ID: 1155206692

View in Genome Browser
Species Human (GRCh38)
Location 18:23564441-23564463
Sequence CCCAGCCACATGGTTATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 782}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155206692_1155206697 4 Left 1155206692 18:23564441-23564463 CCTCAGATAACCATGTGGCTGGG 0: 1
1: 0
2: 0
3: 34
4: 782
Right 1155206697 18:23564468-23564490 CAGGTACATGCCACCATGCCTGG 0: 220
1: 4687
2: 19954
3: 56433
4: 113798
1155206692_1155206702 29 Left 1155206692 18:23564441-23564463 CCTCAGATAACCATGTGGCTGGG 0: 1
1: 0
2: 0
3: 34
4: 782
Right 1155206702 18:23564493-23564515 AATTATTTTTTGTAGACACAGGG 0: 2
1: 91
2: 716
3: 4518
4: 22209
1155206692_1155206701 28 Left 1155206692 18:23564441-23564463 CCTCAGATAACCATGTGGCTGGG 0: 1
1: 0
2: 0
3: 34
4: 782
Right 1155206701 18:23564492-23564514 TAATTATTTTTTGTAGACACAGG 0: 1
1: 38
2: 502
3: 4372
4: 30109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155206692 Original CRISPR CCCAGCCACATGGTTATCTG AGG (reversed) Intronic
900001883 1:19023-19045 GCCAGCCACAGGGATGTCTGGGG - Intergenic
900015996 1:150400-150422 CTCAGCCACATGAGTAACTGGGG + Intergenic
900021603 1:189546-189568 GCCAGCCACAGGGATGTCTGGGG - Intergenic
900046260 1:508997-509019 CTCAGCCACATGAGTAACTGGGG + Intergenic
900068462 1:750709-750731 CTCAGCCACATGAGTAACTGGGG + Intergenic
900869446 1:5291527-5291549 CCAAACCACATTGTCATCTGCGG + Intergenic
900944252 1:5820888-5820910 CACTGCCACATGGTTTGCTGGGG - Intergenic
901108177 1:6773883-6773905 CCCAGCCACTTGGGAGTCTGAGG + Intergenic
901403907 1:9033325-9033347 CCCAGCAACACGGGTGTCTGAGG - Intergenic
902231625 1:15031124-15031146 CCCAGCCCCAAGGCTAGCTGAGG - Intronic
902531785 1:17095353-17095375 CCCAGCAAAATGGTCCTCTGTGG + Intronic
902858917 1:19230452-19230474 CCCAGCTACTTGGGTGTCTGAGG + Intronic
903617807 1:24674926-24674948 CTCAGCCTCATGGGTAGCTGAGG - Intergenic
903766628 1:25739320-25739342 CACAGCCACATGGGTTTCTGTGG + Intronic
903866897 1:26405859-26405881 CCCAGCTACTTGGTAGTCTGAGG + Intergenic
903917828 1:26777334-26777356 CCCAGCCACTTGGGAAGCTGAGG - Intronic
903977756 1:27162332-27162354 ACCAGCCATGTGGATATCTGGGG - Intronic
904055492 1:27667298-27667320 CCCAGCTACTTGGGAATCTGAGG + Intronic
904353660 1:29924764-29924786 CCCAGCCTCCTGGGTTTCTGGGG + Intergenic
904550834 1:31316215-31316237 CCCAGCTACTTGGGTAGCTGAGG - Intronic
905733008 1:40309123-40309145 CCCAGCCACTTGGGTGGCTGAGG + Intronic
905890280 1:41514562-41514584 CCCAGCCACGCTCTTATCTGAGG + Intronic
906328599 1:44865696-44865718 CCCAGCTACTTGGTTGGCTGAGG - Intronic
906399373 1:45493672-45493694 CCCAGCTACATGGTAGACTGAGG + Intergenic
906499912 1:46334148-46334170 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
906770255 1:48476970-48476992 CCCAGCCACGTGGAATTCTGAGG + Intergenic
907101008 1:51835580-51835602 CCCAGCTACTTGGGAATCTGAGG - Intronic
908457336 1:64316568-64316590 CCCAGCTACTTGGTAAGCTGAGG + Intergenic
908598474 1:65712749-65712771 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
908760266 1:67505314-67505336 CCCAGCTACATGTGTAGCTGGGG + Intergenic
911622315 1:100079190-100079212 CCCAGCCACTTGGGAAGCTGAGG + Intronic
911951072 1:104173996-104174018 CCCAGCCACATGGAACTGTGAGG - Intergenic
912145002 1:106783054-106783076 CCCAGCTACATGGGAAGCTGAGG - Intergenic
912377857 1:109226833-109226855 CCCAGCTACATGGTAGGCTGAGG - Intronic
912974266 1:114313942-114313964 CCCAGCCACATGGAACTGTGAGG - Intergenic
913002260 1:114592602-114592624 CCCAGCTACATGGCTGGCTGAGG + Intronic
913246024 1:116870733-116870755 ATCAGGCATATGGTTATCTGGGG - Intergenic
913699362 1:121359650-121359672 CCCAGCTACATGGGAAGCTGAGG + Intronic
914138183 1:144920386-144920408 CCCAGCTACATGGGAAGCTGAGG - Intronic
914228767 1:145745328-145745350 CCCAGCCACTTGGTAGGCTGAGG + Exonic
914738147 1:150438172-150438194 CCCAGCCACTTGGGAAGCTGAGG + Intronic
914860230 1:151379756-151379778 CCCAGCTACTTGGGAATCTGAGG + Intergenic
914986577 1:152462528-152462550 CCCAGCTACTTGGTAAACTGAGG - Intergenic
915276207 1:154790022-154790044 CCCAGCCACTTGGGAAGCTGAGG - Intronic
915337487 1:155154149-155154171 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
915458678 1:156056465-156056487 ACAAGCCATGTGGTTATCTGAGG + Intronic
916166159 1:161968992-161969014 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
916218625 1:162420794-162420816 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
