15:52441688-52441710 CCAAATGAGGAGAAGAAGTCAGG - Intronic
1127366146 15:58292438-58292460 CAAAGTCAGGAAGTGTAGGCTGG + Intronic
1128338417 15:66803153-66803175 CAAACTCAGGATGGGGAGGCAGG - Intergenic
1129139753 15:73586762-73586784 CAAAATTATCATGAGAAGGCAGG - Intronic
1129172681 15:73817627-73817649 GCGAAGCAGGAGGAGAAGGCAGG + Intergenic
1129738779 15:77979904-77979926 CAGGGTCAGGAGGAGAAAGCTGG - Intergenic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1129976359 15:79825323-79825345 CAAATTCAGGACTAGAATGCAGG + Intergenic
1130750690 15:86709347-86709369 AAAAAGCAGGTGGGGAAGGCAGG + Intronic
1130860933 15:87889028-87889050 GAGAAACAGGGGGAGAAGGCTGG - Intronic
1131550412 15:93352232-93352254 CAAAGAAAAGAGGAGAAGGCTGG - Intergenic
1131667414 15:94585228-94585250 CAAAGGCAGGAGGAGAAAGGGGG - Intergenic
1131828529 15:96339612-96339634 CAAATTAAGGAAGAGAAAGCAGG + Exonic
1132002881 15:98197537-98197559 CCAGATTAGGATGAGAAGGCAGG - Intergenic
1132604995 16:789938-789960 CAAAAGCAGGAGGGGAAGCAAGG - Intronic
1132906749 16:2286425-2286447 TAGATTTAGGAGGAGAAGGCAGG + Intronic
1133197309 16:4180319-4180341 CAAAACCAGAGGGAGAAGGTGGG + Intergenic
1133724440 16:8524278-8524300 CAACGTCAGGAGGAGAAACCTGG - Intergenic
1133855292 16:9544015-9544037 CACAATCTAGAGGGGAAGGCGGG - Intergenic
1134129796 16:11641421-11641443 CACGATCAGCAGGAGAAAGCAGG + Intergenic
1134265068 16:12685671-12685693 CAAAATCAGGAGGAAAAGGGAGG - Intronic
1134327945 16:13224250-13224272 TAAAGTCAGGTGAAGAAGGCAGG - Intronic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135076649 16:19399780-19399802 AAAACTCAGGAGGAAAAAGCAGG - Intergenic
1135228595 16:20683480-20683502 CAAAGTCAGGACGAGAAGTGTGG - Intronic
1135924046 16:26676637-26676659 CAAAATCAGGATTTGAAGGCAGG + Intergenic
1136901076 16:34038655-34038677 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1136968338 16:34942061-34942083 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1137519349 16:49178881-49178903 CACAATCAGAAGGAGTAAGCAGG + Intergenic
1137555946 16:49470455-49470477 CAAACTCAGGCAGACAAGGCTGG - Intergenic
1138218269 16:55224810-55224832 TCAAATCAGGAGAAGATGGCTGG + Intergenic
1139007795 16:62594368-62594390 GAAATTCAGGAGGAGAAAACAGG + Intergenic
1139144780 16:64310096-64310118 AAAAGTGAGGAGGGGAAGGCAGG + Intergenic
1140685077 16:77425744-77425766 CAAAAAGAGGAGGAGTGGGCCGG + Intronic
1141044776 16:80706315-80706337 CAAAAACAGGAGGGCAATGCTGG + Intronic
1141105857 16:81233067-81233089 GAAAAGCAGGAAGATAAGGCAGG - Intergenic
1141695122 16:85615454-85615476 CAAAGTCAGGAGGGGAAGCTGGG + Intronic
1142690673 17:1604729-1604751 CAACAGCAGGAGGTGAGGGCAGG - Intronic
1142899229 17:3002175-3002197 CAAAGTCAGGAGTTCAAGGCCGG - Intronic
1143152178 17:4814555-4814577 CAGCATTAGGAGGAGAAGGGGGG + Intronic
1143194405 17:5064546-5064568 TAAAATTTGGAGGAGGAGGCTGG - Intergenic
1143749805 17:9020514-9020536 CAAAAACAGGAAGAGAAGCCTGG - Intergenic
1143947223 17:10604065-10604087 CAATGTCAGGAGGACATGGCTGG + Intergenic
1144265079 17:13561324-13561346 GAAAATCAGGAGCAGAGGGAAGG - Intronic
1144282804 17:13743589-13743611 CAAAATCAGGAAGCCGAGGCGGG + Intergenic
1144676204 17:17163621-17163643 CTAAGACAGGAGGAGAAGGAAGG - Intronic
