ID: 1155202664

View in Genome Browser
Species Human (GRCh38)
Location 18:23530930-23530952
Sequence CTAAGGGTTTTAAAGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155202657_1155202664 2 Left 1155202657 18:23530905-23530927 CCAGGAATAAGACGGCAAATGGT 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1155202664 18:23530930-23530952 CTAAGGGTTTTAAAGGGTCTGGG 0: 1
1: 1
2: 1
3: 31
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155202664 Original CRISPR CTAAGGGTTTTAAAGGGTCT GGG Intronic
900055938 1:630704-630726 CTGAGGGCTTTGAAGGCTCTTGG - Intergenic
900428489 1:2591362-2591384 CTAAGGGCATTTAAGGGTTTAGG - Exonic
900823845 1:4910705-4910727 CTAAGGGTTTTTGAAGCTCTGGG + Intergenic
900828128 1:4942874-4942896 CTAAGGATATTTAAGGGTTTAGG + Intergenic
901861248 1:12076007-12076029 CTAAGGGTATTTAAGGGTTCTGG - Intronic
909146469 1:71939782-71939804 CTAATGGTTTAAAAGGGTTTCGG - Intronic
909598457 1:77434250-77434272 CTAAGAGTTTTATATGATCTTGG + Intronic
909765844 1:79354927-79354949 CTAAGGGTTTTAATTGGATTTGG - Intergenic
910985035 1:92997063-92997085 CTAATGGTTAGAAAGGGACTTGG - Intergenic
913035782 1:114964487-114964509 CTAGGGTTTTTAATGGGTTTAGG + Intronic
915115839 1:153598959-153598981 CTAGGGGGTTTAAGGGCTCTGGG - Intergenic
915531315 1:156503761-156503783 GGAAGGGTAATAAAGGGTCTAGG + Intergenic
918658065 1:187053834-187053856 CTAAGGGTATTTAAGGGTTCAGG + Intergenic
919020643 1:192100992-192101014 CTAAGGGTATTTAAGGGTTCAGG + Intergenic
920742978 1:208598782-208598804 CAATGGGTTTTAAAGGGATTTGG + Intergenic
921741845 1:218694473-218694495 CTAAGGGTTTTTCAGCGTCATGG + Intergenic
922816897 1:228455739-228455761 TTAAGGTTTTTGCAGGGTCTGGG - Intergenic
922976391 1:229787277-229787299 CTAAGGGTATTTAAGGGCTTAGG + Intergenic
923682755 1:236131938-236131960 CTAAGAGTTTCAAAGGTTTTAGG - Intergenic
923866129 1:237941413-237941435 CTAAGGGCTTTGAAGGTCCTTGG + Intergenic
1062972721 10:1661086-1661108 CTAAGGGTATTTAAGGGTTTAGG - Intronic
1063532067 10:6842793-6842815 CTAAGGATATTTAAGGGTTTAGG - Intergenic
1064128563 10:12686884-12686906 CTAAAGGTTTTTATGGATCTGGG - Intronic
1066271445 10:33828204-33828226 CTATAGTTTTTAAAGGGTTTCGG + Intergenic
1067320321 10:45213464-45213486 CTAAGAGTTTTTATGGGTGTTGG - Intergenic
1069084124 10:64119847-64119869 CCCAGGGTTTTCATGGGTCTTGG + Intergenic
1069584943 10:69593277-69593299 CTAAGGGCTTTGAAGGCTCTTGG + Intergenic
1073495222 10:103884792-103884814 CTTAGGGTTGGAAAGGGCCTTGG - Intronic
1076796077 10:132799117-132799139 CAAAGGGGTTTACTGGGTCTGGG - Intergenic
1078515534 11:12018876-12018898 CTGAGGGTTTTGAGGGGTCAGGG - Intergenic
1078515616 11:12019548-12019570 CAAAGGGTTATGGAGGGTCTTGG + Intergenic
1079283132 11:19105901-19105923 CTATGGGTTTTAAGGAGGCTTGG + Intergenic
1079763086 11:24355762-24355784 CTGGTGCTTTTAAAGGGTCTTGG - Intergenic
1081411050 11:42759047-42759069 GTAAGGGTTTTAGTGGGTGTGGG - Intergenic