916306925 1:163346737-163346759 CCCAGCCACTTGGGAGTCTGAGG + Intronic
916443984 1:164855062-164855084 CCCAGCTACTTGGGTAGCTGAGG - Intronic
916640402 1:166722299-166722321 CCCAGCTACATGGGAATCTGAGG + Intergenic
916729924 1:167556854-167556876 CCCAGCTACATGGGAGTCTGAGG - Intergenic
916774873 1:167951457-167951479 CCCAGCCACTTGGGAAGCTGAGG + Intronic
917001119 1:170360934-170360956 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
918291641 1:183114183-183114205 CCCAGCCACTTGGTAGGCTGAGG - Intronic
918921953 1:190724124-190724146 CCCAGCTACTTGGTAGTCTGAGG - Intergenic
919468542 1:197950931-197950953 CCCAGCTACCTGGTAGTCTGAGG + Intergenic
919661980 1:200256335-200256357 CCCAGCTACATGGGAAGCTGAGG - Intergenic
919710162 1:200718771-200718793 CCCAGCTACTTGGTTGGCTGAGG - Intergenic
919716976 1:200788755-200788777 CCCAGCTACTTGGGTAGCTGAGG - Intronic
920157199 1:203963127-203963149 CCCAGCTACTTGGGAATCTGAGG + Intergenic
920421808 1:205839793-205839815 CCCAGCTACTTGGGAATCTGAGG + Intronic
920486771 1:206378362-206378384 CCCAGCTACATGGGAAGCTGAGG + Intronic
920593318 1:207243678-207243700 CTTAGCCACATGGTAATGTGAGG + Intergenic
920655970 1:207875293-207875315 CTCAGCCACCTGAGTATCTGGGG + Intergenic
920923332 1:210317304-210317326 CCCAGCTACTTGGGTAACTGAGG - Intergenic
920984522 1:210873461-210873483 CCCAGCTACATGGTAGGCTGAGG - Intronic
921339445 1:214119919-214119941 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
921459266 1:215409946-215409968 CCCAGCTACTTGGGAATCTGAGG - Intergenic
922103822 1:222496095-222496117 CTCAGCCACATGAGTAACTGGGG + Intergenic
922264140 1:223968612-223968634 CTCAGCCACATGAGTAACTGGGG + Intergenic
922525581 1:226300433-226300455 CCCAGCTACATGGGAAGCTGAGG + Intronic
922772337 1:228192820-228192842 CCCAGCCACTTGGGTGGCTGAGG - Intergenic
923598183 1:235377293-235377315 CCCAGCTACTTGGCCATCTGAGG - Intronic
923654740 1:235905799-235905821 CCCAGCTACATGGGAAGCTGAGG + Intergenic
924186192 1:241493913-241493935 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
924250485 1:242128187-242128209 CCCAGCCACTTGGTCAGCTGAGG + Intronic
924345987 1:243073605-243073627 CTCAGCCACATGAGTAACTGGGG + Intergenic
1063269274 10:4488383-4488405 CCCAGCTACTTGGTAAGCTGGGG - Intergenic
1063647281 10:7897773-7897795 CCCAGCTACATGGGAAACTGAGG - Intronic
1065012810 10:21434498-21434520 CCCAGCTACATGGGTGGCTGAGG + Intergenic
1065184851 10:23161877-23161899 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1065220169 10:23488573-23488595 CCCAGCCACATGGGAGGCTGAGG - Intergenic
1065732309 10:28720853-28720875 CCCAGCCACTTGGTAGGCTGAGG - Intergenic
1065835174 10:29650831-29650853 CCCAGCCACATGGGAGGCTGAGG + Intronic
1066234259 10:33469471-33469493 CACAGCCACATGGTAATACGTGG + Intergenic
1066639911 10:37545617-37545639 CCCAGCCACTTGGGTGGCTGAGG - Intergenic
1066730355 10:38431211-38431233 CTCAGCCACATGAGTAACTGGGG - Intergenic
1067050760 10:43018346-43018368 AAAAACCACATGGTTATCTGTGG - Intergenic
1068426104 10:56866351-56866373 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1068884129 10:62080936-62080958 CCCAGCCACTTGGGAAACTGAGG - Intronic
1069055465 10:63840011-63840033 CCCAGCCACATGGAACTGTGAGG + Intergenic
1069546339 10:69331758-69331780 CCCAGCCACTTGGGAGTCTGAGG + Intronic
1069658317 10:70106680-70106702 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1069978870 10:72238286-72238308 CCCAGCCTCATGGGAAGCTGAGG + Intergenic
1070415362 10:76184144-76184166 CCCAGCTACATGGCAAGCTGAGG - Intronic
1071453639 10:85824325-85824347 CCCAGCTACATGGGAAGCTGAGG - Intronic
1072727746 10:97824978-97825000 CCCAGCTACATGGGTGGCTGAGG + Intergenic
1074074791 10:110113160-110113182 CCCAGCCACATGGGAGGCTGAGG + Intronic
1074184055 10:111086098-111086120 GCCAGCCACATGGGTCCCTGGGG - Intergenic
1074393750 10:113079771-113079793 CCCAGCTACTTGGGTAACTGAGG - Intronic
1074816645 10:117146921-117146943 CCCAGCCACTTGGGAAACTGGGG - Intergenic
1075712847 10:124540082-124540104 CCCCTCCCCACGGTTATCTGGGG - Intronic
1076016583 10:127032667-127032689 CCCAGCTACATGGGAAGCTGAGG - Intronic
1076194480 10:128506928-128506950 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1076620130 10:131781749-131781771 CCCAGCCACATGCCTGTCTTTGG + Intergenic
1076972588 11:145469-145491 CTCAGCCACATGAGTAACTGGGG + Intergenic
1077205763 11:1343260-1343282 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1077249221 11:1553486-1553508 CCCAGCTACTTGGGAATCTGAGG + Intergenic
