ID: 1155202887

View in Genome Browser
Species Human (GRCh38)
Location 18:23533034-23533056
Sequence CCTTCATCTCAGTGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155202887 Original CRISPR CCTTCATCTCAGTGGCAGGG AGG Intronic
902259640 1:15215072-15215094 CCATCATGTCAGTGGGAGGAGGG - Exonic
905544739 1:38788627-38788649 CCTTCCTCTCAATAGCAGAGGGG - Intergenic
905970480 1:42138099-42138121 CCCTCAGCTCTGTGCCAGGGAGG + Intergenic
908436004 1:64106970-64106992 GCTACTCCTCAGTGGCAGGGTGG - Intronic
910208991 1:84774983-84775005 CCTTCATCTGAGAGGCAGTGTGG + Intergenic
912520256 1:110240249-110240271 CCTTGGTGTCAGTGGCAGGCTGG - Intronic
913119696 1:115728451-115728473 CCCTCTTCTCAGGGGTAGGGGGG + Intronic
915283494 1:154838405-154838427 CCTTCATCCCAGAGGCTGTGGGG - Intronic
916585430 1:166145521-166145543 CCTGCCTCTCAGTTGCATGGAGG + Intronic
916789974 1:168116511-168116533 TCTTTATCTCAGTTACAGGGTGG - Intronic
917506725 1:175634157-175634179 TGTTTATATCAGTGGCAGGGAGG + Intronic
919876214 1:201870755-201870777 CCCTCATCTCCAAGGCAGGGCGG + Exonic
920517943 1:206600360-206600382 CCCTCCTCTCAGTGTCAGGCAGG - Intronic
920802696 1:209204326-209204348 GCATCATCTCAGTGGCCGGTTGG - Intergenic
920819460 1:209366824-209366846 CCTTTCTCTAAGAGGCAGGGTGG - Intergenic
923047192 1:230363987-230364009 CCTTCATCTCAGCCACAAGGGGG - Intronic
923329149 1:232906614-232906636 CCTTCCTCACAGTGTCAGGCTGG + Intergenic
923484445 1:234415576-234415598 CCTTCTTGTTAGTGGCAAGGAGG - Intronic
923778577 1:237001434-237001456 TCTTCATCTCATTGCCAGTGAGG + Intergenic
924312810 1:242763406-242763428 CTTTCATCTCAGTGACATAGTGG - Intergenic
1062818993 10:519902-519924 CCCACGTCTCAGTGGCTGGGTGG - Intronic
1063218338 10:3943916-3943938 CTGTCATCACAGTGGCAGGAAGG + Intergenic
1068789543 10:61012209-61012231 CCTATATCTCAGTGGAAGGGAGG - Intergenic
1068843010 10:61637157-61637179 CCCTCATGTAAGTGGCAGAGTGG + Intergenic
1069511816 10:69048146-69048168 CCTCTCTCTGAGTGGCAGGGTGG + Intergenic
1071567903 10:86681034-86681056 ACTTCATCTCACTGGCAGTGTGG + Intronic
1073192063 10:101658535-101658557 ACTTCGTCTGGGTGGCAGGGGGG + Intronic
1074052553 10:109893400-109893422 CCTAAATGTCAGTGGCAAGGAGG - Intronic
1074630439 10:115248795-115248817 CCATCATTTCAGGGGCAGGTGGG + Intronic
1074997141 10:118767305-118767327 CCTACATTTCAGTGCCAGGAAGG - Intergenic
1075648042 10:124109357-124109379 CCTTCAGATGAGTGTCAGGGTGG - Intergenic
1076351392 10:129817045-129817067 CCTTCAACACAGGAGCAGGGTGG - Intergenic
1077856094 11:6127433-6127455 CATTCTTCTCAGAGGCAGTGAGG + Intergenic
