ID: 1155200664

View in Genome Browser
Species Human (GRCh38)
Location 18:23514914-23514936
Sequence TGTACAGTGTTCTGTAATAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155200661_1155200664 4 Left 1155200661 18:23514887-23514909 CCATGAGCATTAATGTCTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1155200664 18:23514914-23514936 TGTACAGTGTTCTGTAATATCGG 0: 1
1: 0
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155200664 Original CRISPR TGTACAGTGTTCTGTAATAT CGG Intronic
905877867 1:41444771-41444793 TGTTCAGTGTTCTCTCCTATAGG - Intergenic
909215771 1:72886442-72886464 TGTATAGTTTCCTGTAATGTTGG + Intergenic
909808494 1:79901920-79901942 TGTTCAGTTTTCTTTATTATAGG + Intergenic
909880902 1:80876687-80876709 TTGCCAGTGTTCTATAATATTGG - Intergenic
911256187 1:95636265-95636287 TGTCCAGTGTTCCCTAATATTGG - Intergenic
915847032 1:159277366-159277388 GGTACAGGGCTCTGTAAGATTGG - Intergenic
916860940 1:168804442-168804464 TGTTCAGTGTTCTCTTAAATAGG + Intergenic
917131447 1:171746312-171746334 TGTGTAGTGTTTTGTACTATTGG + Intergenic
917295761 1:173517613-173517635 TTTACAGAGTTCTGTACTACTGG - Exonic
918483050 1:185000315-185000337 TATACATTGTTCTGTCATAAAGG - Intergenic
918685868 1:187414753-187414775 TGTACAGATAACTGTAATATGGG - Intergenic
920245200 1:204582642-204582664 TGTCCAGTGTTCTGTTGTGTGGG - Intergenic
923118475 1:230967054-230967076 TGTAAAGAGTTCAGTAATGTGGG - Intronic
924359616 1:243223951-243223973 TGTATTATGTTCTGTAATCTTGG - Intronic
1064470966 10:15635345-15635367 TACACAGTGCTCTGTAATATTGG - Intronic
1065139767 10:22708824-22708846 TGTACAGTGTACTGTAGCTTGGG - Intronic
1066271711 10:33830506-33830528 TGTACAGTTTTCTCTAATGAAGG + Intergenic
1066802266 10:39205348-39205370 TGGACAGTGTTCTGTGATGGGGG + Intergenic
1068450788 10:57184394-57184416 TGTACAGTATTGTGAATTATAGG - Intergenic
1068509298 10:57943998-57944020 TGTACTGTTTTCTATAATAGCGG - Intergenic
1069281288 10:66657609-66657631 AGTACATTGCTCAGTAATATAGG - Intronic
1069461215 10:68596812-68596834 TGTGCACTCTTCTGTAAAATTGG - Intronic
1070529499 10:77324301-77324323 TTTCCAGTGTCCTGTAAAATGGG + Intronic
1070594803 10:77825045-77825067 TGAGCAGTGTTCTGCAATGTGGG - Intronic
1071235109 10:83636490-83636512 TGAAAAGTGTTATGGAATATAGG + Intergenic
1071695549 10:87864812-87864834 TGTACTGTATTCTGTATTAACGG - Intronic
1072126439 10:92449466-92449488 TCTAAAGTGTTATGTAAGATTGG + Intergenic
1075908230 10:126101223-126101245 TGTTCAGTGGTCTGTAAAACTGG + Exonic
1075986015 10:126785767-126785789 TGTATTGTCTTCTGTAACATAGG + Intergenic
1079803477 11:24898858-24898880 AGTACAGTGTTCTATTAGATGGG + Intronic
1080507636 11:32932587-32932609 TAATCAGAGTTCTGTAATATCGG + Exonic
1080846136 11:36028687-36028709 GGAACAATTTTCTGTAATATAGG - Intronic
1084442947 11:69186305-69186327 TGTTCATTATTCTGAAATATTGG - Intergenic
1087227186 11:95614385-95614407 TGTACAGGTTTGTGGAATATGGG - Intergenic
1088229718 11:107661352-107661374 TCTACAATGTGCTGGAATATTGG - Intronic
1088695561 11:112362923-112362945 TGTGCAGTGATATGTAAAATAGG - Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1091017297 11:132063517-132063539 TGAACAGGGTACTGTAAAATTGG - Intronic
1092594918 12:9991468-9991490 TGTACAGTTTTCTGAATTATTGG + Intronic