1078223840 11:9374347-9374369 CCCAGCTACATGGGAGTCTGAGG - Intergenic
1078254163 11:9643055-9643077 ACCAGCCACATTGCTAGCTGAGG - Intergenic
1078280379 11:9894864-9894886 CCCAGCCACTTGGGCAACTGAGG + Intronic
1079140072 11:17802724-17802746 GGGAGCCATATGGTTATCTGGGG - Intronic
1079410775 11:20185324-20185346 CCCAGCCACTTGGGAGTCTGAGG + Intergenic
1079441188 11:20516328-20516350 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1079693613 11:23451129-23451151 CCCAGCTACATGGGGAGCTGTGG + Intergenic
1080006949 11:27418948-27418970 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1080531951 11:33185104-33185126 CCCAGCCACTTGGGGAGCTGAGG - Intergenic
1080708118 11:34718678-34718700 GCAAGCCACAAGGTTATCTGGGG + Intergenic
1080862187 11:36159655-36159677 CCCAGCTACATGGGAAGCTGAGG + Intronic
1080873634 11:36258272-36258294 CGCAGCCACATGTGGATCTGGGG + Intergenic
1080948471 11:37001613-37001635 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1081313125 11:41597680-41597702 CCCAGACACATGGTCCTTTGGGG + Intergenic
1081503453 11:43690013-43690035 GTCAGTCACATGGATATCTGGGG - Intronic
1082181512 11:49125965-49125987 CCCATGCATATGTTTATCTGGGG + Intergenic
1082714418 11:56594170-56594192 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1082799593 11:57404856-57404878 CCCAGCTACTTGGTTGGCTGAGG - Intronic
1082841264 11:57692130-57692152 CCCAGCTACTTGGGTAGCTGAGG - Intronic
1083613157 11:64014000-64014022 CCAAGACACAGGGTGATCTGTGG - Intronic
1084215504 11:67645115-67645137 CCCAGCCACAGGGTGTGCTGCGG - Exonic
1084278334 11:68068531-68068553 CCCAGCTACTTGGTAAGCTGAGG - Intronic
1084408991 11:68995306-68995328 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1085022514 11:73218329-73218351 CCCAGGCACGTGGGTCTCTGCGG + Exonic
1085555895 11:77421303-77421325 ATAAGCCATATGGTTATCTGAGG - Intronic
1085742474 11:79088997-79089019 CAGACCCACATGGTCATCTGGGG + Intronic
1085766889 11:79291143-79291165 CCAATCCACATGGCTATGTGGGG - Intronic
1085870347 11:80342215-80342237 CCCAGCCACTTGGGTGGCTGAGG - Intergenic
1085872822 11:80370734-80370756 CCCAGCCACATGGGAGGCTGAGG - Intergenic
1086103672 11:83127569-83127591 CCCAGCTACTTGGGTGTCTGAGG - Intergenic
1086350337 11:85937547-85937569 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1086371118 11:86156642-86156664 CCCAGACACAAGGTAAGCTGAGG + Intergenic
1086467836 11:87073781-87073803 CCCAGCTACATGGGAAGCTGAGG - Intronic
1086683982 11:89708879-89708901 CCCATGCATATGTTTATCTGGGG - Intergenic
1087184530 11:95174597-95174619 CCCAGCTACTTGGGAATCTGAGG - Intronic
1087643062 11:100776041-100776063 CCCAGCTACTTGGGAATCTGAGG + Intronic
1088038946 11:105352916-105352938 CCCAGCTACATGGTAAGCTGAGG - Intergenic
1088151088 11:106746243-106746265 CCCAGTCACATGGTAATATATGG - Intronic
1088246089 11:107819694-107819716 CCCAGCCATATGCTTCTCTCAGG + Intronic
1088583614 11:111338107-111338129 CCCAGCTACTTGGTGAGCTGAGG - Intergenic
1090127072 11:124097768-124097790 CCCAGCTACATGGGAAGCTGGGG + Intergenic
1090611558 11:128475665-128475687 CCCAGCCACTTGGTAGGCTGAGG - Intronic
1090951356 11:131476355-131476377 CCCAGGTACATGATTAGCTGGGG - Intronic
1091269961 11:134301132-134301154 CCAAGCCACTTGCTTACCTGGGG - Intronic
1091374963 12:19128-19150 GCCAGCCACAGGGATGTCTGGGG - Intergenic
1092173720 12:6389211-6389233 GCCAGCCATGGGGTTATCTGGGG + Intronic
1092736967 12:11592168-11592190 GCCATCCACATGGAGATCTGGGG + Intergenic
1093300224 12:17444036-17444058 CCCAGCTACTTGGGTATCTGAGG - Intergenic
1093991860 12:25598126-25598148 CCCAGCCATATGGAAATGTGAGG + Intronic
1094310551 12:29075862-29075884 CCCAGCTACATGGGTAGCTGAGG + Intergenic
1096697356 12:53358268-53358290 CCCAGCTACATGGGTGGCTGAGG + Intergenic
1098106900 12:67077251-67077273 CCCAGCCACTTGGGAGTCTGAGG + Intergenic
1098228354 12:68347935-68347957 CCCAGCTACTTGGGCATCTGAGG - Intergenic
1098439890 12:70506145-70506167 CCCAGCTACATGGGAAACTGAGG + Intergenic
1098983863 12:76988686-76988708 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
1099170990 12:79363617-79363639 CCCAGCTACATGGGAAGCTGAGG + Intronic
1099420923 12:82459509-82459531 CCCAGCTACTTGGGTAGCTGAGG + Intronic
1099612964 12:84898223-84898245 CCCAGCTACTTGGTTGGCTGAGG + Intronic
1100726288 12:97412310-97412332 GCCAGCCATATGGTTATTTATGG - Intergenic
1101748438 12:107562404-107562426 GCAAGCCATATGGATATCTGAGG + Intronic
1102115766 12:110402057-110402079 CCCAGCTACTTGGTTGGCTGAGG + Intronic
