ID: 1155201162

View in Genome Browser
Species Human (GRCh38)
Location 18:23519077-23519099
Sequence CAATATGTGCATCTTTTTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155201162_1155201164 -7 Left 1155201162 18:23519077-23519099 CCTGTAAAAAGATGCACATATTG 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1155201164 18:23519093-23519115 CATATTGAAGTTAAATAGGACGG 0: 1
1: 0
2: 1
3: 20
4: 199
1155201162_1155201167 17 Left 1155201162 18:23519077-23519099 CCTGTAAAAAGATGCACATATTG 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1155201167 18:23519117-23519139 AAAGTTTGCCCTGAACGTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 78
1155201162_1155201165 -6 Left 1155201162 18:23519077-23519099 CCTGTAAAAAGATGCACATATTG 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1155201165 18:23519094-23519116 ATATTGAAGTTAAATAGGACGGG 0: 1
1: 0
2: 0
3: 25
4: 212
1155201162_1155201166 14 Left 1155201162 18:23519077-23519099 CCTGTAAAAAGATGCACATATTG 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1155201166 18:23519114-23519136 GGGAAAGTTTGCCCTGAACGTGG 0: 1
1: 0
2: 0
3: 16
4: 106
1155201162_1155201170 26 Left 1155201162 18:23519077-23519099 CCTGTAAAAAGATGCACATATTG 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1155201170 18:23519126-23519148 CCTGAACGTGGTGGACAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155201162 Original CRISPR CAATATGTGCATCTTTTTAC AGG (reversed) Exonic
908073314 1:60487893-60487915 CAATATGTGACTTTTTTTTCTGG - Intergenic
908905938 1:69009024-69009046 TAATATCTGTATCTTTTTAGGGG - Intergenic
909667872 1:78155631-78155653 CAGTATATGCATCTTTTTCATGG - Intergenic
910254933 1:85238374-85238396 CTATATGTGAATATTTTTATTGG + Intergenic
911438321 1:97891929-97891951 CAACATGTGTATCATTTTAATGG - Intronic
911753619 1:101527217-101527239 CAAGATTTGCTTCTTTTTAGGGG + Intergenic
913233045 1:116757610-116757632 GCATATATGCATCTTTTTAAAGG - Intronic
916968381 1:169979485-169979507 AAATAGGCACATCTTTTTACTGG + Intronic
918466713 1:184828136-184828158 AAATATGTTGATGTTTTTACTGG + Intronic
920694538 1:208172180-208172202 CAATATGTGCATCTTTCCTTTGG - Intronic
921098129 1:211904712-211904734 CAATATTTCCTTCTTTTTAAAGG + Intergenic
921821057 1:219617912-219617934 CAAAATTTGCAGCTCTTTACAGG + Intergenic
922380169 1:225015170-225015192 CAGTCTGTGCATGTCTTTACAGG + Intronic
922531886 1:226351135-226351157 CAATTTTTGTATCTTTTTAGTGG + Intergenic
923231676 1:231992263-231992285 GAATCTGTGCATCTTTATATTGG + Intronic
923882177 1:238115623-238115645 CAATATGTGTTTTTTTTTATTGG + Intergenic
1065187694 10:23184911-23184933 CAATTTCTCCATCTCTTTACTGG - Intergenic
1065686053 10:28286007-28286029 CAAAATGTACAACTTTGTACAGG + Intronic
1065706491 10:28475780-28475802 CAATATGTCCATCTATCTGCTGG + Intergenic
1068537025 10:58251855-58251877 CAATCTGTGCATGTCTTTAAAGG + Intronic
1069284667 10:66698152-66698174 ACATATGTGCATCTGTTTAAGGG - Intronic