1144841057 17:18186038-18186060 CAAAGTCATGAGGAGAAGCAGGG + Intronic
1146120317 17:30188184-30188206 AAAAATCAGAAAGAGTAGGCTGG - Intergenic
1147539573 17:41346090-41346112 CACAACCAGGAGGAGAAGAAAGG - Exonic
1147588974 17:41669079-41669101 CAAAATAGGGAGGTCAAGGCTGG + Intergenic
1147636089 17:41965236-41965258 CAAGATCAGGAGAAACAGGCAGG + Exonic
1147962976 17:44178929-44178951 TAAACACAGGAGGAGAAGGGAGG - Exonic
1148550370 17:48546651-48546673 CCCAGCCAGGAGGAGAAGGCTGG + Intergenic
1148624129 17:49055925-49055947 CAAAATCGGGTGGTGATGGCTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149535551 17:57430913-57430935 CAAATTCAGGAAGAAGAGGCGGG - Intronic
1149891431 17:60392824-60392846 CATGGTCAGGAGGAGAAGGTGGG - Intronic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1151074408 17:71254656-71254678 CAAAATGAGGAGGAACAGGATGG - Intergenic
1151894234 17:76969372-76969394 CCGACTTAGGAGGAGAAGGCAGG - Intergenic
1151920911 17:77154886-77154908 CCAGATCAGAAGGGGAAGGCCGG - Intronic
1152119975 17:78412624-78412646 CAGAATCTGGTGGGGAAGGCTGG - Intronic
1154102121 18:11485743-11485765 CAAATTCAGCAAGAGAAGGTGGG - Intergenic
1155037418 18:22036726-22036748 CAACAACAACAGGAGAAGGCTGG + Intergenic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155529617 18:26753672-26753694 CTAAATCAGGTGGAGTAGGCTGG + Intergenic
1155816619 18:30319093-30319115 CATAATCAGGAGGCTGAGGCAGG - Intergenic
1155824800 18:30427292-30427314 CAAAGGCAGGAGGAAAAGCCTGG - Intergenic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1158571990 18:58604019-58604041 CAGCATGAGGAGGAGAATGCAGG + Intronic
1158855526 18:61540095-61540117 CAAAAGCAGGAGCAGAATGGAGG - Intronic
1159319791 18:66831614-66831636 CAAAAACAGGACTAGAAGGATGG + Intergenic
1159781925 18:72669780-72669802 TAAATTGAGAAGGAGAAGGCAGG - Intergenic
1159877072 18:73824522-73824544 CAAAAGCAGGGAGAGAAGGAGGG + Intergenic
1160742647 19:694648-694670 GGAAAACAGGAGGATAAGGCAGG - Intronic
1161822566 19:6539301-6539323 CAAAGTCAGGCTGAAAAGGCTGG - Intergenic
1163197805 19:15736226-15736248 ACAAATCAAGAGGAGAAGGTAGG - Intergenic
1163251327 19:16127944-16127966 CTAAAACAGGAGCTGAAGGCAGG - Intronic
1163335614 19:16669696-16669718 AAAGCTCAGGAGGAGAAGACTGG + Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1163563523 19:18035523-18035545 CAAACTCAGGAGGCTGAGGCAGG + Intergenic
1164469164 19:28514122-28514144 CAAAAGCAGCAGGAAAAGGCTGG + Intergenic
1165119597 19:33550672-33550694 CAAAAAGAGGAGGTGCAGGCTGG + Intergenic
1165202418 19:34155899-34155921 AAAAAGCAGGACGAGGAGGCAGG + Intergenic
1165337672 19:35183286-35183308 CAAAATCAGGAAAACAGGGCTGG + Intergenic
1165489368 19:36114462-36114484 CAAGATTGGGAGGAGAGGGCAGG + Intronic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166712066 19:44944134-44944156 CAAAATCAGGTGGTGAAGGGAGG + Intronic
1167421076 19:49403702-49403724 CAAAAGCAGAAGGAGTAAGCAGG + Intronic
1167624780 19:50580326-50580348 CTAAATCAGCAGGACAAGGAAGG - Intergenic
1167641422 19:50684520-50684542 AAAAATCAAGAGTAGGAGGCTGG - Intronic
1167909237 19:52688563-52688585 CAAAATGAGGAGCAGAACCCCGG - Intronic
1167958795 19:53089840-53089862 CAAAATGAGGAGCAGAAACCTGG - Intronic
1168475941 19:56675296-56675318 CAAGACCAGGAGGCCAAGGCAGG - Intergenic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