1096325541 12:50657721-50657743 TGTAAAATGTTCTTTAATTTTGG - Intronic
1099982289 12:89618846-89618868 TGTAAAGTGTTCATTAATACTGG + Intronic
1101334369 12:103783272-103783294 TGTACAGAGTTCTGTCAGGTTGG - Intronic
1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG + Intronic
1104867309 12:131965035-131965057 TGTACAGTGTCCTTTGATGTGGG + Intronic
1110312347 13:74065582-74065604 TGTACTGTTTTCTGTAATATGGG + Intronic
1110345075 13:74437573-74437595 TCTGCATTGTTCTGTACTATTGG - Intergenic
1110759513 13:79215838-79215860 TCTATAGTATTCTGTTATATCGG - Intergenic
1111807532 13:93056103-93056125 TGTAAAGTGTTTTGTCATATTGG - Intergenic
1112883345 13:104136370-104136392 TTGACAGTGTTCTCTAATAAAGG + Intergenic
1114436042 14:22708651-22708673 TGTACACCCTTCTGTGATATTGG - Intergenic
1115351425 14:32399575-32399597 TGTAAAGTGTTCTATAATTTGGG - Intronic
1119086801 14:71746598-71746620 TGTTGATTGTTCTGTAAAATGGG - Intergenic
1120651368 14:87137492-87137514 AGTACAGTGTTGAATAATATGGG + Intergenic
1121806716 14:96833060-96833082 TGCACTGTGTTCTATCATATCGG + Intronic
1124044318 15:26134579-26134601 TGTCCATTGATGTGTAATATTGG - Intergenic
1124902703 15:33838917-33838939 TGTACAGTACTCTCTAATGTAGG - Exonic
1125093536 15:35824797-35824819 TGTACAATGTCCTTTAATTTAGG - Intergenic
1127607812 15:60607225-60607247 TGTACAGTATGCTGTAATACAGG - Intronic
1130195259 15:81773321-81773343 TGTGTTCTGTTCTGTAATATTGG + Intergenic
1130763389 15:86844081-86844103 TGAAAAGTGTTCTGTTGTATGGG + Intronic
1131257855 15:90873399-90873421 TCTACAGTGTGCTGGAATCTGGG + Intronic
1131911734 15:97212823-97212845 TATTCAATATTCTGTAATATGGG - Intergenic
1132390452 15:101434697-101434719 TGTACAGTGTTCGGTTCCATTGG - Intronic
1138774944 16:59709729-59709751 TGGACTGTCTTCTATAATATTGG + Intergenic
1141452970 16:84117766-84117788 TGCGCTGTGATCTGTAATATTGG - Intergenic
1143934064 17:10463728-10463750 TGCACAGTATTCTGTAACTTTGG + Intronic
1144358953 17:14472785-14472807 TGCATAGTGTTCTATCATATAGG + Intergenic
1145915085 17:28568694-28568716 AACACAGTGTTCAGTAATATGGG - Intronic
1149851521 17:60038916-60038938 TGTACAGTATTAGGTAATATTGG + Intergenic
1150172770 17:63017446-63017468 TGTTCACTGTTCTGTTGTATAGG + Intronic
1151507064 17:74535775-74535797 TATACATTGTTCTTTGATATTGG - Intergenic
1154129053 18:11720319-11720341 TGTACAATTTTTTGTAAGATAGG + Intronic
1155200664 18:23514914-23514936 TGTACAGTGTTCTGTAATATCGG + Intronic
1157169834 18:45393020-45393042 TGTATAGTCATCTGAAATATTGG - Intronic
1166032405 19:40142222-40142244 TGTACAGTGCTCTGTATTTGTGG - Intergenic
925769603 2:7269078-7269100 TGTAAAGAGTGCTGTAATAAAGG + Intergenic
928897777 2:36284611-36284633 TGTAAAGAGTACTCTAATATGGG - Intergenic
929472815 2:42212914-42212936 TGCCCTGTGTTCTGTAATCTTGG + Intronic
931662575 2:64580811-64580833 TGTACAGTGATTTTTAATGTTGG + Intronic
932162278 2:69472009-69472031 TGTTCAGTGTTATTTGATATTGG - Exonic
937776893 2:125788529-125788551 GGTAAAGTGTTTTATAATATGGG - Intergenic
939532156 2:143376906-143376928 TATACTGTGTTTTGTATTATTGG + Intronic
943424793 2:187717961-187717983 GGTATAGTGTTATGTTATATGGG + Intergenic
944143236 2:196479456-196479478 TGAACACTGTTCTGCAATACTGG - Intronic
944888184 2:204086777-204086799 TTTACAGTGTTCTGTATAATAGG - Intergenic