1069489793 10:68851542-68851564 AAATATGTACATCTATTTGCTGG + Intronic
1069649046 10:70029576-70029598 CAATATGTGTCTCTTTATAAAGG + Intergenic
1069664858 10:70147510-70147532 CAATGTCTGTATCTTTTTATTGG - Exonic
1072601049 10:96930049-96930071 CAATATTTCAATCTTTTTAATGG - Intronic
1076537928 10:131194841-131194863 AAATATGTGCATATGTTTCCGGG - Intronic
1079345592 11:19649232-19649254 CAATATTTGCATCTGGTTAGTGG + Intronic
1079894339 11:26100150-26100172 GAAGATGAGCATCTTTTTATAGG - Intergenic
1079907757 11:26269808-26269830 CAATATGTGAATTTTTTGGCAGG - Intergenic
1081436726 11:43034909-43034931 CAATATGTGTTTCTTTTAGCAGG - Intergenic
1082037781 11:47659150-47659172 CAATCTGTGAGTCTTTTTAAGGG - Intergenic
1085450301 11:76628005-76628027 CCATAGGTGCATCTTAATACAGG - Intergenic
1087414622 11:97838123-97838145 AAATATGTGCATCCTTTCTCTGG - Intergenic
1090399415 11:126439513-126439535 CAGTATCTGCATTTTTTTAAAGG - Intronic
1091364110 11:135002969-135002991 CAAAATGTCCTTCTTTTTAAAGG + Intergenic
1095353230 12:41239977-41239999 TAATATGTGCATTTTTTTAAAGG + Intronic
1097443637 12:59642372-59642394 AAATATGTGCATGATTTTATGGG - Intronic
1097734009 12:63161716-63161738 TATTATGTGCATTTTTTTTCTGG + Intergenic
1098115483 12:67171979-67172001 CAATATGAGCATCTTGATATTGG + Intergenic
1098214026 12:68196629-68196651 CAATATTTGAATATTTTTGCCGG - Intergenic
1098894230 12:76039237-76039259 CCATAGGTTCTTCTTTTTACAGG + Exonic
1099982802 12:89626094-89626116 CATTTTGCTCATCTTTTTACTGG - Intronic
1100792941 12:98150586-98150608 CAAAATGTTCATGTTTTTAAAGG + Intergenic
1102402246 12:112639667-112639689 CAATATCTGCATCTTTGTGGGGG - Intronic
1102668254 12:114595221-114595243 CTATATGTGTATGTTTATACTGG + Intergenic
1103424608 12:120821988-120822010 CAATATTTGTCTCTTTTTTCTGG - Intronic
1104174551 12:126317291-126317313 AAATATGTACAGCTTTTTATAGG - Intergenic
1105592444 13:21806053-21806075 AAACATGTGCATTTTTCTACTGG + Intergenic
1106481423 13:30140049-30140071 CAATAAGTGCATGTATTTATGGG + Intergenic
1106727541 13:32501511-32501533 CGATATTTTCATTTTTTTACTGG - Intronic
1109142445 13:58731355-58731377 TAATATGTACATCTTTTAAGTGG - Intergenic
1110037027 13:70700728-70700750 CAATATGTGTCTTTTTTTACTGG - Intergenic
1111062669 13:83043568-83043590 CAATAGATGCATCATTTTAAAGG - Intergenic
1112084704 13:96017867-96017889 CAATATGACCATCTTTTTTGTGG - Intronic
1114895602 14:26986967-26986989 CAACATGTGCATATTTGAACTGG - Intergenic
1115273917 14:31585070-31585092 CAATATGTGCTTTTTCTGACTGG + Intronic
1120173844 14:81273384-81273406 CAATATGTTCATCCTTGTATGGG - Intronic
1123961296 15:25403768-25403790 CAAAATTTGCATCCTTTTTCAGG - Intronic
1124532537 15:30520161-30520183 CAAAATTTCCATCTTTTAACTGG + Intergenic
1124766116 15:32487483-32487505 CAAAATTTCCATCTTTTAACTGG - Intergenic
1125263798 15:37856129-37856151 CAATATGTCTTTATTTTTACAGG + Intergenic
1127214172 15:56806964-56806986 CAAAATGTGCTTCTTTTTTAAGG - Intronic
1127785198 15:62349594-62349616 CAATATTTTCTTCTTTTTAAAGG + Intergenic