925343659 2:3154345-3154367 CAAAAGCAGGAAGAGGAAGCCGG - Intergenic
925414086 2:3657312-3657334 GGAGTTCAGGAGGAGAAGGCCGG + Intergenic
926417124 2:12660711-12660733 GGAAATCAGAATGAGAAGGCAGG + Intergenic
926588597 2:14716194-14716216 GGACATGAGGAGGAGAAGGCAGG - Intergenic
928277937 2:29920000-29920022 GAAGATCTGGAAGAGAAGGCGGG + Exonic
928289873 2:30027732-30027754 CAAAATCATGAGAAGAATGGGGG + Intergenic
929407598 2:41660496-41660518 CAAAGTCAGGAGGAGACTTCTGG - Intergenic
929695823 2:44114387-44114409 CAAAAGAAGGGGGAGAAGACAGG - Intergenic
930382250 2:50646046-50646068 CTAAATCAGGTAGAAAAGGCAGG + Intronic
931420761 2:62124794-62124816 CAAAATTGGGAGGCCAAGGCAGG - Intronic
931665130 2:64605060-64605082 CAAAGTCTGGTGGAGAGGGCGGG - Intergenic
931695767 2:64869411-64869433 TGAAATCAGGGGGAGAAGGTGGG + Intergenic
932213997 2:69954589-69954611 CAGAGACAGGAGGAGAAGACGGG - Intergenic
932415927 2:71573981-71574003 GAAAATCAGGAGGGGAGGCCAGG - Intronic
933419144 2:82025046-82025068 AAAACTCAGGAGGAAAAAGCAGG + Intergenic
933688121 2:85159262-85159284 CACCATCAGGAGGAGAACACAGG - Intronic
933703911 2:85275670-85275692 CAGAATTGGGAGGTGAAGGCGGG + Intronic
934158768 2:89228288-89228310 CAAACTCAGGTGGAGGTGGCTGG - Intergenic
934208507 2:89954140-89954162 CAAACTCAGGTGGAGGTGGCTGG + Intergenic
935291002 2:101610968-101610990 CAAAATTTGCAGCAGAAGGCAGG - Intergenic
935406012 2:102709383-102709405 CAATACTAGGAGGAGGAGGCAGG + Exonic
935553119 2:104479367-104479389 CCAAAGCAGGAGGGGAAGGTAGG - Intergenic
935751117 2:106234817-106234839 TAAAAACAGCAAGAGAAGGCCGG + Intergenic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
937794314 2:125998923-125998945 AAAAATCAGGAGGCCGAGGCAGG - Intergenic
938519150 2:132048838-132048860 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
939303860 2:140384064-140384086 GAAAAGCAGGAGAAGAAGGAAGG - Intronic
940855559 2:158726215-158726237 CAGATTCAGGCGGAGAAGACTGG - Intergenic
941352430 2:164453284-164453306 GAAGATGAGGAGGGGAAGGCAGG - Intergenic
941409979 2:165142860-165142882 CCAACTCAGGAGGGTAAGGCAGG - Intronic
941687929 2:168466745-168466767 CAAAAGTAGGAATAGAAGGCAGG - Intronic
941927857 2:170914269-170914291 CCAAATCAGGATGAGAATACAGG + Intergenic
942015123 2:171805860-171805882 CAAAACTAGGAGGCCAAGGCAGG + Intronic
942625302 2:177894095-177894117 CACATTCAGGAGAAGAAGCCAGG - Intronic
943367897 2:186982819-186982841 CAAAACCATGAGGTTAAGGCCGG - Intergenic
943657058 2:190521016-190521038 CAAATGCAGGAGTAGAATGCTGG - Intronic
943661536 2:190564441-190564463 CAAAATCAAGAGTAAAAGACTGG - Intergenic
944099313 2:196005333-196005355 CAAAACAAGAAGGAGAAGGGAGG + Intronic
944861561 2:203819979-203820001 CACAATGGGGTGGAGAAGGCGGG + Intergenic
945680019 2:212902825-212902847 AAAAAGGAGGAGGAGAAGGAAGG - Intergenic
945783573 2:214206082-214206104 CATAATCAGGAGGCTGAGGCAGG + Intronic
946017878 2:216618915-216618937 CACAGTCAGGATGAAAAGGCAGG + Intergenic
946151887 2:217779698-217779720 AAAACTCAAGAGGAGAAGGAAGG - Intergenic
946345748 2:219109185-219109207 CAAAATGAGAAGGAAAAGACTGG - Intronic
947458847 2:230284371-230284393 CAGAATGAGAATGAGAAGGCAGG + Exonic
947690869 2:232134718-232134740 GAAACTCAGGAGGCTAAGGCAGG + Intronic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