1081643881 11:44776880-44776902 CTGAGTGTTTTAAAGGGATTGGG + Intronic
1081963401 11:47154710-47154732 CTAAGGGGTTTAAAGGGTCTTGG - Intronic
1085803601 11:79613962-79613984 GTAAGGGATTTAAAGGCTCATGG - Intergenic
1086438547 11:86805388-86805410 CTAAAGGTTTTAAGTGGACTAGG - Intronic
1087525099 11:99298946-99298968 TTAAGGGTATTTAAGGGTTTAGG - Intronic
1087658673 11:100959204-100959226 CTAATTTTTTTAAAGGGTTTTGG - Intronic
1087880145 11:103406171-103406193 CTAAGGGCTTTGAAGGCTCTTGG + Intronic
1088682059 11:112251940-112251962 CAAAGGGTTTTAAAGGGATTGGG - Intronic
1089109185 11:116041513-116041535 CTAGGGCTTTTAAAGGGTCTGGG + Intergenic
1090135209 11:124190748-124190770 CTAAGAGTATTTAAGGGTTTAGG - Intergenic
1091067473 11:132529652-132529674 CAAAGATTTTAAAAGGGTCTGGG - Intronic
1092172604 12:6383438-6383460 CTAAGGGGTTTGAAGGTTCATGG + Intronic
1095656149 12:44671828-44671850 CTATGGCTTTCAGAGGGTCTGGG - Intronic
1096479679 12:51930642-51930664 CTAAGAGTTGTCAAGGGTGTGGG + Intergenic
1099481146 12:83168130-83168152 GTAAGGGTTATACAGGCTCTCGG + Intergenic
1100287194 12:93178198-93178220 CTAAGAGTATTTAAGGGTTTAGG - Intergenic
1102227372 12:111238170-111238192 CTAAGCGTTGTAAAAGGTCCTGG - Intronic
1102409332 12:112703764-112703786 CTAGGGTTTTTAAAGGTTTTGGG - Intronic
1102987389 12:117289682-117289704 CTAAGAGTATTTAAGGGTTTAGG + Intronic
1103132354 12:118480325-118480347 CTAAGGGTATTTAAGGGTTCAGG + Intergenic
1103836824 12:123828410-123828432 CTAAGAGTTTTTAAGGATTTAGG + Intronic
1103968311 12:124654008-124654030 CTAAGGGTGTCATAGGGTCTAGG + Intergenic
1104406395 12:128520791-128520813 CTAAGAGTTTTTAAGGATTTAGG + Intronic
1105323151 13:19346354-19346376 CTCAGGGTTTTAGAGGGCATAGG + Intergenic
1106289626 13:28348605-28348627 ATGAGGGTTTTAAAGAGTTTAGG + Intronic
1106663472 13:31826830-31826852 GCAAGGGTTTTTAAGGGTTTTGG - Intergenic
1108737030 13:53294908-53294930 GTTAGGGTTTTTAAGGGTTTTGG + Intergenic
1109991714 13:70067443-70067465 CTAAGGGTTACATAGGGACTTGG + Intronic
1110100833 13:71598962-71598984 CTAACTTTTTTAAAGTGTCTAGG + Intronic
1110264416 13:73521461-73521483 GTAAGGGCTTCAGAGGGTCTGGG + Intergenic
1111594554 13:90395215-90395237 CTAAGGGTTGCAATGGGTGTGGG - Intergenic
1112636939 13:101226337-101226359 CTAAGGGTATTTAAGGGTGTAGG - Intronic
1117039773 14:51759325-51759347 CTAATGTTTTTAAAATGTCTCGG - Intergenic
1121191375 14:92033756-92033778 CTAAGAGTTTTTAAGGATTTAGG + Intronic
1121656142 14:95597242-95597264 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
1122646696 14:103199230-103199252 CCAAGGGTTTTAGATGCTCTTGG + Intergenic
1122767931 14:104084665-104084687 CTAAGGATCTTTAAGGGTTTAGG + Intergenic
1124199214 15:27662809-27662831 CTAAGAGTTTTTAAGGGTTCAGG + Intergenic
1127500303 15:59548570-59548592 CTAAGGGTATTTAAGGGTTTAGG - Intergenic
1130017522 15:80199391-80199413 CTGAGGGTTCTAAAGTGTGTCGG + Intergenic
