ID: 1155203968

View in Genome Browser
Species Human (GRCh38)
Location 18:23541433-23541455
Sequence AGAGCCCTTCTCTCCCCGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155203968_1155203971 2 Left 1155203968 18:23541433-23541455 CCTGTCGGGGAGAGAAGGGCTCT 0: 1
1: 0
2: 1
3: 16
4: 96
Right 1155203971 18:23541458-23541480 GTCACTTCTGTTTACAGCCGGGG 0: 1
1: 0
2: 2
3: 6
4: 89
1155203968_1155203972 3 Left 1155203968 18:23541433-23541455 CCTGTCGGGGAGAGAAGGGCTCT 0: 1
1: 0
2: 1
3: 16
4: 96
Right 1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 61
1155203968_1155203973 14 Left 1155203968 18:23541433-23541455 CCTGTCGGGGAGAGAAGGGCTCT 0: 1
1: 0
2: 1
3: 16
4: 96
Right 1155203973 18:23541470-23541492 TACAGCCGGGGGCTCTCTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 117
1155203968_1155203969 0 Left 1155203968 18:23541433-23541455 CCTGTCGGGGAGAGAAGGGCTCT 0: 1
1: 0
2: 1
3: 16
4: 96
Right 1155203969 18:23541456-23541478 GCGTCACTTCTGTTTACAGCCGG 0: 1
1: 0
2: 2
3: 5
4: 72
1155203968_1155203970 1 Left 1155203968 18:23541433-23541455 CCTGTCGGGGAGAGAAGGGCTCT 0: 1
1: 0
2: 1
3: 16
4: 96
Right 1155203970 18:23541457-23541479 CGTCACTTCTGTTTACAGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155203968 Original CRISPR AGAGCCCTTCTCTCCCCGAC AGG (reversed) Exonic
900983342 1:6059022-6059044 ACAGCCCTTCCCTCCCCCACAGG + Intronic
900993784 1:6109611-6109633 AGACCCCTTATCTCCCCTGCAGG - Intronic
904697116 1:32336764-32336786 AGAGCCCTCCGCTCCCCGGCTGG - Intergenic
909713799 1:78682606-78682628 TGAGCCCTCCTCTCACCTACAGG - Intergenic
915054251 1:153111179-153111201 ATAGCCCCTCACTCCCCAACAGG - Intergenic
920127038 1:203701510-203701532 AGAAACCTTCTCTCCCCTAAGGG - Intronic
1064201009 10:13284893-13284915 AGAGCCCTTCTCTCCTGGCCAGG + Intronic
1067343096 10:45419801-45419823 AGGGCCCTTCTCTCCTGGCCTGG - Intronic
1070646296 10:78204480-78204502 AGAGCCCTTCTCCCCACCAGGGG + Intergenic
1076161494 10:128247414-128247436 AGTTCCCTTCTCTCCCAGCCTGG - Intergenic
1080300749 11:30782503-30782525 AGGGCTTTTCTCTCCCAGACTGG - Intergenic
1080977700 11:37362604-37362626 CTAGCCCTCCACTCCCCGACAGG - Intergenic
1083326105 11:61873782-61873804 TGAGCCCTTCTCTGCCCGCCTGG + Exonic
1084208011 11:67607174-67607196 AGAGCCCTTCTCCCCAGGCCAGG + Intronic
1084298075 11:68226079-68226101 AGAGCCCTACTCACCCCCAGTGG + Intergenic
1085910455 11:80818785-80818807 AGAGCTTTTCTCTTTCCGACTGG + Intergenic
1087396553 11:97608749-97608771 AGATCCCTTATCTCCCTCACAGG + Intergenic
1088982011 11:114872444-114872466 TGAGCCCTTGTCTCCTCAACTGG + Intergenic
1092503046 12:9066225-9066247 AGAGCTCTTCTCTCCCTGTGGGG - Intergenic
1095941050 12:47727096-47727118 CTAGCCCTTCTCTCCCAGAAGGG + Intergenic
1096706554 12:53425579-53425601 GGAGCCCTTCTCTCCCTCCCTGG - Intronic
1097263990 12:57735717-57735739 AGAGCCCTGGTCTCCCTGTCTGG - Intronic
1097435997 12:59552200-59552222 AGTGTCATTCTCTCCCCCACGGG - Intergenic
1101466977 12:104958527-104958549 ACAGCCCTTCTCTCCTGGGCAGG - Intronic
1101582959 12:106060044-106060066 ACAGCCCTTCTCTACCTGACTGG - Intergenic