1128734012 15:70041814-70041836 CTCTATCTGCTTCTTTTTACTGG + Intergenic
1133292288 16:4730363-4730385 CCATATGTGCTCCTCTTTACTGG - Intronic
1135385932 16:22039894-22039916 TAATATGTTCACTTTTTTACTGG + Intronic
1137043675 16:35637603-35637625 CACCATGTGCCTCTTTTCACAGG + Intergenic
1137917960 16:52453694-52453716 CTATATGTGCAAATTTTCACAGG - Intronic
1142535333 17:611713-611735 CACTATGTGAATATTTGTACAGG - Intronic
1142535334 17:611753-611775 CACTATGTGAATATTTGTACAGG - Intronic
1142535336 17:611845-611867 CACTATGTGAATATTTGTACAGG - Intronic
1142535341 17:612063-612085 CACTATGTGAATATTTTTACAGG - Intronic
1142535345 17:612245-612267 CACTATGTGAATATTTGTACAGG - Intronic
1142535347 17:612337-612359 CACTATGTGAATATTTGTACAGG - Intronic
1142535351 17:612517-612539 CACTATGTGAATATTTGTACAGG - Intronic
1142535357 17:612789-612811 CACTATGTGAATATTTGTACAGG - Intronic
1142535361 17:612969-612991 CACTATGTGAATATTTGTACAGG - Intronic
1142535363 17:613061-613083 CACTATGTGAATATTTGTACAGG - Intronic
1142535366 17:613192-613214 CACTATGTGAATATTTGTACAGG - Intronic
1142535369 17:613323-613345 CACTATGTGAATATTTGTACAGG - Intronic
1142535372 17:613467-613489 CACTATGTGAATATTTGTACAGG - Intronic
1142535373 17:613507-613529 CACTATGTGAATATTTGTACAGG - Intronic
1142535375 17:613599-613621 CACTATGTGAATATTTGTACAGG - Intronic
1142535377 17:613691-613713 CACTATGTGAATATTTGTACAGG - Intronic
1144463316 17:15476117-15476139 CAAAATGTGCAAATTTTTAAAGG + Intronic
1144522124 17:15960250-15960272 CAATTTGTGCCTTTTTTTAATGG - Intronic
1146821321 17:35985436-35985458 CAACATGTGCCTGTTTGTACAGG - Intronic
1147344978 17:39784845-39784867 CAATACCTGCATTTTTTTGCAGG + Intronic
1149351048 17:55787678-55787700 CAATATGTGTATGTTTTTATAGG + Intronic
1151264030 17:72939881-72939903 GAATATTTGCATTATTTTACTGG + Intronic
1152726739 17:81950832-81950854 CAACGTGTGCACCTGTTTACCGG + Intergenic
1153955722 18:10094366-10094388 CTATATGACCATCTGTTTACAGG - Intergenic
1155201162 18:23519077-23519099 CAATATGTGCATCTTTTTACAGG - Exonic
1155555935 18:27019366-27019388 GAATATGTGTATCCTTTTGCTGG + Intronic
1156097623 18:33554003-33554025 GGATATGTGCATCTTTTTGTTGG - Intergenic
1156909797 18:42397999-42398021 CATTATGTGTGTCATTTTACTGG + Intergenic
1157014137 18:43689555-43689577 CAATATGTTCATGTTATTATTGG + Intergenic
1157366447 18:47068989-47069011 CAATTTTTGCAGCTTTTTAAAGG - Intronic
1158667309 18:59444062-59444084 CAAAATTTCCATCTTTTTAAAGG + Intronic
1161863534 19:6817358-6817380 CAATATTTGCATTTTTTGGCTGG - Intronic
1163644684 19:18482115-18482137 CATGTTGAGCATCTTTTTACAGG + Intronic
1165566433 19:36732831-36732853 CAATCTGTGCATATTTTTATAGG - Intronic
926926330 2:17991916-17991938 CTATATGTCCATCTTTGTGCAGG + Intronic
927347474 2:22062630-22062652 CAATATGTACATTTTCTGACTGG + Intergenic
927359152 2:22211455-22211477 CAATATTTTCTTCTTTTTAAAGG + Intergenic
928282239 2:29958282-29958304 CTATATGTCCATTTTTATACCGG - Intergenic