1078583247 11:12556915-12556937 CATTCATCTCCTTGGCTGGGAGG - Intergenic
1080258751 11:30323094-30323116 CCGTCCTCTCAGTGGTAGCGCGG + Exonic
1081643426 11:44773920-44773942 GCTTCATCTCAGAGGCAGTTTGG + Intronic
1083295426 11:61712752-61712774 CCTTCTTCCCAGTGGCCGAGAGG - Intronic
1083540486 11:63508708-63508730 CAGAGATCTCAGTGGCAGGGAGG - Intronic
1084297834 11:68224721-68224743 CCTGCACCTGAGTGGCATGGAGG - Intergenic
1084972350 11:72778773-72778795 CCTGCATCCCAGGGGCAGGAGGG + Intronic
1088829029 11:113519600-113519622 CCTTCATCTTCAGGGCAGGGAGG - Intergenic
1088902258 11:114127148-114127170 CCTTCATCTCAGCGTGATGGTGG + Intronic
1090400820 11:126447258-126447280 CCTCCATCCCAGTGGCGGGCAGG + Intronic
1091321941 11:134657831-134657853 TCTTCAACTCAGTGACAGGGAGG + Intergenic
1092547982 12:9468065-9468087 CCTTCTTCTTAGTGGAATGGGGG + Intergenic
1092658219 12:10710042-10710064 ACTGCCTATCAGTGGCAGGGGGG + Exonic
1097021123 12:56021470-56021492 TCTGCGTCTCAGTGGCAGGCAGG - Exonic
1099028549 12:77495892-77495914 ACTTCATCTCTGTGTCAGAGGGG - Intergenic
1099514743 12:83584252-83584274 ACTTCAAATCAGTGGGAGGGAGG + Intergenic
1100672060 12:96824199-96824221 TCTTCATCTCTGTGGCAGCAAGG + Intronic
1105402839 13:20110845-20110867 CCTTCAGCTGACTGGCAGGGTGG - Intergenic
1105805148 13:23948108-23948130 CCTGCAGGCCAGTGGCAGGGTGG - Intergenic
1107368811 13:39718330-39718352 ACTACATCTTAGTGGCAGGTAGG - Intronic
1110672916 13:78203417-78203439 GCTTCGTCTCAGTGGGAAGGAGG + Intergenic
1111033169 13:82633659-82633681 ACTGCATCCAAGTGGCAGGGAGG + Intergenic
1112192504 13:97191774-97191796 GCTTCTTCTCATTGGCAGGGTGG - Intergenic
1113335208 13:109370531-109370553 CCTTCATCTCATAGGAAGGGTGG + Intergenic
1114141501 14:19916361-19916383 CCTTCATCTCAGTGTCATGTAGG + Intergenic
1114448871 14:22811337-22811359 GCTTCTTCACAGTTGCAGGGTGG + Intronic
1117463826 14:55972806-55972828 CCTTCAACTCAGTGTCTGAGGGG - Intergenic
1122243917 14:100387764-100387786 CCTTATTCTCAGAGGCAGGAGGG - Intronic
1123069434 14:105635168-105635190 CATTCGTCTCAGGGGCAGGAGGG - Intergenic
1127183318 15:56449229-56449251 TCTTCTTCTCAGTGTCAGAGGGG + Intronic
1127359513 15:58232520-58232542 CCTTCATGTGAGTGGCACGAAGG + Intronic
1127623109 15:60753290-60753312 CTTTCATCTCTGTTACAGGGTGG + Intronic
1127638383 15:60892614-60892636 CCTACACCTCTGTGTCAGGGAGG + Intronic
1128159876 15:65416634-65416656 CCTCCCTCTCAGTGCCGGGGTGG + Intronic
1129892656 15:79081760-79081782 CCATCCTCCCAGTGCCAGGGAGG + Intronic
1130047153 15:80454222-80454244 CCCTGATCTCAGTGACAGGGTGG + Intronic
