ID: 1155203972

View in Genome Browser
Species Human (GRCh38)
Location 18:23541459-23541481
Sequence TCACTTCTGTTTACAGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155203968_1155203972 3 Left 1155203968 18:23541433-23541455 CCTGTCGGGGAGAGAAGGGCTCT 0: 1
1: 0
2: 1
3: 16
4: 96
Right 1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155203972 Original CRISPR TCACTTCTGTTTACAGCCGG GGG Intronic
904398854 1:30242359-30242381 TCATTTCTTTTTACAGCCCAAGG - Intergenic
904658247 1:32065574-32065596 TCACTTCTGTGTACCACCAGAGG + Intergenic
913396150 1:118375103-118375125 TCACTTCTCTATACAGCCTTGGG + Intergenic
916341775 1:163744956-163744978 TCTCTTCTTTTTACAGGCAGAGG + Intergenic
917822789 1:178782340-178782362 TCACTTCTGCTTCTAGCAGGAGG + Intronic
1069424313 10:68276392-68276414 TCAATTCTGTTCACAGCCTTTGG - Intergenic
1077828720 11:5839415-5839437 TCACTACCCTTTACAGCCTGTGG - Intronic
1081227471 11:40541882-40541904 TCAGTTCTGTTTATAGAAGGAGG - Intronic
1085918214 11:80918010-80918032 TCACTGCTGTGTTCAGCTGGTGG + Intergenic
1091298667 11:134490661-134490683 ACACTTCTGCTTACAGGCAGTGG + Intergenic
1091298731 11:134491249-134491271 ACACTTCTGCTTACAGGCAGTGG + Intergenic
1091383143 12:75948-75970 TCGGTTCTGTTTATTGCCGGGGG - Intronic
1091852934 12:3714982-3715004 TTACTTCTCTTTACAGCTGAGGG + Intronic
1096956815 12:55534625-55534647 TCAATTCTGTTTCCAGGTGGAGG - Intergenic
1097711536 12:62922890-62922912 TCACTCCTCTTTTCAGCTGGTGG - Intronic
1102097028 12:110249118-110249140 TCACTTCTGTTTGCAGAGTGTGG + Intergenic
1113294302 13:108941066-108941088 TCATTTTTGTTTCCAGCCTGTGG - Intronic
1114353305 14:21878577-21878599 TCACTTCTGTTTGGAGACAGAGG - Intergenic
1117844929 14:59900888-59900910 TCACTGCTGCTTACAGGCTGGGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1131237175 15:90706698-90706720 CCACTTCTATTTACAGCCTGGGG - Intergenic
1135983943 16:27169747-27169769 TCCCTACTGTTTCCAGCCAGAGG - Intergenic
1136579746 16:31143978-31144000 TTTCTTCTGTTTAGAGCCGCAGG - Intronic
1141304134 16:82845167-82845189 TCACTGCTGTAGACAGCCAGGGG + Intronic
1152275661 17:79355328-79355350 TGACTTCTGTTTTCAGCCACTGG + Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155553734 18:26995007-26995029 TCACTTCTGGGGAAAGCCGGTGG + Intronic
1164602971 19:29576006-29576028 CCACTTCTGGTGACAGCCGCTGG - Intergenic
1165285310 19:34837393-34837415 TCACTGCTGCTTACAGGCTGGGG + Intergenic
1167422608 19:49413070-49413092 TCACAGCTGTTTACAGTAGGAGG + Intronic
927229224 2:20803450-20803472 GCACTGCTGTTTACAGCTTGGGG - Intronic
938902525 2:135809905-135809927 GCCCTTCTGGTTACAGCCAGCGG - Exonic
944656423 2:201880682-201880704 TAACTTGTGTTTACAGGAGGTGG - Intronic
1173732154 20:45336531-45336553 TCACTTCTTTTTACAGCCGAGGG + Intronic
1176282039 20:64318811-64318833 TCGGTTCTGTTTATTGCCGGGGG + Intergenic
1182208591 22:28653838-28653860 TCTCTTATGTTTACAGTCTGGGG - Intronic
1183677476 22:39307568-39307590 TCACTTCTGTTTTCACAGGGAGG - Intergenic
1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG + Intronic
949621581 3:5818711-5818733 TCACTTGTGTTTTCAGCCTGGGG + Intergenic
950560567 3:13719188-13719210 TACCTTCTGTTTACAGAAGGTGG - Intergenic
954716383 3:52528923-52528945 TCCCTTCTGGGTACTGCCGGGGG + Exonic
965750100 3:171966842-171966864 TCAATTCTGTTTCCATCCTGGGG - Intergenic
970152615 4:13105961-13105983 TCACTTCTGTTTTCTGCCATAGG - Intergenic
970303879 4:14710576-14710598 TCACTTCTGTTTACAGCCAATGG + Intergenic
972564207 4:40255515-40255537 TCGCTTCTGTCTGCAGCCCGGGG + Intergenic
975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG + Intergenic
977187826 4:93962416-93962438 TCACTTTTTTTTACAGGTGGGGG + Intergenic
985947846 5:3200648-3200670 TCCCTTCTGTCTTCAGCAGGTGG + Intergenic
986157871 5:5194910-5194932 TCAGTTCTGTTTACATTCGGAGG + Intronic
986537485 5:8805879-8805901 TCCCTTCTGTTTGCAGCCTAGGG + Intergenic
989298114 5:39853648-39853670 TATCTCCTCTTTACAGCCGGTGG - Intergenic
990324102 5:54657623-54657645 TTACTTCTGGTTAGGGCCGGTGG - Intergenic
993452387 5:88088303-88088325 TCAATTGTGTTTACAGCTGGAGG - Intergenic
993989743 5:94641524-94641546 TCACTTCAGCTTACAGCAGTGGG + Intronic
997655451 5:135550895-135550917 ACACTTCTGATCACAGCAGGTGG + Intergenic
999262727 5:150247601-150247623 TCACTTCTGGGTACAGGCCGTGG + Intronic
1000023857 5:157342191-157342213 TCCCTTCTGTTTGCAGCAGGAGG + Exonic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1018698428 6:166408309-166408331 GCACTTCTGGGTACAGCAGGAGG + Intergenic
1029196616 7:98810047-98810069 TCACTGCTGTGGACAGCCGTGGG - Intergenic
1029436495 7:100566853-100566875 TCCTTTCTGCTTAGAGCCGGAGG + Exonic
1030119783 7:106097850-106097872 TCACATATGTTTACACCTGGAGG + Exonic
1041131920 8:54710427-54710449 ACACTGCTGTCTACAGACGGTGG - Intergenic
1044298938 8:90561371-90561393 TCATTTTAGTTTACAGCAGGAGG + Intergenic
1046856729 8:119040753-119040775 TCCCTTCTGTTGATAGCTGGTGG - Intronic
1052029078 9:23608282-23608304 TCACTTCTGTCTACAGATGATGG - Intergenic
1052533063 9:29712734-29712756 TCAGTGCTGATTAAAGCCGGAGG + Intergenic
1057144357 9:92748329-92748351 TCATTGCAGTTTACACCCGGGGG - Intronic
1059450220 9:114366976-114366998 TCACTTCTGTTTTCAGAATGTGG + Intronic
1061627142 9:131847495-131847517 TCTCTTCTGTCTACACCCGGGGG + Intergenic
1195116438 X:101703667-101703689 TCACTTCTCTTTCCAGCCTCTGG - Intergenic
1198492919 X:137161512-137161534 TCACTTCTGTTTACGTCCAGTGG + Intergenic