1102423367 12:112821556-112821578 CTGAGCCACATGGCCATCTGGGG - Intronic
1102836259 12:116063400-116063422 CCCAGCCACTTGGGTGGCTGAGG + Intronic
1103729644 12:123018897-123018919 CCCAGCTACTTGGTCAGCTGAGG - Intronic
1104219492 12:126768064-126768086 CCCAGCTACATGGTAGGCTGAGG - Intergenic
1104268629 12:127262031-127262053 CCCAGCCATATTTTTAACTGTGG - Intergenic
1104291381 12:127472453-127472475 CCCAGCTACTTGGTGGTCTGAGG - Intergenic
1104338323 12:127922290-127922312 CCCAGCCACTTGGTAGGCTGAGG - Intergenic
1104480147 12:129100434-129100456 CCATGCCTCATGGTGATCTGAGG + Intronic
1105272286 13:18888813-18888835 CCCAGCTACATAGTTGGCTGAGG - Intergenic
1105288566 13:19029592-19029614 CCCAGCTACTTGGGTGTCTGAGG - Intergenic
1105521423 13:21134627-21134649 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1105745064 13:23369972-23369994 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1106082305 13:26510632-26510654 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1106722620 13:32451656-32451678 CCCAGCTACATGGGAAGCTGAGG - Intronic
1107503911 13:41011557-41011579 CCCAGCCACTTGGGGAGCTGAGG - Intronic
1107924084 13:45241035-45241057 CCCAGCCACAAGGGCAGCTGAGG + Intronic
1109612269 13:64781929-64781951 CCCAGCAACTTGGTAAGCTGAGG - Intergenic
1110084203 13:71356621-71356643 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1110112271 13:71762649-71762671 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1111369800 13:87302193-87302215 CTCAGCCTCCTGGGTATCTGGGG - Intergenic
1111974412 13:94950847-94950869 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1111989937 13:95106445-95106467 CCCTGCCACATTCTCATCTGTGG - Intronic
1112493545 13:99887635-99887657 CCCAGCCACATGGGAGGCTGAGG + Intronic
1112732857 13:102386246-102386268 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1112842516 13:103598676-103598698 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
1112940489 13:104855337-104855359 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1113065943 13:106374535-106374557 CCCAGCTACTTGGTCAGCTGAGG - Intergenic
1113123516 13:106950894-106950916 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
1113359808 13:109620078-109620100 CCCAGCCACTTGGAAGTCTGAGG - Intergenic
1113359852 13:109620385-109620407 CCCAGCCACTCGGTAGTCTGAGG - Intergenic
1113367639 13:109691142-109691164 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1113808939 13:113125988-113126010 CTGAGCCACTTGGGTATCTGTGG + Intronic
1114183683 14:20384492-20384514 CCCACTCACAGGGGTATCTGTGG + Exonic
1114232345 14:20795090-20795112 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1114344248 14:21779088-21779110 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1114913618 14:27232943-27232965 CCCAGCTACTTGGGGATCTGAGG + Intergenic
1115014084 14:28588716-28588738 CCCAGCTACTTGGTAAGCTGAGG - Intergenic
1115393329 14:32878317-32878339 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1115537285 14:34385006-34385028 CCCAGCTACTTGGGTAGCTGAGG - Intronic
1116264199 14:42665648-42665670 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
1116265193 14:42679439-42679461 CCCAGCTACTTGGGTAGCTGTGG - Intergenic
1116317370 14:43415583-43415605 CCCAGCTACATGGTAGGCTGAGG + Intergenic
1116550853 14:46235986-46236008 ACCAGCCACATGATGATCTGAGG + Intergenic
1116886016 14:50222592-50222614 GCCAGCCACGTGATTATCTGAGG + Intronic
1117035490 14:51723657-51723679 CCCAGCTACATGGGTGGCTGGGG + Intronic
1117139695 14:52776054-52776076 CCCAGCCACATGGGAGGCTGAGG + Exonic
1117283736 14:54265852-54265874 TGCAGCCATTTGGTTATCTGGGG - Intergenic
1117672997 14:58126916-58126938 CCCAGCCACATGGGAGGCTGAGG - Intronic
1118541184 14:66827167-66827189 CCCAGCTACTTGGGTAGCTGAGG + Intronic
1119216749 14:72875289-72875311 CCCAGCCACTTGGGAAGCTGGGG + Intronic
1119238312 14:73038162-73038184 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1120134967 14:80856844-80856866 CCCAGCCACCTGGGAGTCTGAGG - Intronic
1120742132 14:88119711-88119733 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1121097605 14:91228708-91228730 CTCAGCCACATGGGGATCTGCGG + Intergenic
1121608313 14:95257669-95257691 CCCAGCCACGTGGCTATGCGGGG + Intronic
1121907609 14:97761377-97761399 CCCAGCCACTTGGTAGGCTGAGG + Intronic
1122135423 14:99630079-99630101 GACTCCCACATGGTTATCTGAGG - Intergenic
1122252721 14:100451355-100451377 CCCAGCTACTTGGGTGTCTGAGG - Intronic