1131196849 15:90362445-90362467 CCTTCAGCTAAATGCCAGGGAGG - Exonic
1132533385 16:465098-465120 GCTTGGTCTCAGTCGCAGGGAGG + Intronic
1133544603 16:6793451-6793473 CCTTCATCTCAGTGTCTCAGTGG + Intronic
1135470565 16:22725931-22725953 CCTTCTTCCCATTGGCTGGGAGG - Intergenic
1135704447 16:24662694-24662716 CCTTCATCTTATTTGCAGAGAGG + Intergenic
1136089110 16:27905730-27905752 CATTCATCTTGGTGGCAGGGCGG + Intronic
1137536929 16:49334320-49334342 CCATCCTCTTGGTGGCAGGGTGG + Intergenic
1137717206 16:50605158-50605180 CCTGCATCTAAGTGGCTAGGAGG - Intronic
1138202518 16:55100769-55100791 ACCCCACCTCAGTGGCAGGGGGG + Intergenic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1143971481 17:10799149-10799171 TCCTCATCTCTGGGGCAGGGTGG + Intergenic
1146011114 17:29195550-29195572 CTTTCATCTCAGTTGCAAGGAGG - Intergenic
1146560158 17:33861649-33861671 CCTTCCTCTCAGAGGCAGAAAGG - Intronic
1147135055 17:38429381-38429403 CCTTCAACTTAGGAGCAGGGAGG - Intronic
1147160337 17:38565977-38565999 CCTTCATCCCAGCTGAAGGGCGG + Intronic
1148913126 17:50953982-50954004 CCCTGAGCTGAGTGGCAGGGAGG - Intergenic
1150625131 17:66836484-66836506 CAGGCATCTCAGTGGCAGGTTGG + Intronic
1151387699 17:73765074-73765096 CCTTCCTCTCAGGGTCATGGTGG - Intergenic
1151850058 17:76684845-76684867 CCTTCTGGTCAGTGCCAGGGAGG + Intronic
1152737651 17:82005221-82005243 GCCTCTGCTCAGTGGCAGGGTGG + Intronic
1153656651 18:7288830-7288852 TCTTCATCCCAGTGACAGGGTGG - Intergenic
1154268832 18:12901776-12901798 CCTCTTTCTCAGTGGTAGGGAGG - Intronic
1155202887 18:23533034-23533056 CCTTCATCTCAGTGGCAGGGAGG + Intronic
1156470387 18:37374100-37374122 CTGTGATCTCAGTGGCTGGGCGG - Intronic
1157223021 18:45840558-45840580 CCTTCAGCAGAGTGCCAGGGGGG - Intronic
1157364112 18:47047961-47047983 CCCTAATCTCAGTGACTGGGAGG - Intronic
1160865078 19:1252787-1252809 CCTACATCGCGGGGGCAGGGCGG + Intronic
1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG + Intronic
1163369371 19:16893475-16893497 CCTTGATCTCACAGGCAGCGAGG + Intronic
1163406995 19:17128982-17129004 CCTTCATCTCAGTGCCTGCATGG + Intronic
1163763718 19:19150850-19150872 TCTTCCTCTCAGTGGCTGGCAGG - Intronic
925466401 2:4110473-4110495 CCTGCCTGTCAGTGGCACGGTGG + Intergenic
925851546 2:8086837-8086859 CCCTCATCTCAGATGCAGTGGGG + Intergenic
927077937 2:19598728-19598750 CCATCATCTCTAAGGCAGGGTGG + Intergenic
927440752 2:23115246-23115268 CCTTTACTTCAGGGGCAGGGTGG + Intergenic
927868061 2:26605546-26605568 CCTTCATCTCACTGCCTAGGAGG + Intronic
929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG + Intronic