948814807 2:240504708-240504730 CAAAACCACAATGAGAAGGCCGG + Intronic
1168900610 20:1361293-1361315 AAAAAACAGGAGGAAAAGGAGGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1170920463 20:20673939-20673961 CAACTTCAGGAGGCCAAGGCAGG + Intronic
1170930510 20:20766021-20766043 CAGAAACTAGAGGAGAAGGCGGG + Intergenic
1171472733 20:25385035-25385057 CTAAATCAGGAGGAAAAAGCAGG + Intronic
1173027277 20:39320184-39320206 CATCAGCCGGAGGAGAAGGCAGG - Intergenic
1176081160 20:63273692-63273714 CAGAACCATGAGGAGACGGCTGG - Intronic
1176273002 20:64246281-64246303 CATATTCAGGAGGAGAAGAGCGG + Intergenic
1176362063 21:6006180-6006202 CAAAAGGAGGAGGAGGAGGGGGG + Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1176742564 21:10617389-10617411 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1178409903 21:32354454-32354476 CAAAGTCAGGATTAGAACGCAGG - Intronic
1178415268 21:32399771-32399793 CAAAATCAGTGGGAGAAGGGTGG + Intergenic
1178583483 21:33854903-33854925 CAAGACCAGCAGGAGAATGCTGG - Intronic
1178863196 21:36306364-36306386 CAAACTCAGGAGGCTGAGGCTGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179423369 21:41253606-41253628 AAGAAGCAGGAGGAGAAGGCAGG + Intronic
1179761455 21:43532365-43532387 CAAAAGGAGGAGGAGGAGGGGGG - Intronic
1180702300 22:17788219-17788241 CACAGTCGGGAGCAGAAGGCTGG + Exonic
1180742651 22:18064549-18064571 CTAACTCAGGAAGAGAAGGGGGG + Intergenic
1181366011 22:22377574-22377596 CCAGATCAGGAGAAGCAGGCTGG - Intergenic
1182059948 22:27389739-27389761 TAAAATCACAAGGAGAAGCCGGG + Intergenic
1182696615 22:32203019-32203041 CAAGAACAGGAGGAGGTGGCCGG + Exonic
1183031697 22:35111241-35111263 CAGAGACAGGAAGAGAAGGCTGG + Intergenic
1184222267 22:43108824-43108846 CAAAAGGAGGAAGAGATGGCTGG - Intergenic
1184793681 22:46718392-46718414 CAAACAGAGGAGGGGAAGGCGGG + Intronic
1184902787 22:47457914-47457936 GAAAAGCAGGAGGAGGAGGAAGG + Intergenic
1185365888 22:50436563-50436585 CATAGTCAAGAGGAGCAGGCAGG - Intronic
1203237720 22_KI270732v1_random:21962-21984 GAAAATAAAGAGGAGAAGGAGGG + Intergenic
949639269 3:6016706-6016728 TAAAATATGGAGGACAAGGCTGG - Intergenic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
950723778 3:14902655-14902677 CAAAATGAGGAGGGGCAGGGAGG - Intronic
951003646 3:17593119-17593141 CAAACTGAGGGAGAGAAGGCAGG - Intronic
952961475 3:38593358-38593380 ATAAATCAGTAGGAGAAGGCTGG - Intronic
953329601 3:42041904-42041926 CAGACTCAGGAGGCTAAGGCAGG - Intronic
953552120 3:43911206-43911228 CAAATTCAGGAGGCGAAGCGAGG + Intergenic
954070753 3:48141332-48141354 CAAAATCATGTGGAAAAGGAAGG + Intergenic
954207134 3:49068107-49068129 CTAAATCAGGAGGCTATGGCAGG + Intronic
954534984 3:51353240-51353262 TAAGGTCAGGAGGAGCAGGCTGG - Intronic
955940895 3:64146445-64146467 TAAAATCCGGAGGACCAGGCTGG + Intronic
955994579 3:64666898-64666920 GAAATTTAGGAGGTGAAGGCAGG + Intronic
956453068 3:69392953-69392975 CTCAAGCAGGAGGAGATGGCAGG + Intronic
957158690 3:76580087-76580109 CTAAATCAGGAGCAGAGGGCAGG - Intronic
957376569 3:79366434-79366456 CAAAGTCAGAAAGAGGAGGCTGG - Intronic
958102230 3:89027475-89027497 CGAAATCAGGAGTAGATGGTGGG + Intergenic
958603047 3:96323632-96323654 GAAGAGGAGGAGGAGAAGGCGGG + Intergenic