1122607071 14:102953814-102953836 ACCAGCCACATGGTTCTGTAAGG + Intronic
1122847320 14:104506940-104506962 CCCAGCCCCATGGCAACCTGGGG - Intronic
1123106501 14:105844270-105844292 CCCGGCCACATGGACATCTCAGG + Intergenic
1123664671 15:22598959-22598981 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1124186457 15:27533951-27533973 CCCAGCCACTTGGGAAACTGAGG - Exonic
1124285466 15:28397443-28397465 CTCAGCCACTTGGTAAGCTGAGG + Intergenic
1124297229 15:28514193-28514215 CTCAGCCACTTGGTAAGCTGAGG - Intergenic
1124318507 15:28693409-28693431 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1124329198 15:28794091-28794113 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1124564935 15:30804037-30804059 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1125960185 15:43823490-43823512 CCCAGCTACTTGGGAATCTGAGG - Intronic
1126858902 15:52865014-52865036 GCCAGCCACATGTGTATCTGAGG - Intergenic
1127351509 15:58157520-58157542 AACAGCCACATGGGTTTCTGTGG - Intronic
1128303864 15:66585002-66585024 CCCAGCCACATGGGAGGCTGAGG + Intronic
1128629483 15:69249160-69249182 GCCATCCAAATGGATATCTGGGG + Intronic
1130108989 15:80949619-80949641 CCCAGCATCATGGATATCAGTGG - Exonic
1130570548 15:85039311-85039333 CCCAGCTACTTGGGAATCTGAGG + Intronic
1130643940 15:85706956-85706978 CCCAGACACATGGATTTGTGGGG - Intronic
1130731041 15:86492472-86492494 CCCAGCTACATGGGAAGCTGAGG + Intronic
1131138941 15:89961498-89961520 CCCAGCTACATGGGTGGCTGGGG + Intergenic
1131897031 15:97044867-97044889 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1131976992 15:97957011-97957033 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1132302241 15:100783145-100783167 CCCAGCTACTTGGGGATCTGAGG + Intergenic
1132325350 15:100964219-100964241 CCCAGCCCCGGGGTGATCTGCGG - Intronic
1132386413 15:101403833-101403855 CCCAGCTACTTGGTTGGCTGAGG - Intronic
1132451626 15:101971917-101971939 GCCAGCCACAGGGATGTCTGGGG + Intergenic
1132455263 16:18712-18734 GCCAGCCACAGGGATGTCTGGGG - Exonic
1132770898 16:1562654-1562676 CCCAGCTACTTGGTAGTCTGAGG + Intronic
1133084793 16:3353683-3353705 CCCAGCTACTTGGTTGGCTGAGG + Intergenic
1133187192 16:4108487-4108509 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1134175432 16:12002330-12002352 CCCAGCTACTTGGGTATCTGAGG + Intronic
1134487947 16:14673485-14673507 CCCAGCCACATGGGAGGCTGAGG - Intronic
1134488129 16:14675053-14675075 CCCAGCTACTTGGTAAGCTGAGG + Intronic
1134566793 16:15258512-15258534 CCCAGCAAAATGGTTCACTGGGG - Intergenic
1134735700 16:16498187-16498209 CCCAGCAAAATGGTTCACTGGGG + Intergenic
1134931826 16:18214035-18214057 CCCAGCAAAATGGTTCACTGGGG - Intergenic
1134993318 16:18720013-18720035 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1135003067 16:18793545-18793567 CCCAGCTACTTGGGTAGCTGAGG - Intronic
1135352839 16:21744253-21744275 CCCAGCCACTTGGGTGGCTGAGG - Intronic
1135378108 16:21968115-21968137 CCCAGCTACATGGGTGGCTGAGG - Intronic
1135451325 16:22560375-22560397 CCCAGCCACTTGGGTGGCTGAGG - Intergenic
1136423070 16:30148995-30149017 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1136542919 16:30938388-30938410 CCCAGCCACATGGGAGGCTGAGG + Intronic
1136591838 16:31222275-31222297 CCCAGCTACTTGGTTGGCTGAGG + Intronic
1137306130 16:47202102-47202124 CCCTGTCACATGTTTATATGAGG + Intronic
1137346887 16:47670603-47670625 CCCAGCCACTTGGGAGTCTGAGG - Intronic
1137430000 16:48411020-48411042 CCCAGCTACTTGGTAAGCTGAGG - Intronic
1137452975 16:48594468-48594490 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1138321999 16:56122574-56122596 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1138501921 16:57451465-57451487 CCCAGCCACAAGGCTGTCTTAGG + Intronic
1138644658 16:58415579-58415601 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1138952476 16:61929772-61929794 TCCAGCCACTTGGGTAGCTGAGG + Intronic
1139269260 16:65666638-65666660 CCCAGGCACCTGGTGAGCTGGGG + Intergenic
1139609563 16:68045841-68045863 CCCAGCTACTTGGGAATCTGAGG - Intronic
1140180276 16:72709593-72709615 CCCAGCCACTTGGATGGCTGAGG + Intergenic
1140442258 16:74997466-74997488 CCCAGCTACTTGGGTAGCTGAGG - Intronic
1140471223 16:75216100-75216122 CCCAGCTACATGGGAGTCTGAGG - Intergenic
1140720724 16:77769312-77769334 CCCAGCCACACGGGAAACTGAGG + Intergenic
1141472362 16:84247694-84247716 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
1141681823 16:85549288-85549310 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1142003305 16:87676616-87676638 CCCAGCTACATGGGTGCCTGAGG + Intronic