1133381426 16:5334083-5334105 CTAAGAGTATTTAAGGGTTTAGG + Intergenic
1134855375 16:17514372-17514394 CTTAGGGTTTTTAAGGGTTTTGG + Intergenic
1135158691 16:20074658-20074680 CTGCGTGTTTTCAAGGGTCTGGG - Intergenic
1135722714 16:24830955-24830977 CACAGGGTCCTAAAGGGTCTTGG - Intergenic
1135902028 16:26469359-26469381 CTAAGAGTTTTTAAGGATTTGGG + Intergenic
1135915199 16:26599359-26599381 GTAAGCGTTTTTAAGGGTTTTGG + Intergenic
1136715940 16:32281410-32281432 CTGAGTCTTTTTAAGGGTCTGGG - Intergenic
1136751972 16:32648355-32648377 CTGAGTCTTTTTAAGGGTCTGGG + Intergenic
1136822616 16:33332111-33332133 CTGAGTCTTTTTAAGGGTCTGGG - Intergenic
1136829179 16:33388650-33388672 CTGAGTCTTTTTAAGGGTCTGGG - Intergenic
1136834245 16:33487432-33487454 CTGAGTCTTTTTAAGGGTCTGGG - Intergenic
1137224970 16:46494871-46494893 CTAAGGGTTTTTATGGTTTTAGG - Intergenic
1140016692 16:71194048-71194070 TTAAGTGTGTTAAAGGATCTGGG - Intronic
1140755790 16:78065473-78065495 CTAAGGATATTTAAGGGTTTAGG + Intronic
1141197378 16:81870313-81870335 CTGAGGGTTTGAAAGGGTCAAGG + Intronic
1141781383 16:86163955-86163977 CTGACGGTTTTAAATGATCTCGG + Intergenic
1203010671 16_KI270728v1_random:237088-237110 CTGAGTCTTTTTAAGGGTCTGGG + Intergenic
1203054114 16_KI270728v1_random:908341-908363 CTGAGTCTTTTTAAGGGTCTGGG + Intergenic
1142537289 17:627428-627450 CTCATGGTTTTAAAGAATCTAGG + Intronic
1144387954 17:14767314-14767336 ATATGGCATTTAAAGGGTCTAGG + Intergenic
1144813349 17:18016351-18016373 CCATGGGTTTTAAAGTCTCTGGG - Intronic
1147552197 17:41451406-41451428 CTAAGGATATTTAAGGGTTTAGG - Intergenic
1148188617 17:45662904-45662926 CTAGGGTTTTTAAAGGATTTTGG + Intergenic
1149941311 17:60870417-60870439 CTAAGGGATCAAAAGGGTCTCGG + Intronic
1150200254 17:63348407-63348429 ATAAGGATTTTAAAGGGCTTGGG + Intronic
1152156790 17:78639009-78639031 TTCAAGCTTTTAAAGGGTCTGGG - Intergenic
1153163612 18:2237784-2237806 CTAAGGGTATGTAAGGGTCTGGG + Intergenic
1155202664 18:23530930-23530952 CTAAGGGTTTTAAAGGGTCTGGG + Intronic
1155572938 18:27215265-27215287 CTAACAGTTTTAAAAGGTTTTGG - Intergenic
1155818332 18:30344395-30344417 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
1156668352 18:39436235-39436257 ATAAAGGTTTACAAGGGTCTGGG - Intergenic
1156984859 18:43338188-43338210 CTAAGAGTTTTTAAGGATTTCGG + Intergenic
1159367802 18:67492137-67492159 CTAATGGTTTTTAAGGGGTTAGG + Intergenic
1163342310 19:16717001-16717023 GTTAGGCTTTTAAAGAGTCTGGG - Intergenic
1167727151 19:51224134-51224156 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
925257994 2:2506428-2506450 CTAAGGGTATTTAAGGGTTTAGG + Intergenic
925599568 2:5594086-5594108 CTCAGGGTTTTTAAGGGTGAGGG - Intergenic
926113850 2:10198765-10198787 CTAAGGGTATTTAAGGGTTTAGG + Intronic
926114296 2:10202509-10202531 CTAAGGGTATTTACGGGTTTAGG + Intronic
927504933 2:23606789-23606811 CTAAGGGTGTCTAAGGGACTAGG - Intronic
928583026 2:32727925-32727947 ATAAGAGTTTAAAGGGGTCTTGG + Intronic