959526298 3:107381245-107381267 GAAAAACAGGAGCAGAGGGCGGG + Intergenic
961860305 3:129911939-129911961 CATAATTAGGATGGGAAGGCAGG - Intergenic
962049750 3:131800601-131800623 CAACATCAGGAGCAGTAGGAGGG - Intronic
962769688 3:138600898-138600920 AAAAAGAAGGAGGAGAAGGAGGG + Intergenic
962979580 3:140475591-140475613 CCAAGTCAGGATGAGAAAGCAGG - Intronic
963090764 3:141481616-141481638 CAAAGTCAGGAGGTGAAGATTGG + Intergenic
963214222 3:142725819-142725841 CAAAAGCAGGAGGAGAGGTTAGG - Intronic
963949782 3:151186447-151186469 CAAGATGAGGTGGAAAAGGCAGG - Intronic
964441663 3:156717601-156717623 CAAAGTCAGAAGCAGACGGCTGG + Intergenic
964545638 3:157830441-157830463 TTAAAGCAGGGGGAGAAGGCCGG - Intergenic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966323590 3:178729433-178729455 AAAAATTAGAAGGAGAAGACAGG - Intronic
966603217 3:181795865-181795887 CAAAATAAGGAAGAGAGGCCAGG - Intergenic
966883961 3:184364521-184364543 CAAAATAAAGAGGTGTAGGCCGG - Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
969666819 4:8562603-8562625 CTAAATCAGGAGAAGATGGAAGG + Intronic
969838267 4:9861008-9861030 CAAAATGAGGAGGAGAATGATGG - Intronic
969933494 4:10657779-10657801 CAAAATCAGAAGGAGAATAAAGG - Intronic
970372244 4:15419632-15419654 AAATATCAGGAGGAAAAGGTAGG - Intronic
970876797 4:20880341-20880363 AAAAAGGAAGAGGAGAAGGCAGG + Intronic
971327362 4:25655473-25655495 CAAGTTCTTGAGGAGAAGGCAGG + Intronic
972144936 4:36011659-36011681 CAATATAAGGAGGAGAATGAGGG - Intronic
973084745 4:46044174-46044196 AAAAATCAACAGGAGAAGGCTGG + Intronic
973933673 4:55819425-55819447 AAAGATCAGGAGGCGAAGGAAGG + Intergenic
974032009 4:56784557-56784579 TAAAAAGAGGAGGAGAGGGCCGG + Intergenic
975648591 4:76569459-76569481 CAGAATGAGGAAGAGAAGTCAGG + Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
976851901 4:89557335-89557357 AAAGATAAGGAGGAGCAGGCAGG + Intergenic
978388011 4:108195515-108195537 CATACTCAGGAGGCTAAGGCAGG - Intergenic
980494311 4:133571368-133571390 CAAAATTGGGAGGCCAAGGCAGG - Intergenic
980757844 4:137189834-137189856 TAAAATCATGAGGAGAGGGGAGG + Intergenic
981671016 4:147286964-147286986 ATAATTCAGGAGGAGAAGACAGG + Intergenic
981695892 4:147558411-147558433 GAAAAGCAGGAGGAGGAGGAGGG + Intergenic
982379941 4:154739715-154739737 CAGAGTCAGGAGCAGAATGCAGG - Intronic
983002737 4:162438594-162438616 CAATCTCAGGAGGAGAAGGAGGG - Intergenic
983661104 4:170131508-170131530 AAAACTCAGGAGGAAAAAGCAGG - Intergenic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
986050394 5:4084548-4084570 CAAAATCAGGAGGGAGAAGCTGG - Intergenic
986200534 5:5574413-5574435 CAAAATCAGTAAGAGAAGCCAGG + Intergenic
986208923 5:5652031-5652053 CAAAATCAGGCCAGGAAGGCAGG - Intergenic
986257093 5:6109541-6109563 CAGAGTCAGGTGGATAAGGCGGG - Intergenic
986415330 5:7522446-7522468 CAGAAACAGGAAGTGAAGGCTGG - Intronic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
988485485 5:31665192-31665214 CAAGCTCAGGAGGAGAAGAGGGG - Intronic
988820063 5:34874369-34874391 TCAAATTAGGAGCAGAAGGCAGG + Intronic
989426295 5:41299857-41299879 CAAAAGCTGGAGGAGAAGCATGG + Intergenic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
991944459 5:71885996-71886018 ACTAATCAGGAGGAGAGGGCAGG - Intergenic