1172687748 20:36769658-36769680 AGTACTGTGTTATGTAAGATAGG + Intronic
1174560842 20:51429578-51429600 TGTACTGTGTTCTGCAAGAATGG - Intronic
1175560168 20:59918859-59918881 TGTACAATTTTTTGTAATATAGG - Intronic
1177766234 21:25460617-25460639 TGTACAGTTGTCTTTTATATTGG - Intergenic
1179197356 21:39177032-39177054 TATACAGTTCTCTGTAAAATTGG + Intronic
1182081594 22:27533148-27533170 TGGACACTGTTCTGTAATTCTGG - Intergenic
1183107586 22:35625885-35625907 TGGAAAGTGTTCTTTAAGATAGG - Intronic
949562810 3:5218427-5218449 TGTTCTGTGTTCTGAAATACTGG + Exonic
951400171 3:22223367-22223389 TGTACAGTGTTTAATAATGTAGG + Intronic
952286552 3:31975165-31975187 TATACAGTGTTTTGTAACCTAGG + Intronic
958937101 3:100267770-100267792 TGTACAGTATTTTCTTATATAGG - Intronic
958975597 3:100664845-100664867 TGTACAGTGTTTCCTTATATTGG - Intronic
961267025 3:125651659-125651681 TGTACAGTGGTTAGAAATATAGG + Intergenic
962256969 3:133878156-133878178 TGTATAGTTTTCTTTAATTTTGG - Intronic
963874406 3:150457978-150458000 TTTAAAGTGATCTGTAATTTTGG - Intronic
967567903 3:190992855-190992877 AGTACAGTGGCCTGTAATACTGG + Intergenic
970911983 4:21287449-21287471 TGAACAGAGTTCTGTAAAACTGG + Intronic
973023462 4:45234798-45234820 TGTACAGTGGTATGAAATTTGGG + Intergenic
973099420 4:46245796-46245818 TGTAAATTGTTCTTTACTATTGG + Intergenic
974737484 4:65955703-65955725 AGTATAGGGTTCTGTAACATGGG + Intergenic
976942542 4:90721753-90721775 TTTTCAGTGATCTGTAATTTAGG - Intronic
976960920 4:90971763-90971785 TGTACTGTATTCTGTTATTTTGG - Intronic
978168928 4:105645299-105645321 CGTCCAGTGCTCTGTAATCTGGG - Exonic
979273531 4:118790790-118790812 AGTACAGTGTTTTTTAAAATTGG - Intronic
979926876 4:126579008-126579030 TGTTCAGTGTTCTCTTATTTGGG - Intergenic
991071166 5:62482084-62482106 TTTACAGTGTTCTCTGATGTTGG + Intronic
993711854 5:91232931-91232953 TCTTCAGTGTTTTGTAATCTCGG - Intergenic
995447907 5:112266776-112266798 GGCAGAGTGTTATGTAATATAGG - Intronic
997154957 5:131545610-131545632 TGGCCAGTGTCCTGCAATATTGG - Intronic
997915592 5:137921484-137921506 AGTACAGAGTTGTGTAAAATTGG - Intronic
999754053 5:154651505-154651527 TGTACAGTATTCTATAGTGTGGG + Intergenic
999793317 5:154964041-154964063 TGTTCAGTTCTCTGGAATATAGG - Intronic
1000582983 5:163056622-163056644 TGTTTAGTGTTCTGTAAACTTGG + Intergenic
1007890786 6:45288971-45288993 TATACAGTGTCCTCTAATATAGG + Intronic
1008554680 6:52663408-52663430 AGTACAGTGTCCTGAAATACTGG - Intergenic
1009738998 6:67720058-67720080 TGTTCAGTGTTCTGTATTTCTGG - Intergenic
1010151094 6:72733031-72733053 TGTTCAGTTTTCTGTGAAATGGG + Intronic
1010421158 6:75677631-75677653 TGTACATTTGTATGTAATATAGG + Intronic
1011468792 6:87687178-87687200 TGTACATTGCTCTGTTATTTTGG - Intronic
1012275033 6:97262694-97262716 TTTCCAGTTTTCTGTAATTTGGG - Intronic
1014258271 6:119186100-119186122 TTTACAGTGTTCTGTGCTCTGGG - Intronic
1021393059 7:20118140-20118162 TGGAGAGTGTTCTGGAATCTGGG + Intergenic
1022004158 7:26251845-26251867 TGTAGATTGTTCTGAAATTTAGG - Intergenic
1023007489 7:35887904-35887926 TTTACAGACATCTGTAATATTGG - Intronic
1025276632 7:57587653-57587675 TGTATAATTTTCTATAATATGGG + Intergenic
1026103220 7:67399650-67399672 TGTACAGGGTACTGAAATACTGG + Intergenic
1026745425 7:73007714-73007736 TGTTCACTGTGCTGCAATATAGG + Intergenic
