ID: 1155199375

View in Genome Browser
Species Human (GRCh38)
Location 18:23503731-23503753
Sequence CCGCGCGGGGGAGGAAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155199375_1155199394 24 Left 1155199375 18:23503731-23503753 CCCGCGCTTCCTCCCCCGCGCGG 0: 1
1: 0
2: 0
3: 24
4: 229
Right 1155199394 18:23503778-23503800 AAGGCCGGTCCCGCGCGACCAGG 0: 1
1: 0
2: 0
3: 4
4: 26
1155199375_1155199387 -5 Left 1155199375 18:23503731-23503753 CCCGCGCTTCCTCCCCCGCGCGG 0: 1
1: 0
2: 0
3: 24
4: 229
Right 1155199387 18:23503749-23503771 CGCGGCCCTGCCGGGGTCGTGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1155199375_1155199386 -6 Left 1155199375 18:23503731-23503753 CCCGCGCTTCCTCCCCCGCGCGG 0: 1
1: 0
2: 0
3: 24
4: 229
Right 1155199386 18:23503748-23503770 GCGCGGCCCTGCCGGGGTCGTGG 0: 1
1: 0
2: 1
3: 28
4: 237
1155199375_1155199392 9 Left 1155199375 18:23503731-23503753 CCCGCGCTTCCTCCCCCGCGCGG 0: 1
1: 0
2: 0
3: 24
4: 229
Right 1155199392 18:23503763-23503785 GGTCGTGGGCGCGCCAAGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 59
1155199375_1155199391 5 Left 1155199375 18:23503731-23503753 CCCGCGCTTCCTCCCCCGCGCGG 0: 1
1: 0
2: 0
3: 24
4: 229
Right 1155199391 18:23503759-23503781 CCGGGGTCGTGGGCGCGCCAAGG 0: 1
1: 0
2: 0
3: 12
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155199375 Original CRISPR CCGCGCGGGGGAGGAAGCGC GGG (reversed) Intronic