1103464722 12:121132914-121132936 AGAGCTCTACTCTTCCTGACAGG - Exonic
1106553078 13:30788230-30788252 AAAGCCCATCTCACCCCGACAGG + Intergenic
1107016045 13:35708369-35708391 AGCTGCCTTCCCTCCCCGACAGG + Intergenic
1107447304 13:40480639-40480661 AGTGCCCCTTTCTCCCAGACTGG + Intergenic
1107884046 13:44859422-44859444 AGAGATCTTCTCTTCCCAACAGG - Intergenic
1107998232 13:45882755-45882777 TGGGCCCTCCTCTCCCCCACTGG + Intergenic
1108723999 13:53161084-53161106 AGAGACCTGCTCTTCCCTACAGG - Intergenic
1109626109 13:64977323-64977345 CTAGCCCTTCACTCCCCGACAGG + Intergenic
1113561422 13:111284668-111284690 TGAGCCCTTCTCTCCCAGTGTGG - Intronic
1122785700 14:104162447-104162469 AGAGCCCTTGTGTGGCCGACGGG + Intronic
1128664505 15:69528343-69528365 ATGGCCCTTCTCTCACCGAGCGG - Intergenic
1129074137 15:72976984-72977006 TGAGCCCTTCTGACCCCCACTGG + Intergenic
1133206627 16:4237968-4237990 AGACGCCTCCTCTCCCCTACTGG + Intronic
1135303392 16:21349709-21349731 AGTACCCTTCTCTCCCTGTCTGG + Intergenic
1136300140 16:29328903-29328925 AGTACCCTTCTCTCCCTGTCTGG + Intergenic
1136585174 16:31179916-31179938 AGAACCCCTCTCTCCTCGGCAGG - Intergenic
1141369938 16:83477718-83477740 AGAGCCATTCTTTCCCCCAAAGG - Intronic
1141991908 16:87615412-87615434 TGAGCCCTTCTCTCCCAGCTCGG + Intronic
1142061872 16:88035673-88035695 AGTACCCTTCTCTCCCTGTCTGG + Intronic
1142483095 17:230410-230432 AGTGCCCCTCTCTCCCTGAATGG - Intronic
1142757092 17:2022971-2022993 AGAGCCTTTCTCTCCCACCCTGG - Intronic
1143528226 17:7484563-7484585 GGAGCCCTTCTTTCCCTTACCGG - Exonic
1147266644 17:39238374-39238396 AGAGCCCTCCTCTTCCTGGCAGG + Intergenic
1147334626 17:39719864-39719886 ATTGCCCTTCACTCCCCCACTGG + Intronic
1155203968 18:23541433-23541455 AGAGCCCTTCTCTCCCCGACAGG - Exonic
1155317559 18:24587749-24587771 AGAGACCTTCTCTTCCCTGCAGG - Intergenic
1159943396 18:74426051-74426073 AGAGGCCGCCACTCCCCGACGGG + Intergenic
1164329959 19:24244729-24244751 ATGGCCCTTCTCTGCCCGCCAGG - Intergenic
1164445813 19:28316730-28316752 AGATCCCTTCTGTCCCTGTCAGG + Intergenic
1166908501 19:46133173-46133195 GGAGCCTTTCTCTCCCTGAGGGG - Intergenic
925178904 2:1803963-1803985 AGAGCTCTCCTCTCCCTGAGGGG - Intronic
926628653 2:15117414-15117436 AGAGCCCTGCTCTTCCCTTCTGG + Intergenic
941084240 2:161097959-161097981 CTAGCCCCTCACTCCCCGACAGG + Intergenic
945044991 2:205774038-205774060 ACATCCCTTCTCTCCCCAAAGGG - Intronic
1168900346 20:1358480-1358502 ACAGCCCTCCTCTCCCCAACAGG - Intronic
1168934180 20:1648682-1648704 AGAGCGCTTCTCTCTCAGGCTGG - Intronic
1169153381 20:3308095-3308117 AGAGCCCTTCTCTTCCACCCAGG + Intronic
1170599751 20:17832099-17832121 AGAGTCCTTCTCTCCCCAGAAGG - Intergenic
1173344918 20:42190471-42190493 AGAGCCTTCCTCTCCCAGAGAGG + Intronic
1173827201 20:46055606-46055628 GGAGCCCTTCTGTCCCCAGCTGG - Intronic
1175940691 20:62536303-62536325 AGTGCCCTTCCCTCCCCTCCAGG + Intergenic
1175985062 20:62760509-62760531 AGAGCGCTCCTCTCCCAGATAGG + Exonic
1176184679 20:63771721-63771743 GTAGGCCTTCTGTCCCCGACAGG - Intronic
1179563481 21:42231998-42232020 AGAACCCTTCTCTTCCCCGCTGG + Intronic