928699560 2:33884768-33884790 CTGATGGTTGTAAAGTGTCTTGG + Intergenic
928904292 2:36355087-36355109 TTAAGTGCTTTAAACGGTCTTGG - Intergenic
933379594 2:81525978-81526000 ATAAGGGTTTTAAATAATCTTGG + Intergenic
933438871 2:82283992-82284014 CTAAGGTTTGTAACTGGTCTTGG + Intergenic
936861527 2:117026138-117026160 CTAAGGGCTTTGAAGGCCCTTGG - Intergenic
936867177 2:117087973-117087995 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
937648380 2:124292223-124292245 CTAAGGGTCTTAAAGATACTGGG - Intronic
937777706 2:125799412-125799434 CTAAGGGTTTTATTGTTTCTGGG - Intergenic
938446501 2:131384416-131384438 CTAAGAGCTTTGAAGGCTCTTGG + Intergenic
939120825 2:138114227-138114249 ATAAGGGTATTTAAGGGTATAGG - Intergenic
939249364 2:139665300-139665322 TTAAAGGTTTTTAAGGCTCTGGG + Intergenic
939292824 2:140217594-140217616 CTAAGGGCTTTGAAGGCCCTTGG + Intergenic
940197877 2:151115831-151115853 CTAACGGTTTTAAAAGGATTAGG - Intergenic
940424491 2:153515003-153515025 CTAAGGGTTTTTAAGTGTTTTGG + Intergenic
941081925 2:161071654-161071676 CTGAGGAATTTAAAGTGTCTTGG - Intergenic
944591343 2:201220589-201220611 CTAAGAGTTTTTAAGGATTTAGG - Exonic
945326777 2:208491527-208491549 CTAAGAGTTTTTAAGGGTTCAGG + Intronic
945594778 2:211777882-211777904 CTAAGGGCTTTGAAGGCCCTTGG - Intronic
945742703 2:213682549-213682571 CTAAGGGTATTTAAGCGTTTAGG + Intronic
947172162 2:227322824-227322846 CTAAGAGTATTTAAGGGTTTAGG + Intergenic
947463485 2:230322639-230322661 CTAAGGGTATCTAAGGGTTTAGG - Intergenic
948206814 2:236167048-236167070 CGAAGGGGTTTAAAAAGTCTGGG + Intronic
948474044 2:238205063-238205085 CTAAGGATATTTAAGGGTTTTGG + Intergenic
1169286534 20:4312276-4312298 CTAAGAGTTTTTAAGGATTTGGG - Intergenic
1170405032 20:16026685-16026707 CTAAGGGGTTTAATTGGACTGGG + Intronic
1173359404 20:42327528-42327550 CTAAAGGTTTTGAAGCGTCATGG + Intronic
1174582095 20:51579360-51579382 CTTAGGGATTTAAAAGGACTGGG + Intergenic
1175239495 20:57536386-57536408 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
1176153119 20:63603398-63603420 CCTAAGGTTTTAAAGGTTCTAGG + Intronic
1177702169 21:24653611-24653633 CTAAGGGCTCTAAGGGGTCGGGG + Intergenic
1179583529 21:42360455-42360477 CTCAGGGTTATTAAGGCTCTAGG + Intergenic
1181592202 22:23892432-23892454 CTAAGGATATTTAAGGGTTTTGG + Intronic
1181595578 22:23912385-23912407 CTAAGGATATTTAAGGGTTTTGG - Intergenic
1181612984 22:24031402-24031424 CCAAGGGTTGTAAAGGATCAGGG + Intronic
1183258428 22:36778083-36778105 CTAAGAGTATTTAAGGGTTTAGG - Intergenic
1183775787 22:39964057-39964079 TCAAGAATTTTAAAGGGTCTCGG - Intronic
1184608648 22:45588616-45588638 CCAAGGGGTTAAAAGGGGCTGGG + Intronic
949220597 3:1629284-1629306 TTCAGGATTTTAAATGGTCTAGG - Intergenic
950690874 3:14656392-14656414 TTAACGTTTTTAAAGGGTCCAGG + Intronic
954497601 3:50979480-50979502 CTCTGGGTGTTAAAGAGTCTGGG + Intronic