992199326 5:74368328-74368350 GAAAAGGAGGAGGAGGAGGCAGG + Intergenic
993505374 5:88702535-88702557 CAAAAGGAGGAGGAGCAGGTTGG - Intergenic
994756037 5:103794405-103794427 GCAACTCAGGAGGATAAGGCAGG - Intergenic
996544101 5:124659452-124659474 CAAAGGAAGGAGGAGCAGGCAGG + Intronic
997348529 5:133211733-133211755 CAGAATGAAGAGGAGAAGCCAGG - Intronic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
999449370 5:151666728-151666750 CAAAATCACCTGGCGAAGGCCGG + Intronic
999535191 5:152508695-152508717 CAAAAACGGGAGGCTAAGGCAGG - Intergenic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1001795043 5:174495059-174495081 CAAGATCAGGAGGGGAGGGAGGG - Intergenic
1002269718 5:178062602-178062624 AAAAATTAGGAGGTCAAGGCAGG + Intergenic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1003283843 6:4717081-4717103 CACAATCAGGAAGAAAAGGGTGG + Intronic
1003409658 6:5851274-5851296 CAAAATCCAGAGGAGAGGGAAGG - Intergenic
1004329091 6:14705163-14705185 CAAATTCAAGTGCAGAAGGCTGG + Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1006256215 6:32834748-32834770 TAAAATCAGCAGAAGAAGTCTGG - Intronic
1006259975 6:32859540-32859562 CAAAATAAGAAAGAGAAGTCTGG - Exonic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1007216736 6:40246035-40246057 CTAAATCAGAAGGAGACTGCTGG + Intergenic
1007220351 6:40274110-40274132 GAAAATGAGGAAGAGAGGGCTGG + Intergenic
1007400030 6:41598161-41598183 GAAAATGGGGAGGAGAAGGTGGG - Intronic
1007434184 6:41796786-41796808 CAAAATCAGGAGATGAAGAAAGG + Intronic
1008124322 6:47651591-47651613 GGAAAGAAGGAGGAGAAGGCTGG + Intergenic
1008124565 6:47653983-47654005 CAAGATGAGCAGGACAAGGCAGG + Intergenic
1008467034 6:51842604-51842626 CCAAAACAGGAGGAGAAGATTGG - Intronic
1008860963 6:56149832-56149854 CAAACACAGAAGGAGAAGTCAGG - Intronic
1010850399 6:80768566-80768588 CTAAATTAGGATGAGAAGGTTGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012674269 6:102095214-102095236 AAAAATCAAGAAAAGAAGGCTGG - Intergenic
1014166455 6:118230685-118230707 CAAAATCAAGATGATAAGGCTGG + Intronic
1014448633 6:121558208-121558230 CAAAAATGGGAGGATAAGGCGGG - Intergenic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015850691 6:137568795-137568817 GAAAAGGAGGAGGAGAAGGAGGG + Intergenic
1016831726 6:148440810-148440832 CAAAATGAGGTGCAGAAGACGGG - Intronic
1017108982 6:150914409-150914431 AAAAATCAGAAGGCCAAGGCAGG + Intronic
1017228467 6:152046815-152046837 CAAATTCAGCATGAAAAGGCTGG + Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1018023740 6:159788643-159788665 CAGAATCTGAAGGAAAAGGCTGG - Intronic
1018901463 6:168053872-168053894 CCCAAGCAGGAGGAGGAGGCCGG - Intergenic
1018982216 6:168610198-168610220 CTAAAACAGGAGGAGAAGGATGG + Intronic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019080047 6:169424330-169424352 TCAAAGCAGGAGGAGGAGGCGGG + Intergenic
1019101550 6:169634947-169634969 CAAGATCAGAAAGAGGAGGCAGG + Intronic
1020755911 7:12202833-12202855 CAAAATCTGAAGGGGGAGGCTGG - Intergenic
1020959393 7:14783517-14783539 CAAAATCAGGCAGCGAAAGCAGG - Intronic
1021336415 7:19408139-19408161 GGAAATCAGGAGCAGAAAGCAGG - Intergenic
1022044312 7:26611078-26611100 CACAATGAGGAGGAGAAGAGGGG - Intergenic
