ID: 1155203972

View in Genome Browser
Species Human (GRCh38)
Location 18:23541459-23541481
Sequence TCACTTCTGTTTACAGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155203968_1155203972 3 Left 1155203968 18:23541433-23541455 CCTGTCGGGGAGAGAAGGGCTCT 0: 1
1: 0
2: 1
3: 16
4: 96
Right 1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155203972 Original CRISPR TCACTTCTGTTTACAGCCGG GGG Intronic