955240262 3:57171503-57171525 CTAGGGTTTTTAATGAGTCTTGG - Intergenic
959121517 3:102238490-102238512 CCAATGGCTTTAAAGGATCTGGG + Intronic
963333409 3:143943166-143943188 GTAAGGCTTTTGAAGGCTCTGGG - Intergenic
964524831 3:157607226-157607248 CTATGTTTTTTAAAGGTTCTTGG - Intronic
965770074 3:172172649-172172671 GTAAGGTTTTTAAAGAATCTGGG - Intronic
966434712 3:179870414-179870436 GCTAGGGTTTTTAAGGGTCTTGG - Intronic
970410321 4:15800134-15800156 CTAAGAGTTTTTAAGGATTTAGG - Intronic
971127968 4:23775194-23775216 CTCAGGGTTTTCAAGGGAATTGG - Intronic
971540763 4:27813749-27813771 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
971616687 4:28799802-28799824 TTAAGGGTATTTAAGGGTTTAGG + Intergenic
973856980 4:55021346-55021368 CTATGGGTTTAAGAGGGCCTGGG + Intergenic
974080850 4:57211087-57211109 CTAAGGATTTTCCAGGGCCTGGG + Intergenic
974249337 4:59363548-59363570 CTAAGGGTTTTGAAGGTCCATGG + Intergenic
975601657 4:76106472-76106494 CTAAGAGTTTTTAAGGATTTAGG + Intronic
976268603 4:83208015-83208037 CTAAGGGTATTTAAGGGTTTAGG - Intergenic
979084381 4:116388374-116388396 CTAAGGGTATTGAAGGGTTTAGG - Intergenic
982443325 4:155461591-155461613 CTAAGGGCTTTGAAGGTTCTTGG + Intergenic
982901870 4:161015464-161015486 CCTAGAGTTTTCAAGGGTCTGGG + Intergenic
982949342 4:161669805-161669827 CTAAGGTTTATAAATGGTCTTGG - Intronic
983570491 4:169202746-169202768 CTAAGGGATTCAAAGGGGTTAGG - Intronic
983833814 4:172365148-172365170 CTAAGAGTATTTAAGGGTTTAGG + Intronic
984387888 4:179087152-179087174 CTAAGGGCTATGAAGGGTATAGG - Intergenic
984493307 4:180464201-180464223 TTAATATTTTTAAAGGGTCTTGG - Intergenic
987871060 5:23617375-23617397 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
989115397 5:37947824-37947846 CTATGGGTTTCAAAGGATGTGGG + Intergenic
989344705 5:40416903-40416925 CCAAGGATTTTAAAGGTTTTGGG + Intergenic
994930221 5:106173181-106173203 CTTAGGGTATTTAAGGGTTTAGG - Intergenic
995468171 5:112472283-112472305 CTTAGGGTCATAAAGGATCTTGG + Intergenic
996633889 5:125667427-125667449 CTAAGGGTATTTAAAGGTTTAGG + Intergenic
996918718 5:128741819-128741841 CTAAGGGGTATACAGGGTCAAGG + Intronic
996937312 5:128964519-128964541 CTAAGGATTCTAAAGGGAGTGGG - Intronic
997029505 5:130109152-130109174 TTAACGGTTTTAAAGTTTCTTGG - Intronic
997319912 5:132969354-132969376 AAAAGGGTTTTAAAGAGTCTGGG + Intergenic
998258713 5:140611156-140611178 CTAAGAGTTTTTAAGGGTTCAGG + Intergenic
998259623 5:140619656-140619678 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
1001211449 5:169813616-169813638 TTAAGGGTTCTCAAGGGACTTGG + Intronic
1001352469 5:170982101-170982123 CTAAGAGTTGTAAAGTGTCTAGG - Intronic
1003938283 6:10998056-10998078 CTAATTGTTTGAAAGAGTCTGGG + Intronic
1006243583 6:32708651-32708673 CTAAGAGTATTTAAGGGTTTGGG - Intergenic
1009864439 6:69378778-69378800 CCAAGTATTTTAAATGGTCTAGG + Intronic
1010479126 6:76328233-76328255 CTAAGGGTATTTAAGGGGTTAGG - Intergenic