1142168026 16:88603736-88603758 CCCAGCTACTTGGTAAGCTGAGG - Intronic
1142447662 16:90152052-90152074 CTCAGCCACATGAGTAACTGGGG - Intergenic
1142459828 17:83271-83293 CTCAGCCACATGAGTAACTGGGG + Intergenic
1142602615 17:1061660-1061682 CCCAGCCACATGGGAGGCTGAGG - Intronic
1142786766 17:2230447-2230469 CCAAACCACATGGCTATCTTGGG + Intronic
1142979239 17:3662193-3662215 CCCAGCTACTTGGTTGGCTGAGG + Intergenic
1143636354 17:8165909-8165931 CCCAGCCACTTGGGAGTCTGAGG - Intergenic
1144123235 17:12177398-12177420 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1144590462 17:16519510-16519532 CCCAGCTACCTGGGGATCTGAGG - Intergenic
1144941533 17:18945472-18945494 CCCAGCCACTTGGGAGTCTGAGG + Intergenic
1144997262 17:19278762-19278784 CCCAGCTACCTGGGTAGCTGAGG - Intronic
1145127830 17:20316480-20316502 CCCAGCCACATGGGAGGCTGAGG - Intronic
1145880497 17:28349330-28349352 CCCAGCCAAATGGCCATCTATGG - Intronic
1146192407 17:30781092-30781114 CCCAGCCACATGGGAGGCTGAGG - Intronic
1146390551 17:32418277-32418299 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1147118900 17:38323651-38323673 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1147259704 17:39202017-39202039 CCCAGCTACTTGGTAAGCTGAGG + Intronic
1148137699 17:45305509-45305531 CCCAGCCACTTGGGTGGCTGAGG - Intronic
1148243929 17:46018027-46018049 CCCAGCCACTCGGTTGGCTGAGG + Intronic
1148271495 17:46265592-46265614 CCCAGCCACATGGGAAGCTGAGG - Intergenic
1148504057 17:48113659-48113681 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1148532329 17:48406147-48406169 CCCAGCCACATGGGAGGCTGAGG + Intronic
1148657300 17:49296613-49296635 CCCAGCTACTTGGTTAGCTGAGG + Exonic
1148884040 17:50758416-50758438 CCCAGCCACTTGGGTGGCTGAGG + Intergenic
1148884392 17:50761153-50761175 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1149304579 17:55335502-55335524 CCCAGCCTCAGGGTTCTCAGTGG + Intergenic
1150251558 17:63707673-63707695 CCCAGCTACTTGGTTGGCTGAGG - Intronic
1150713136 17:67548473-67548495 CCCAGCTACATGGTAGGCTGAGG + Intronic
1150801042 17:68283004-68283026 CCCAGCCACTTGGGTGGCTGAGG + Exonic
1151458026 17:74238232-74238254 CACAGCCACAGGGTTATGGGGGG + Intronic
1153061366 18:998189-998211 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1153256714 18:3178981-3179003 CCCAGCTACTTGGTAGTCTGAGG - Intronic
1153297559 18:3562264-3562286 CACAGCCACTTGGGTAACTGTGG - Intronic
1153406123 18:4741722-4741744 CCCAGCTACCTGGGTGTCTGAGG - Intergenic
1153899748 18:9607243-9607265 CCCAGCTACTTGGTAAGCTGAGG + Intronic
1155206692 18:23564441-23564463 CCCAGCCACATGGTTATCTGAGG - Intronic
1155398365 18:25410951-25410973 CCCAGCTACCTGGTAAGCTGAGG - Intergenic
1156460958 18:37321061-37321083 CCCAGCCACAGGGTTAACCAGGG - Intronic
1156465765 18:37347153-37347175 CCCACCCTCAGGGTCATCTGAGG - Intronic
1156750977 18:40454644-40454666 CCCAGCCACCTGGGAAACTGAGG + Intergenic
1157134678 18:45042263-45042285 CCCAGCCACTTGGTAGGCTGAGG - Intronic
1157242419 18:46023441-46023463 CCCAGCTACTTGGTAAGCTGAGG + Intronic
1157682277 18:49616408-49616430 AGCACCCACATGGTTAGCTGGGG + Intergenic
1157819377 18:50754221-50754243 TCCAGCTACATGGTTATAGGTGG + Intergenic
1158245968 18:55432185-55432207 CCCAGCCACTTGGGTGGCTGAGG + Intronic
1158363195 18:56700370-56700392 CCCAGCTACATGGGTGACTGAGG - Intronic
1158475330 18:57774479-57774501 CCCAGCTACATGGTAGGCTGGGG + Intronic
1159306755 18:66653087-66653109 CCCAGCTACTTGGATAGCTGAGG - Intergenic
1159588737 18:70308331-70308353 CCCAGCTACATGGGAAGCTGGGG - Intronic
1160633635 19:60631-60653 GCCAGCCACAGGGATGTCTGGGG - Intergenic
1160649544 19:215779-215801 CTCAGCCACATGAGTAACTGGGG + Intergenic
1160798807 19:957726-957748 CCCAGCCACTTGGGCAGCTGAGG + Intronic
1161463104 19:4410733-4410755 CCCAGCCACCTGGGAAACTGAGG + Intronic
1161781646 19:6297121-6297143 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
1161945090 19:7430687-7430709 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1162448178 19:10737299-10737321 ATGAGCCACAGGGTTATCTGGGG - Intronic
1162719293 19:12652645-12652667 CCCAGCTACTTGGATAGCTGAGG - Intronic
1163530592 19:17846698-17846720 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1163583145 19:18150100-18150122 CCCAGCCACTTGGGAAGCTGAGG - Exonic
1163740050 19:19006102-19006124 CCCAGCTACTTGGGAATCTGAGG + Intronic
1163817948 19:19478476-19478498 CCCAGCTACTTGGGAATCTGAGG + Intronic