931143029 2:59484719-59484741 CCTTTTTCTGCGTGGCAGGGAGG - Intergenic
931991829 2:67797852-67797874 GCTTCATCCAAGTGGCAAGGTGG + Intergenic
932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG + Intronic
938329788 2:130441526-130441548 CCTGCATCTCAGAGGGTGGGTGG - Intergenic
938360158 2:130679977-130679999 CCTGCATCTCAGAGGGTGGGTGG + Intergenic
938436561 2:131286684-131286706 CCTGCATCTCAGAGGGTGGGTGG + Intronic
938771126 2:134501841-134501863 CTAACATCTCAGTGACAGGGAGG - Intronic
939332565 2:140783837-140783859 CCTTCTTCTCAGTGTCCTGGGGG - Intronic
944104414 2:196063915-196063937 CTTTCATGTCAGGGGCAGGGTGG - Intronic
944433377 2:199660334-199660356 CCTTGATGTCAGTGGCCGCGTGG - Intergenic
945892870 2:215448775-215448797 CCCCAAACTCAGTGGCAGGGAGG + Intergenic
946462090 2:219877840-219877862 CCTGCAGCTCAGAGGCAGAGAGG - Intergenic
947793545 2:232880811-232880833 CCCCCATCACAGTGGGAGGGAGG - Intronic
1170775870 20:19374237-19374259 CCACCATCTCAGTGACAGGGTGG + Intronic
1172206538 20:33166727-33166749 CCTGGATCTCAGAGGCATGGTGG - Intronic
1172608556 20:36232085-36232107 CCTGCATCTCCGTAGAAGGGAGG - Exonic
1173564393 20:44028669-44028691 CCCCCATCTGAGTGCCAGGGAGG - Intronic
1176671701 21:9740731-9740753 CCTTCTTCTATGTGGCAGGCAGG + Intergenic
1177561144 21:22755807-22755829 CCTTCTTCACAGTGGCAGGAAGG + Intergenic
1179645038 21:42770456-42770478 CCCTCATCTCACGGGCACGGGGG + Intronic
1180043735 21:45293347-45293369 CCCTCGTCTCCATGGCAGGGTGG - Intergenic
1180713421 22:17855510-17855532 CCTCCACATCACTGGCAGGGCGG + Intronic
1180918547 22:19506327-19506349 CCATCATGTGCGTGGCAGGGTGG + Intronic
1182911131 22:33985517-33985539 ACTTTCTCTCTGTGGCAGGGAGG - Intergenic
1184094001 22:42306663-42306685 GCTCCATCCCAGTGGCATGGGGG - Intronic
1184190440 22:42891124-42891146 CCTTCATGTCCGAGGCAGAGAGG - Exonic
1185213810 22:49587251-49587273 CTATCCTCTCAGTGGCTGGGTGG - Intronic
950504122 3:13383406-13383428 CCTTGATGTCTGTGGCAGGAAGG + Intronic
953883201 3:46701923-46701945 CTTTGGTCTCACTGGCAGGGAGG + Intronic
955345911 3:58161758-58161780 CCTTCCTCTTGGTGGCAGGATGG + Intronic
955345917 3:58161781-58161803 CCTTCCTCTTGGTGGCAGGATGG + Intronic
956348658 3:68309892-68309914 CCTTTATGTCAGTGGGAAGGAGG + Intronic
956767613 3:72497114-72497136 CCTTCACCTCAGTGTCAAGAAGG - Intergenic
960940415 3:122929452-122929474 CCCTCAACTCAGCGGCAGGCAGG + Intronic
962288271 3:134106735-134106757 CCTTCATGCCAGGGGCATGGAGG - Intronic
962407193 3:135110428-135110450 CCTGCCTCTCAGTGGCAGTCAGG - Intronic
962847122 3:139282569-139282591 CCTTCCTCTCACTTGCTGGGTGG - Intronic