928551262 2:32373373-32373395 CTATATGTCCATCTTTATGCTGG - Intronic
928692513 2:33815418-33815440 AAATATGTGCATAATTTTAATGG - Intergenic
933692266 2:85188516-85188538 CTGTATGTCCATATTTTTACAGG - Intronic
935823858 2:106921971-106921993 CAAGATTTTCTTCTTTTTACAGG + Intergenic
938233119 2:129678855-129678877 CAATATTTGCTGCTTTTTTCTGG - Intergenic
939192230 2:138930530-138930552 CCATATGTGCATCATGTTCCTGG - Intergenic
939917841 2:148069820-148069842 CAATATTTGTACCTTTTTATGGG + Intronic
940019811 2:149145027-149145049 TCATATGTGCATATTTTTTCTGG + Intronic
941157083 2:161992454-161992476 AAATATTTTCATCTTTTAACAGG + Exonic
941272307 2:163445841-163445863 CAATATTTGCAAATTTTAACAGG - Intergenic
941492222 2:166156364-166156386 CAAAGTGAGCATCTTTTTATAGG - Intergenic
941574180 2:167210165-167210187 CAATATTTGCATATTTTAGCTGG + Intronic
943005511 2:182384783-182384805 CAATATTTACATCTTTCTCCAGG - Intronic
945157494 2:206855023-206855045 CAATATTTGTCTCTTTGTACCGG - Intergenic
945994734 2:216426424-216426446 CATTATGTGCATTTTTTTCTGGG - Intronic
946756017 2:222948449-222948471 CTGTATGTGCATTTTTTTTCTGG + Intergenic
948997133 2:241587269-241587291 GAATATGTCCATCTGTTTGCTGG + Intronic
1172311536 20:33922131-33922153 AAATATTAGCATCTTTTCACTGG - Intergenic
1175672293 20:60915280-60915302 CAATAATTGCATGTATTTACAGG + Intergenic
1177137454 21:17320766-17320788 CATTCTGTGTCTCTTTTTACAGG - Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
955681942 3:61511556-61511578 GAATATATGCATATTTGTACAGG + Intergenic
956258298 3:67308219-67308241 CAAGATGTTCATATTTTTTCAGG + Intergenic
956531702 3:70227013-70227035 AAATACATGCATCTTTTTCCTGG + Intergenic
957357676 3:79113464-79113486 CAATAATTTCATTTTTTTACAGG - Intronic
957940829 3:87001652-87001674 GAATATGTACATGTTTTTAATGG + Intergenic
960052261 3:113250231-113250253 CAATATTAGCTTCATTTTACAGG + Intronic
960441643 3:117696055-117696077 CAAGATGTGCATCTTTGGAAAGG - Intergenic
960765864 3:121129234-121129256 CACTATGTGCCTCTAATTACAGG - Intronic
962865659 3:139446285-139446307 GATTTTGTTCATCTTTTTACAGG + Intergenic
963496743 3:146073352-146073374 TAATATGTACTTCTTTTTATAGG - Exonic
963552904 3:146746706-146746728 CACTATATGCAACTTTTTAATGG - Intergenic
963593160 3:147288026-147288048 CAATATGTGAATGTGTTTAAGGG + Intergenic
964603634 3:158533247-158533269 CAATGTGGGAATCATTTTACTGG - Intronic
964670702 3:159222313-159222335 CAATATCTGCTTCTTTTTAAAGG - Intronic
965130206 3:164689071-164689093 TGATATGTGCATATTTTCACAGG + Intergenic
966798278 3:183737467-183737489 CACTTTGTTCATCTTTTTAAAGG - Intronic
967157077 3:186703110-186703132 CAATATGTGCATTTTTCTTATGG - Intergenic
967742614 3:193019980-193020002 GAATATGTGAATCCTTGTACTGG + Intergenic
968247947 3:197173624-197173646 CAGTATGTATTTCTTTTTACAGG - Intronic
969105032 4:4800791-4800813 CAATATGTGCATTTTTGGTCTGG - Intergenic
970023922 4:11600739-11600761 CAATATGTTCATCATATTTCTGG - Intergenic
971182381 4:24341298-24341320 AAATATGTGCAGATTTTTAGTGG - Intergenic