1164008933 19:21179673-21179695 CCCAGCTACATGGGAAGCTGAGG - Intronic
1164037689 19:21468623-21468645 CCTAGGCACATGGATGTCTGGGG - Intronic
1164051655 19:21589148-21589170 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1164052158 19:21592839-21592861 CCCAGGCACAGGGTGTTCTGTGG - Intergenic
1164308333 19:24024692-24024714 CCCAGCTACTTGGGTGTCTGAGG - Intergenic
1164497144 19:28776882-28776904 CCCAGCAACTTGGTAAGCTGTGG + Intergenic
1164976553 19:32577149-32577171 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1165046219 19:33107196-33107218 CCCAGCAACATGGGAGTCTGAGG - Intronic
1165387385 19:35518706-35518728 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1165698275 19:37917887-37917909 CCCAGCTACATGGGTGGCTGAGG + Intronic
1165780766 19:38433142-38433164 CCCAGCCACTTGGGAAACTGAGG - Intergenic
1166628983 19:44388454-44388476 CCCAGCTACTTGGAAATCTGAGG + Intronic
1166638270 19:44471229-44471251 CCCAGCCACTTGGAAATCTGAGG - Intergenic
1166665056 19:44674514-44674536 CCCAGCTACATGGGAAGCTGAGG - Intronic
1166787019 19:45373852-45373874 GTCAGCCACATGGCTATCAGGGG - Intergenic
1167016409 19:46843776-46843798 CCCAGCCACTTGGCAAGCTGAGG + Intronic
1167442268 19:49515108-49515130 CCCAGCTACTTGGTTGGCTGAGG - Intronic
1167928500 19:52844004-52844026 CCCAGCTACTTGGGAATCTGAGG + Intronic
1167933034 19:52883783-52883805 CCCAGCTACTTGGGAATCTGAGG + Intronic
1167963263 19:53124122-53124144 CCCAGCCACTTGGTAGGCTGAGG + Intronic
1168165653 19:54545622-54545644 CCCAGCCACTTGGGAGTCTGAGG + Intronic
925141886 2:1556583-1556605 CCCAGCTACTTGGGAATCTGAGG + Intergenic
926395016 2:12432045-12432067 CCCAGCCACTTGGGAGTCTGAGG - Intergenic
927388201 2:22561206-22561228 CCCAGCTACATGGGAAGCTGAGG + Intergenic
928137123 2:28696018-28696040 CCCAGCTACATGGTAGGCTGAGG + Intergenic
928531512 2:32196942-32196964 CCCAGCCACATGGGAGGCTGAGG + Intronic
928573568 2:32631924-32631946 CCCAGCTACATGGGAACCTGAGG - Intronic
928846682 2:35682468-35682490 CCCAGCTACATGGGAAGCTGAGG + Intergenic
928956468 2:36874146-36874168 CCCAGCTACATGGATGGCTGAGG + Intronic
929428484 2:41867931-41867953 CCCATCCCCATGGTCAGCTGTGG - Intergenic
929691874 2:44081728-44081750 CCCAGCTACTTGGTAAGCTGAGG - Intergenic
929784134 2:44976886-44976908 CCCAGCCACATGGGAGGCTGAGG + Intergenic
930352901 2:50280160-50280182 CCCAGCTACTTGGGAATCTGAGG + Intronic
930352924 2:50280440-50280462 CCATGCCACATGGCTATATGGGG - Intronic
930813471 2:55567529-55567551 CCCAGCCACTTGGGAAGCTGAGG - Intronic
931607951 2:64070535-64070557 CCCAGCTACTTGGTAAGCTGAGG + Intergenic
932550250 2:72762126-72762148 CCCAGCCACTTGGGAAGCTGAGG + Intronic
935412697 2:102782188-102782210 CCCAGCCATATGGTAGGCTGAGG + Intronic
936567839 2:113594384-113594406 GCCAGCCACAGGGATGTCTGGGG + Intergenic
936749297 2:115621791-115621813 CCCAGCTACTTGGGAATCTGAGG - Intronic
937082356 2:119149373-119149395 ACCAGCCTGCTGGTTATCTGAGG - Intergenic
937261212 2:120587630-120587652 CCCCGCCGCGTGTTTATCTGGGG + Intergenic
937444942 2:121949833-121949855 CCCAGCCACCCAGTTACCTGTGG - Intergenic
937502707 2:122498717-122498739 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
938016213 2:127869469-127869491 CACAGCCACATATTTACCTGAGG - Exonic
938032659 2:128008799-128008821 CCCAGCTACATGGGAAGCTGAGG - Intronic
938569725 2:132551616-132551638 CCCAACCAAAGGCTTATCTGAGG + Intronic
938850976 2:135259133-135259155 CCCAGCCACTTGGGAGTCTGAGG - Intronic
939691856 2:145273148-145273170 CCCAGCCACATGGGAAGCTGAGG - Intergenic
939982658 2:148799525-148799547 CCCAGCCACATGGGAGGCTGAGG + Intergenic
940204432 2:151187209-151187231 CCCAGCTACTTGGGTGTCTGAGG + Intergenic
940226793 2:151409360-151409382 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
940231137 2:151453459-151453481 CCCAGCTACTTGGGAATCTGAGG + Intronic
940301678 2:152181761-152181783 CCCAGCTACATGGGAAGCTGAGG - Intergenic
940311924 2:152288159-152288181 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
940504465 2:154535274-154535296 CCCAGTTACAGAGTTATCTGGGG - Intergenic
941569189 2:167148264-167148286 CCCAGCTACATGGGAAGCTGAGG + Intronic
942244597 2:173995535-173995557 CCCAGCCACATGGCAAACTTTGG + Intergenic
943075534 2:183189612-183189634 CCCAGCTACCTGGGAATCTGAGG + Intergenic
943611150 2:190036278-190036300 CACAGCCACATTGTGATTTGGGG - Intronic
944224309 2:197334806-197334828 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