1183026840 22:35071695-35071717 AGAGGCCCTTTCTCTCCGACTGG - Intronic
1184037563 22:41925995-41926017 AAAGCCCTTCTCTCCCCCTCAGG + Intronic
1184608081 22:45585815-45585837 AGAGCCCATCTCTGCCCCATGGG - Intronic
1184841262 22:47053517-47053539 AGGGCGCTTCTCTCCCAGTCGGG + Intronic
950430425 3:12947767-12947789 TGAGCCCTCCTTTCCCAGACTGG + Intronic
953933200 3:47017349-47017371 AGGGCCCTTCTCACCAAGACAGG + Intronic
954160479 3:48717844-48717866 AGAGCCCTTCTGTCCAACACAGG - Intronic
956459062 3:69453650-69453672 TGTGCCCATCTCTCCCCCACTGG - Intronic
960780514 3:121313523-121313545 GGAGCCCCTCACTCCCGGACGGG + Intronic
962177995 3:133174763-133174785 AGAGCGCTTCTCTCCTCCAAAGG + Intronic
962383315 3:134913798-134913820 AGAGCCTTTCTCTCCATGCCTGG - Intronic
963296892 3:143556440-143556462 CAAGCCCTTCTCTCCTCCACTGG - Intronic
964944505 3:162203376-162203398 AGAGCTCTTCTAACCCCGACAGG + Intergenic
968812854 4:2807946-2807968 GGAGCCTGTCTCTCCCTGACAGG + Intronic
969453557 4:7288353-7288375 AGAGCCCCTCACTCCCCTATGGG - Intronic
969932304 4:10642463-10642485 AAAGACCTCCTCTCCCCAACTGG - Intronic
972782499 4:42298133-42298155 GCAGCCCTTCTCTCCCCCACTGG + Intergenic
976085641 4:81404543-81404565 AGAGCCCTTCAATACCCGCCAGG + Intergenic
984926956 4:184815457-184815479 AGAGCCCTCCTGTCCCCTCCAGG + Intronic
985646334 5:1086349-1086371 ACCGCCCTTCTCTGGCCGACGGG - Intronic
986125350 5:4878923-4878945 AGAGGCCCTCTCTCCCCGCCTGG - Intergenic
997210067 5:132071993-132072015 AGTGACCTTCTCTCCCAGATGGG + Intergenic
1000031575 5:157406500-157406522 AGAGCCCTTCTATCCCCAGTCGG - Intronic
1002056072 5:176598517-176598539 AGAGCTCTTGTCTCCTGGACAGG - Exonic
1002306263 5:178285829-178285851 AGAGCCCTCCTGTCCTCCACAGG + Intronic
1002908488 6:1470118-1470140 AGAGCCCTTCTTTCCCCTGGGGG + Intergenic
1014001294 6:116369622-116369644 AGCCCTCTTCTCTCCTCGACAGG + Intronic
1016935274 6:149445261-149445283 AGAGCCTCTTCCTCCCCGACAGG + Intergenic
1018677776 6:166237288-166237310 AGAGCCCTTCTCTCCGCGAGGGG + Intergenic
1019340960 7:508761-508783 AGAGCCCATCCCTCCCAGATGGG + Intronic
1027186570 7:75975299-75975321 AGAGTCCATCTTTCCCCCACTGG + Intronic
1031678325 7:124638715-124638737 AGAGCCCTTCTCTGACCAAGTGG + Intergenic
1033741947 7:144282790-144282812 AGAGCCCTTCTTTACTCCACAGG - Intergenic
1033751955 7:144366824-144366846 AGAGCCCTTCTTTACTCCACAGG + Exonic
1035420439 7:158725093-158725115 AGAGCCATGCTCTACCCCACTGG + Intergenic
1041817502 8:61991635-61991657 CTAGCCCTCCACTCCCCGACAGG + Intergenic
1046476091 8:114745671-114745693 ATATCCCTTGTCTCCCCTACTGG - Intergenic
1049392526 8:142379613-142379635 AAAGCCCTTCTCTGCCTGACGGG + Intronic
1050457691 9:5849342-5849364 GGATCCCTTCTCTCCCCTACAGG - Intergenic
1053131389 9:35617633-35617655 GCAGCCCTTATCTCCCCGAAAGG + Intronic
1054757221 9:68971142-68971164 AGTGCCCCCCACTCCCCGACAGG + Intronic
1188261625 X:28031023-28031045 AAAACCCTTCTCTTCCCCACAGG - Intergenic
1190760056 X:53431508-53431530 AGTGCCCTTCCCTAGCCGACTGG - Exonic
1194250004 X:91562874-91562896 AGAACCCTCCTCTCCCCCACAGG - Intergenic
1200568965 Y:4804123-4804145 AGAACCCTCCTCTCCCCCACAGG - Intergenic