965392607 3:168123112-168123134 CCTACTTCTCAGTGCCAGGCAGG + Intergenic
965845124 3:172952588-172952610 TCTTCATCTAATTGGAAGGGAGG + Intronic
969054311 4:4392163-4392185 CCTTCATCCCATTGGGATGGGGG - Intronic
971539369 4:27796389-27796411 CCTCCATCTTAGTGCCTGGGAGG + Intergenic
971701122 4:29977836-29977858 CCTGCATCTCATTGGGAGAGAGG - Intergenic
976618702 4:87105643-87105665 CCTTCAGCTCAGTGACAGTGAGG + Exonic
977302422 4:95282733-95282755 CCTTCATCTGGGTGTCAGGCAGG + Intronic
982090475 4:151876035-151876057 CCATCATCTCAGTGGGGGGTGGG - Intergenic
982166507 4:152618193-152618215 TCTTCATCTCAGTTGCCGGAAGG + Intergenic
986522989 5:8641784-8641806 CGTGCATCTCAGTGGCATGATGG - Intergenic
986800485 5:11255261-11255283 CATGCATCTCAGTTGCAGTGAGG + Intronic
990132088 5:52598104-52598126 CCGTCATCTCATTTGCAGGGAGG + Intergenic
992546254 5:77816873-77816895 CCTTCCTGGCAGTGGCAGAGGGG - Intronic
995020292 5:107359793-107359815 AAGTCATCTCACTGGCAGGGAGG - Intergenic
996749606 5:126875388-126875410 CCTTCTTCACAGTACCAGGGAGG + Intronic
997612903 5:135227625-135227647 CCTTCCTGACAGTGGCAGGAGGG - Intronic
997673135 5:135692873-135692895 TCTTCAGCTCAGTGGAAGGCAGG - Intergenic
998401934 5:141852792-141852814 CCTTGATCTCAGGGGGTGGGAGG - Intergenic
999551205 5:152689227-152689249 CCTCCATCTCATTAGCAGGGTGG + Intergenic
1000243894 5:159433120-159433142 GCATTATCTCAGGGGCAGGGTGG + Intergenic
1000386807 5:160682382-160682404 CCACCAGCTCACTGGCAGGGAGG - Intronic
1001847367 5:174934040-174934062 CCCTCATCTCAGTGGTTGTGAGG - Intergenic
1002850614 6:993250-993272 GCTTCACCTCAGTGGCACTGGGG + Intergenic
1002905969 6:1449514-1449536 CCATCATCACACTGGCTGGGAGG + Intergenic
1003089310 6:3088327-3088349 CCTTCACCTCTGTGTCAGTGGGG - Intronic
1004737233 6:18419681-18419703 ACTTCAGTTGAGTGGCAGGGAGG + Intronic
1004845366 6:19636056-19636078 CCTTCATTTCATTAGCAGAGAGG - Intergenic
1005241702 6:23837595-23837617 CCTTCAACTCAGTGTCTGAGGGG + Intergenic
1007513557 6:42393394-42393416 CCTCCTTCTCAGGGGCAGAGGGG - Intronic
1007836814 6:44680352-44680374 CCCTTGTCTCAGTGGCAGGCTGG - Intergenic
1011392389 6:86868046-86868068 CCTGCATCTCTGTGGCATAGAGG + Intergenic
1011754040 6:90481154-90481176 CCTCCATCTGAGTTGCAGTGAGG + Intergenic
1013305656 6:108844819-108844841 CCTGCATTTCACTGGAAGGGAGG - Intergenic
1014125278 6:117769977-117769999 CCTTCATCTTGGAGACAGGGAGG + Intergenic
1017224733 6:152007725-152007747 CCTCCATCTCAATGACATGGGGG - Intronic
1018787673 6:167121085-167121107 CCTTCCCCTCTGGGGCAGGGAGG + Intergenic
1019548471 7:1590360-1590382 GCTTCCTCTCAATGGGAGGGGGG + Intergenic