1022296050 7:29054508-29054530 AAAAGTCAGAAGGAAAAGGCAGG - Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023683512 7:42712860-42712882 CAAAATCATGAGGAGAGGGAAGG + Intergenic
1023906338 7:44524506-44524528 CAACATCAGAAGGCCAAGGCAGG + Intronic
1024237268 7:47408097-47408119 GAAGACCAGGAGGAGATGGCAGG + Intronic
1024310556 7:47965518-47965540 CTAAAACAGGAGGTGCAGGCTGG - Intronic
1024539288 7:50463062-50463084 TAAAATAAGGAAGAGAAGGCCGG - Intronic
1024709527 7:51999694-51999716 CAAACTCAGGAGGCTGAGGCAGG - Intergenic
1024805257 7:53132004-53132026 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1025879348 7:65520015-65520037 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1025885147 7:65582916-65582938 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1027882178 7:83854618-83854640 CAAAATCAGGAGGGGCTGGAAGG + Intergenic
1028331028 7:89592289-89592311 GAAAAGCAAGAGGAGAAAGCTGG + Intergenic
1028491947 7:91422553-91422575 TAAAATCAGGAGGCTGAGGCAGG - Intergenic
1029174377 7:98653766-98653788 GAAAAGGAGGAGGAGAAAGCAGG + Intergenic
1029539650 7:101175064-101175086 GCAACTCAGGAGGTGAAGGCAGG - Intronic
1030004387 7:105102029-105102051 CTATATCAGGAGAAGATGGCTGG - Exonic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030994680 7:116345040-116345062 CAAAATCAGAAGTAGAAGTGGGG - Intronic
1033442851 7:141395913-141395935 CATATTCAGGAGGAGAGGGAGGG + Intronic
1034055900 7:148034717-148034739 GAAAATTTGGAGGAGTAGGCTGG + Intronic
1035987168 8:4446962-4446984 CAAAAACAGCAGGAGATGACTGG + Intronic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1037168074 8:15855455-15855477 CCAAGGCAGGAGGAGCAGGCAGG - Intergenic
1037406168 8:18544967-18544989 CAAGACCAGGAGTAGAAAGCAGG + Intronic
1038137295 8:24801570-24801592 CAAAAGAAGGAGGGGAAGGAAGG + Intergenic
1038184696 8:25262928-25262950 AAAACTCAGGAGGTGGAGGCAGG - Intronic
1039784735 8:40824026-40824048 CAAAATCCTGAGGAGTATGCAGG + Intronic
1039863058 8:41476238-41476260 CAAAATCAGTACTTGAAGGCTGG - Intergenic
1040122680 8:43700213-43700235 AAAACTCAGGAGGAAAAAGCAGG - Intergenic
1040389598 8:46938353-46938375 AAAACTCAGTAGGAGAAGTCAGG - Intergenic
1041328554 8:56697299-56697321 GAAAAGGAGGAGGAGAAGGAGGG - Intergenic
1041709560 8:60881498-60881520 CAGAAGTCGGAGGAGAAGGCAGG - Intergenic
1043704562 8:83331917-83331939 CAGGACCAGAAGGAGAAGGCAGG - Intergenic
1045201707 8:99990158-99990180 CTTATTCAGGAGGCGAAGGCAGG + Intronic
1045587833 8:103559254-103559276 GAAAATCAGGATCAGAAGGCTGG - Intronic
1046502537 8:115096988-115097010 AAAGTTCAAGAGGAGAAGGCAGG - Intergenic
1046546072 8:115651651-115651673 CATAAACAGGAGCACAAGGCGGG + Intronic
1046874837 8:119242601-119242623 AAAAATCAGCAGAAGAAGGGTGG + Intronic
1048007633 8:130432012-130432034 GAAAATGGGGAGGAGAAGGAGGG + Intronic
1048320987 8:133400042-133400064 CAGAAACATGGGGAGAAGGCAGG - Intergenic
1049758549 8:144321526-144321548 TACAACCAGGAGGAGAAGCCAGG + Intronic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050192611 9:3044077-3044099 CAAAGGATGGAGGAGAAGGCAGG - Intergenic
1050639625 9:7653433-7653455 CAATATCCGGAGGGAAAGGCCGG - Intergenic
1050758773 9:9040233-9040255 CAAAATCAGGATTTGAAAGCAGG + Intronic
1050996547 9:12227001-12227023 GAAAATCAGGGGGAGAATGCAGG + Intergenic
1052845430 9:33331794-33331816 CAAAATCAGATGTAGAAGCCGGG + Intronic