1011630593 6:89320207-89320229 CTAAGGATATTTAAGGGTTTAGG - Intergenic
1011858666 6:91727129-91727151 CTAAGGGCTTTGAAGGTTCTCGG + Intergenic
1012832687 6:104225565-104225587 CTAAGGTATTTAAAGGGCTTAGG - Intergenic
1014957824 6:127642898-127642920 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
1017302606 6:152879844-152879866 CTAAGGATTGTAAAGGGTCATGG + Intergenic
1018932838 6:168253148-168253170 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
1020586992 7:10080670-10080692 CTAAGAGTTTTTAAGGGTTCAGG - Intergenic
1020842649 7:13239322-13239344 CTAAGGATTTTTAAGGATTTTGG - Intergenic
1023735234 7:43230086-43230108 CTGATGGTTTTTAAGGGTATAGG - Intronic
1023907302 7:44531727-44531749 CTAAGGGTTGAGAAGGGCCTGGG + Intronic
1025731287 7:64110502-64110524 CTAAGAGCTTTGAAGGCTCTTGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026136255 7:67663914-67663936 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
1026146949 7:67754715-67754737 CTAAGGGTATTTAAGGGTTTAGG + Intergenic
1026328743 7:69333962-69333984 CTAAGGGCTTTGAAGGCTCTTGG + Intergenic
1029597977 7:101547579-101547601 CCAAGGGGTTCAAAGGGGCTGGG + Intronic
1032258088 7:130312778-130312800 CTAAGGGTATTTAAGGGTTTAGG + Intronic
1033220145 7:139522392-139522414 CTAAGAGTTTAAAAGGGGCCGGG + Intergenic
1033487192 7:141802422-141802444 CTAAGGGCTTTGAAGGTCCTTGG + Intergenic
1034746483 7:153528130-153528152 CTAAGGGAATTTAAGGGTTTAGG + Intergenic
1034922540 7:155095735-155095757 CTAAGGATATTTAAGGGTTTTGG - Intergenic
1035215894 7:157366451-157366473 TTAAGGGTTTAAAAGGAACTTGG + Intronic
1035770247 8:2141550-2141572 CTAAGGGTATTTAAGGGTTCTGG + Intronic
1036992045 8:13608711-13608733 CTAAAAGTTTTAAAGGTTCTGGG + Intergenic
1037017990 8:13932289-13932311 CTAAGGGTTACAGAGGGACTTGG - Intergenic
1039004338 8:33017069-33017091 CTAAGGGCTTTGAAGGCCCTTGG - Intergenic
1041368202 8:57131367-57131389 CTAAGGGTTGAAGACGGTCTGGG + Intergenic
1041683036 8:60612484-60612506 AAAAGGGTTTTAAAGGATGTAGG + Intronic
1042463809 8:69103029-69103051 CTAAGGGCTTTGAAGGCTCTTGG + Intergenic
1046339121 8:112828422-112828444 CTGATGGTTTTAAAGTGTGTGGG + Intronic
1050386461 9:5096284-5096306 CTAAGGGTTTTGAAGGTCCCTGG - Intronic
1052433134 9:28392823-28392845 CCAAGGGTTTTAGAAGCTCTAGG + Intronic
1054973137 9:71112517-71112539 CAAATGGTATTATAGGGTCTTGG - Intronic
1057117477 9:92539558-92539580 CTAAGGGCTTTGAAGGCTCTTGG + Intronic
1060455853 9:123795611-123795633 CTTTGAGTTTTAAATGGTCTGGG + Intronic
1202629588 M:5534-5556 CTGAGGGCTTTGAAGGCTCTTGG - Intergenic
1185620134 X:1449124-1449146 CTAAGGGTATTTAAGGGTTTAGG - Intronic
1185656613 X:1690608-1690630 CTAAGAGTTCTTAAGGGTTTAGG + Intergenic
1188810820 X:34652516-34652538 CTAAGGGATTTGATGGGTGTGGG - Intronic
1196914021 X:120513415-120513437 GTTAGGGTTTTAAAGGGTTTTGG - Intergenic
1198931605 X:141867488-141867510 CTAAGAGTTTTTAAGGATTTAGG - Intronic