1021507866 7:21405206-21405228 CCTTCATCTCAGGGTCTGGAGGG + Intergenic
1022048605 7:26643631-26643653 CCTTGGTCTCAGTGGCGGCGGGG + Intronic
1022502596 7:30892140-30892162 CCTTCATGGAAGGGGCAGGGAGG - Exonic
1023868050 7:44248204-44248226 CCTTCCTCTCATAGTCAGGGAGG + Intronic
1024557086 7:50613254-50613276 CCCTCCTCTCAGTGGCCTGGGGG - Intronic
1024858214 7:53806358-53806380 CCTTAACCTCTGTGGAAGGGAGG - Intergenic
1026776138 7:73232055-73232077 TTTCCATCTCAGTAGCAGGGAGG + Intergenic
1027016995 7:74785426-74785448 TTTCCATCTCAGTAGCAGGGAGG + Intronic
1027071032 7:75160510-75160532 TTTCCATCTCAGTAGCAGGGAGG - Intergenic
1032898017 7:136273892-136273914 CCTTCATCCCTTTGGCAGGTGGG + Intergenic
1039711580 8:40061129-40061151 CCCTCATCTCAGTCTCACGGCGG - Intergenic
1042181329 8:66090646-66090668 TCTTCATCTCAGTGGTTGTGTGG - Intronic
1043489307 8:80732548-80732570 CCCTCATATGGGTGGCAGGGTGG - Intronic
1045056371 8:98371755-98371777 CCTTCGTCTCAGTTGCATTGAGG + Intergenic
1045424737 8:102054178-102054200 CCATTGTCTCAGGGGCAGGGAGG + Intronic
1046557017 8:115787424-115787446 CCTTCAACTCAGTGGCCTGCAGG + Intronic
1047567914 8:126066369-126066391 CGTTCGTGTCGGTGGCAGGGTGG + Intergenic
1048161277 8:132024356-132024378 CCTTTAACTCAGAGGCGGGGAGG - Exonic
1049291370 8:141804345-141804367 CCTTTTTCTCAGTGCCAGAGAGG - Intergenic
1049406574 8:142454228-142454250 CATTCATCACAGTGGGCGGGCGG + Intronic
1049468554 8:142764805-142764827 CCCTCAGCTCAGTGGCAGATGGG - Intronic
1051226486 9:14904808-14904830 CCAGCATGTCAGTGGCAAGGAGG - Intronic
1057183349 9:93041493-93041515 CCTGCAACACAGTGGCTGGGTGG - Intergenic
1057276914 9:93680932-93680954 ACTTTATCTCAGTGGCTGCGGGG - Intergenic
1057883135 9:98808127-98808149 CCATCAGAGCAGTGGCAGGGCGG + Intronic
1060734998 9:126061287-126061309 CTTTCATATCAGTGGGAGTGGGG + Intergenic
1186045444 X:5532064-5532086 CCTTCTCTTCAGTGGCAGCGTGG - Intergenic
1187310075 X:18133336-18133358 CCCTCACTTCAGTGGCATGGGGG - Intergenic
1187530590 X:20093074-20093096 CCTTCTTTTCACTGGCTGGGAGG - Intronic
1188791709 X:34413902-34413924 CCTCCATGGCAGTGGCAGAGGGG - Intergenic
1194018828 X:88660725-88660747 CCTCCATATTAGAGGCAGGGAGG + Intergenic
1195245607 X:102992543-102992565 GCTCCATCTCAGTGGCAGGCCGG - Intergenic
1195295046 X:103468234-103468256 AGTTCATTTCAGTGGAAGGGTGG + Intergenic
1195368465 X:104149734-104149756 CCTACTTCTCAATGGAAGGGTGG + Intronic
1199849002 X:151711914-151711936 CCTTCCTCTCTGGCGCAGGGAGG + Intergenic
1201337074 Y:12892813-12892835 CCTTCTTACCAGTGCCAGGGTGG + Intergenic