971681311 4:29704858-29704880 CAATATGTGTATGTTTTTAAGGG + Intergenic
974362720 4:60902874-60902896 CATTATCTCCATCTTTTTTCTGG + Intergenic
974796859 4:66763749-66763771 CAATATGACAATATTTTTACAGG + Intergenic
976003032 4:80394735-80394757 AAATATGTGCATTTTTTTCTGGG + Intronic
976020389 4:80616726-80616748 AAATATTTGCATCTTTTATCTGG - Intronic
976345972 4:84001766-84001788 CAATATGCTCATCCTTTTAATGG + Intergenic
976489304 4:85649897-85649919 CATTATTTTCCTCTTTTTACAGG + Intronic
979407257 4:120328511-120328533 CACTATCTTCATCATTTTACAGG + Intergenic
980059750 4:128116450-128116472 CAATATTTGAATCTTTTGAGTGG - Intronic
982447472 4:155510090-155510112 CAAAATGTGCAACGTTTTTCTGG - Intergenic
982510766 4:156280043-156280065 AAATATGTGCTTTGTTTTACTGG + Intergenic
982923065 4:161301004-161301026 CAATATGTGGAATCTTTTACAGG + Intergenic
983461744 4:168033091-168033113 CACTCTATGCATGTTTTTACTGG - Intergenic
983586617 4:169362538-169362560 TAGTATGTGCATATTTTTACAGG - Intergenic
984009371 4:174352198-174352220 CAATATCTGGTTCTTTTTTCTGG - Intergenic
984030121 4:174593669-174593691 AAATATGTCCATCTCTTTAAGGG - Intergenic
986973251 5:13362435-13362457 CAATATAAGCATGTTTTTAATGG - Intergenic
988626783 5:32885190-32885212 CTATATGTCCATCTTTATGCTGG + Intergenic
991098142 5:62761387-62761409 CAATATGTGGATTCTTTTTCTGG - Intergenic
991325003 5:65421023-65421045 CAATGTGTGTATCTTTTAAGTGG + Intronic
991558872 5:67927459-67927481 AAATATGTGCAGTTTTTTATAGG - Intergenic
991640012 5:68742836-68742858 GAGTATGTACATCTTATTACAGG - Intergenic
992810757 5:80386059-80386081 CTATATGTCTATCTTTTTAATGG + Intergenic
993540529 5:89144951-89144973 CAGTATGTCCTTCTTTTTAAAGG + Intergenic
993595987 5:89856315-89856337 CTATATTTCCATCTTTTAACTGG - Intergenic
993853554 5:93041850-93041872 TAATATATACATCTCTTTACTGG - Intergenic
994158480 5:96529307-96529329 CAATATGAGTACCTTTTAACTGG - Intronic
994660969 5:102653910-102653932 CAATATGATCATCTGTTTCCAGG + Intergenic
994971088 5:106738355-106738377 AAATATGTGTATCTCTTTTCTGG - Intergenic
995146676 5:108794911-108794933 GAATATTTACATCTTTCTACAGG + Intronic
995333063 5:110967076-110967098 CAACATGTAAATGTTTTTACTGG + Intergenic
995397648 5:111704454-111704476 TAATTTGTGCATCTTTATTCTGG + Intronic
995648503 5:114341006-114341028 CAATATTTCCTTCTTTTTAAAGG + Intergenic
996540093 5:124621873-124621895 CATTATATGCATATTCTTACAGG - Intergenic
997519418 5:134512953-134512975 AAACATGTGCATTTTTGTACGGG - Intergenic
1002937554 6:1686573-1686595 AAATATTTGCATCTATTTAAAGG + Intronic
1009196181 6:60688260-60688282 CAATATTTGCTTTATTTTACAGG + Intergenic
1014851121 6:126340611-126340633 AAATATCTGGATCTTTTTAAAGG + Intronic
1016783100 6:147981732-147981754 CAAAATGTTCTTTTTTTTACTGG + Intergenic
1016785603 6:148007478-148007500 CCATAAGAGCATCTTTTTCCAGG - Intergenic
1020769032 7:12364285-12364307 CAAGGTGTGCTTCTTGTTACAGG - Intronic
1021308611 7:19063230-19063252 CAATAGGTGTATATATTTACGGG + Intronic