1052974982 9:34403484-34403506 CAAAGTAAGGGGCAGAAGGCTGG + Intronic
1054153963 9:61627375-61627397 CAGGATGATGAGGAGAAGGCAGG - Intergenic
1054754272 9:68941400-68941422 CAACATCAGAAGCAGAAGGCAGG + Intronic
1054865857 9:70000267-70000289 CTGATTCAGGAGGAGAAGCCAGG + Intergenic
1054875428 9:70091364-70091386 CAGAGTCAGGGAGAGAAGGCAGG + Intronic
1055605938 9:77970466-77970488 CAAAATCTGGGGTTGAAGGCAGG + Intronic
1055956449 9:81778160-81778182 CAAACTCAGGAGGCCGAGGCAGG - Intergenic
1056131577 9:83592481-83592503 CAAAATTAGTAGAAGTAGGCCGG + Intergenic
1056178354 9:84057683-84057705 CAAAATGAAGGGGAAAAGGCAGG + Intergenic
1056435797 9:86575092-86575114 CAAAATCAGTTGGAGAAGGCTGG - Intergenic
1056516178 9:87352621-87352643 CAGATTCAGGGGGAGAAGGAGGG + Intergenic
1057236398 9:93365371-93365393 GAAAAGTAGGAGGGGAAGGCCGG + Intergenic
1057794607 9:98146289-98146311 CAAAGGCAGCAGGGGAAGGCTGG - Intronic
1058411082 9:104732174-104732196 GAAAAGAAGGAGGAGAAGGAAGG + Intergenic
1058927666 9:109683466-109683488 CAGAAGCAGGGAGAGAAGGCAGG + Intronic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059742324 9:117164250-117164272 CAAGGTCAGGATGAGAATGCAGG + Intronic
1060470106 9:123941457-123941479 CATAACCAGCAGGAGAAGTCAGG - Intergenic
1060569605 9:124626300-124626322 CAAAATCTGTAGGATATGGCTGG - Intronic
1060840712 9:126791192-126791214 AAAAATCAGGAGGTACAGGCTGG + Intergenic
1061293234 9:129664262-129664284 CAAAATGAGGCCGAGTAGGCCGG - Intergenic
1061946373 9:133910512-133910534 GAAAATCAGGGACAGAAGGCTGG + Intronic
1062152708 9:135030164-135030186 CCACATCAGGAGGAGGGGGCAGG - Intergenic
1203581732 Un_KI270746v1:13098-13120 GAAAATAAAGAGGAGAAGGACGG + Intergenic
1185500209 X:591157-591179 AAACATCAGGAGGGGAAGGCCGG - Intergenic
1187384986 X:18840163-18840185 CAAATTCTGGAGGATAAGGTAGG - Intergenic
1187505436 X:19874972-19874994 GAAAAAGAGGGGGAGAAGGCAGG + Intronic
1187856728 X:23644152-23644174 GAAATTCAGGAAGACAAGGCAGG - Intergenic
1188586920 X:31787878-31787900 CAAAATCAAGGGGAGAAAACAGG + Intronic
1189191904 X:39116768-39116790 CAAAATGACGAGGTGAAGGCAGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190831771 X:54065139-54065161 CTAACTCAGGAGGCTAAGGCAGG + Intergenic
1191846213 X:65549977-65549999 CAGACACAGGAGGAGAGGGCAGG + Intergenic
1194284079 X:91988293-91988315 CAGTATGAGGAGGAGAAGGGAGG - Intronic
1196215330 X:113044273-113044295 CAAACTCAGGAGGCTGAGGCAGG - Intergenic
1196719298 X:118839186-118839208 CAAAAACAGAAGAATAAGGCAGG - Intergenic
1197131796 X:123014161-123014183 AGAAATCAGGAGGAGAATGTGGG - Intergenic
1197207879 X:123805428-123805450 CAAATTCAGCTGGAGAAGCCGGG - Intergenic
1197326485 X:125100764-125100786 CAAAATCAGGAGGAGAAGGAGGG - Intergenic
1198019793 X:132646568-132646590 CAAATTCAGGACAAGAAGACAGG + Intronic
1198109484 X:133490205-133490227 CAAAAACAAGAAGACAAGGCTGG - Intergenic
1198367079 X:135951666-135951688 CAGAGTCAGGAGGAGATGGATGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201316903 Y:12656295-12656317 CAAAAACATGAAAAGAAGGCAGG - Intergenic
1201942509 Y:19474941-19474963 AAAAATCACCAAGAGAAGGCAGG + Intergenic
1202053595 Y:20806075-20806097 TAACATCAGGAGGCCAAGGCAGG + Intergenic
1202113674 Y:21450014-21450036 AAAACTCAGGAGGAAAAAGCAGG - Intergenic