1026749076 7:73035648-73035670 TGTTCACTGTGCTGCAATATAGG + Intergenic
1026752724 7:73063793-73063815 TGTTCACTGTGCTGCAATATAGG + Intergenic
1026756375 7:73091925-73091947 TGTTCACTGTGCTGCAATATAGG + Intergenic
1027031535 7:74892391-74892413 TGTTCACTGTGCTGCAATATAGG + Intergenic
1027091030 7:75301500-75301522 TGTTCACTGTGCTGCAATATAGG - Intergenic
1027094675 7:75329472-75329494 TGTTCACTGTGCTGCAATATAGG - Intergenic
1027098316 7:75357378-75357400 TGTTCACTGTGCTGCAATATAGG - Intergenic
1027324666 7:77038211-77038233 TGTTCACTGTGCTGCAATATAGG + Intergenic
1027378619 7:77579943-77579965 TATACAGGGTTATGTAATAAGGG - Intronic
1028434613 7:90788068-90788090 TGAACTGAGTTCTGGAATATAGG - Intronic
1029399429 7:100334272-100334294 TGTTCACTGTGCTGCAATATAGG - Intergenic
1031381748 7:121094595-121094617 AGTATAGTGTTCAGTGATATGGG + Intronic
1034035805 7:147820204-147820226 TGTACAGTGATCTGTCATTATGG + Intronic
1035002979 7:155630727-155630749 TGTACACTGTTCCTTAATTTGGG + Intronic
1035011579 7:155722027-155722049 TGTAAAGTGCTTTGTAATTTAGG + Intronic
1036119724 8:6002708-6002730 TGTACATTGTTCTGTATAATTGG - Intergenic
1036455451 8:8902772-8902794 TGTAGAGTTTTCTGAAATTTTGG - Intergenic
1037170897 8:15890551-15890573 AGTGCAGTGTTGTGTAATCTCGG - Intergenic
1037718846 8:21423725-21423747 TGTACAGTGTTTTACAAAATTGG + Intergenic
1038731301 8:30130174-30130196 TGTACAGTGTTTTGTATGGTGGG + Intronic
1038969423 8:32615921-32615943 TTTACACGTTTCTGTAATATAGG + Intronic
1039026836 8:33267756-33267778 TATACAGGGTTCTGTACCATTGG - Intergenic
1039279376 8:35966836-35966858 TGTACAGTGTGCTGAAGTAGGGG - Intergenic
1039628549 8:39081580-39081602 TGTAGAATCTTCTGTAATTTTGG + Intronic
1040919568 8:52600808-52600830 AGTGGAGTGTTCTGTAGTATGGG - Intergenic
1042259762 8:66846271-66846293 TGTACAGGTTTCTGTACTCTGGG - Intronic
1046539875 8:115566056-115566078 TGTACAGTTTTCTTTAAAATAGG - Intronic
1050738868 9:8796315-8796337 TGAACAGTATTCTATAATAGGGG + Intronic
1051734897 9:20188188-20188210 TGGAGAGTGTTCTCTAATTTGGG - Intergenic
1051904699 9:22081772-22081794 TTTACAGTGTTATGAAAAATAGG + Intergenic
1055312000 9:74992329-74992351 TGTAAAGTGTACTGAAAGATAGG - Intronic
1055943975 9:81676343-81676365 TGCTCAGTGTCCTGTAATAATGG - Intronic
1056155051 9:83825912-83825934 TGTACCATGTTATGTAAGATAGG - Intronic
1058190541 9:101909368-101909390 TGTACAGTGTTTTGTCATTGTGG - Intergenic
1058536474 9:105965345-105965367 TGTATAGTCTTCTGGAACATGGG + Intergenic
1059174219 9:112154616-112154638 TGGATAGTGTTCTGTAACCTAGG - Intronic
1203560428 Un_KI270744v1:50867-50889 TGTACAGTGATCTCTGAAATGGG - Intergenic
1186723726 X:12334405-12334427 GGTGCAGTGTTCCCTAATATGGG + Intronic
1189597191 X:42581394-42581416 TGTTCAATGTTCTCTAAAATGGG + Intergenic
1190778509 X:53574992-53575014 AGCTCAGTGTTCTGTAATAAAGG - Intronic
1194664170 X:96659169-96659191 TGTACTGAGTTCTGTAATTGAGG + Intergenic
1197990611 X:132312875-132312897 TATTCAGTGTTCTGTTTTATGGG - Intergenic
1198149049 X:133890208-133890230 TGTACAGTATTCTATCATATAGG + Intronic
1201462957 Y:14247955-14247977 TGTAAAGTCTTTTGTAATAAAGG + Intergenic
1201595191 Y:15660400-15660422 TATACATTGTTCTGTAATACAGG + Intergenic
1202039273 Y:20665749-20665771 TGTACTTTCCTCTGTAATATTGG + Intergenic