1022491221 7:30820223-30820245 CAATCTGTGTCTCTTTTAACTGG + Intronic
1023152846 7:37218167-37218189 CAATAATTTCATCTTTTTAAAGG - Intronic
1023463226 7:40423710-40423732 CTATATGTGTATGTTTTCACAGG + Intronic
1024353464 7:48391634-48391656 CAATATTTTCAACTTTTTATGGG + Intronic
1024926960 7:54627235-54627257 AAATATTTTCATATTTTTACTGG + Intergenic
1026550289 7:71362714-71362736 CCATTTGTGTATATTTTTACGGG + Intronic
1030038450 7:105428357-105428379 CAATATATGCATATGTTTAGAGG - Intergenic
1032427218 7:131831839-131831861 CAACATCTGCATCTTTTTAGGGG + Intergenic
1032751590 7:134846835-134846857 GAAAATGGGCATCTTTTTCCTGG - Intronic
1033442977 7:141396619-141396641 TAATATCTGCATCTGTTCACAGG + Intronic
1034103161 7:148468611-148468633 CAATAAGTTCATCTTTGTTCTGG - Intergenic
1034697929 7:153070983-153071005 CAGTATCTGCATATCTTTACAGG + Intergenic
1039800330 8:40949080-40949102 CAATATCTTCATCTCTTTGCCGG - Intergenic
1041336554 8:56791212-56791234 CAATATCTTTGTCTTTTTACTGG - Intergenic
1042055519 8:64761004-64761026 CAACATTTGCGTCTTTTTAAAGG - Intronic
1046355908 8:113084793-113084815 AAATATGTGTATCTATTTTCAGG - Intronic
1048344113 8:133563676-133563698 CAAAATGTGCACCCTCTTACGGG - Intronic
1048483313 8:134822740-134822762 CTACATGTGCATATTTTCACAGG + Intergenic
1049565860 8:143338654-143338676 GATTTTGAGCATCTTTTTACAGG - Intronic
1051301155 9:15652401-15652423 CTATATGTGTATCCTTTTGCTGG + Intronic
1051906495 9:22101071-22101093 AAATAAATGCATCTCTTTACTGG - Intergenic
1052299274 9:26935058-26935080 CAATATATGCATTTTCTCACTGG - Exonic
1052337143 9:27331539-27331561 CAATGAGTGCTTCTTTTTCCTGG - Intronic
1052795009 9:32915540-32915562 CAGTATCTTCATCTTTTTTCAGG - Intergenic
1053480360 9:38412274-38412296 CATTATGGTCTTCTTTTTACAGG + Intronic
1056681585 9:88724055-88724077 CAAGATTTCCATCTTTTTAAAGG + Intergenic
1057560355 9:96123308-96123330 CAGTTTGTGCATCTGTTTAATGG - Intergenic
1058539343 9:105995334-105995356 TAATATGTGCATCTTGTTTTAGG + Intergenic
1058974361 9:110112278-110112300 CAAGATGTGCTTCTTTATAGTGG + Intronic
1186172724 X:6894314-6894336 CAATACCTGCATCCCTTTACTGG - Intergenic
1186884695 X:13901628-13901650 AAATATGTGCTTCCTTGTACTGG + Intronic
1188246211 X:27838834-27838856 GAATATGTACATCTTTGTCCAGG - Intergenic
1190816183 X:53931827-53931849 CAATATTTGAATCTTTTTTAAGG - Intergenic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1192711386 X:73593800-73593822 CAATTTTTGGATCATTTTACTGG + Intronic
1193660922 X:84257384-84257406 AAATTTGTACATCTTGTTACAGG + Intergenic
1195528776 X:105926811-105926833 GAATATGTGGATCTATTTATGGG + Intronic
1196227654 X:113185692-113185714 CAAACTGTGCATCTTTTTAAAGG - Intergenic
1197190681 X:123644310-123644332 TAATATGTGCATCATATTATGGG - Intronic
1197600219 X:128519167-128519189 CAATACTTGGATCATTTTACTGG - Intergenic
1198391294 X:136177535-136177557 TAATTTGTTCATCTGTTTACAGG + Intronic
1201477613 Y:14400189-14400211 CAAAATGTGCATGTGTTTGCTGG - Intergenic