944242033 2:197495707-197495729 CCCAGCTACATGGGAAGCTGAGG - Intronic
944982230 2:205134406-205134428 CCCAGCCACTTGGTAGGCTGAGG + Intronic
945960310 2:216127122-216127144 CCCAGCTACTTGGGTGTCTGAGG + Intronic
946214174 2:218170918-218170940 CCCAGCTACATGGAAAGCTGAGG + Intergenic
946279289 2:218654971-218654993 CCCAGCTACATGGGAAGCTGAGG + Intronic
946784398 2:223227193-223227215 CCCAGCTACTTGGGAATCTGAGG + Intergenic
947643167 2:231718495-231718517 CCCAGCTACATGGAAAGCTGAGG + Intergenic
947774310 2:232695966-232695988 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
947842742 2:233218838-233218860 CCCAGCCACTTGGGAAGCTGAGG + Intronic
948246452 2:236489807-236489829 CCCAGCCACTTGGGAAGCTGGGG + Intronic
948559160 2:238839246-238839268 ATCAGCCACATGGCTATCTGGGG + Intergenic
948984334 2:241510948-241510970 CCCAGCTACATGGGGAGCTGAGG - Intergenic
1168796883 20:616426-616448 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1168974749 20:1955898-1955920 CCCAGCTACTTGGTAATCAGAGG - Intergenic
1169101473 20:2953721-2953743 CCCAGCCACTTGGAAGTCTGAGG - Intronic
1169121171 20:3096793-3096815 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1169202993 20:3723377-3723399 CCCAGCTACTTGGGTGTCTGCGG + Intergenic
1169350711 20:4865946-4865968 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1169376401 20:5069823-5069845 CCCAGCCACCTGGGTGGCTGAGG - Intronic
1169692039 20:8342948-8342970 CCCATCCACATGGATATCCAAGG + Intronic
1169890591 20:10447814-10447836 CCCAGCTACATGGGAAACTGAGG - Intronic
1169951344 20:11047544-11047566 CCAAGCCACAAGTTTATCTTTGG - Intergenic
1170069240 20:12345944-12345966 CCCAGCCACATGGGATGCTGAGG - Intergenic
1170440854 20:16377466-16377488 CCCAGCCACTTGGGTGGCTGGGG + Intronic
1170611843 20:17920617-17920639 CCCAGCTACATGGAAAGCTGAGG + Intergenic
1170751788 20:19154925-19154947 CCCAGCCACATGGAACTGTGAGG - Intergenic
1171338886 20:24411838-24411860 CCCAGCCACCAGGATACCTGTGG + Intergenic
1171974533 20:31586084-31586106 CCCAGCAACTTGGGAATCTGGGG - Intergenic
1172000599 20:31773265-31773287 CCCAGCCACATGGGAGACTGAGG - Intronic
1172343220 20:34175781-34175803 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1172497201 20:35396098-35396120 CCCAGCCACTTGGGAGTCTGAGG - Intronic
1173316399 20:41948637-41948659 CCCAGGCACATGGCACTCTGTGG - Intergenic
1173353701 20:42267731-42267753 CCCAGCACCATGGATGTCTGGGG - Intronic
1173421930 20:42909037-42909059 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1173574294 20:44100788-44100810 CCCAGCTACTTGGAAATCTGAGG - Intergenic
1173937788 20:46882290-46882312 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1173948017 20:46967107-46967129 CCCAGCTACTTGGGTGTCTGAGG - Intronic
1174141790 20:48419850-48419872 CCCAGCTACATGGAAAGCTGAGG - Intergenic
1174304238 20:49603875-49603897 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1174350130 20:49961213-49961235 CCCAGCTACATGGAAAGCTGAGG + Intergenic
1174382666 20:50166841-50166863 CCCAGCTACTTGGGTACCTGAGG - Intergenic
1174540147 20:51282804-51282826 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1174756226 20:53161220-53161242 CCCAGCCAAATGAATGTCTGCGG + Intronic
1174789727 20:53466129-53466151 CCCAGCCACTTGGGTGGCTGAGG + Intronic
1175897212 20:62343658-62343680 CCCAGCTACATGGTAAGCTGAGG + Intronic
1176697939 21:10003183-10003205 CCCAGCTACTTGGTTGGCTGAGG + Intergenic
1176895949 21:14378733-14378755 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1177471480 21:21565407-21565429 CCCAGCTACTTGGATAGCTGAGG + Intergenic
1177511627 21:22094087-22094109 CCCAGCCACTTGGGAGTCTGAGG + Intergenic
1177557308 21:22708702-22708724 CCCAGCTACTTGGGAATCTGAGG + Intergenic
1181029607 22:20143447-20143469 CCCAGCCACAAGGTCGTCTCTGG - Exonic
1181857999 22:25796478-25796500 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1182613160 22:31566207-31566229 CCCAGCTACATGGGAAGCTGAGG - Intronic
1183399187 22:37591493-37591515 CCCAGCCACTTGGGTGGCTGAGG - Intergenic
1183599414 22:38831289-38831311 CCCAGCCACTTGGGTGGCTGAGG + Intronic
1183985571 22:41568397-41568419 CCCAGCTACTTGGGCATCTGAGG - Intronic
1183997513 22:41646185-41646207 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1185122405 22:48979849-48979871 CCCTGCCCCATGGTTACCTATGG + Intergenic
949910215 3:8897954-8897976 CCCAGCCACTTGGGAAGCTGAGG + Intronic
949997476 3:9629588-9629610 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
950082260 3:10231405-10231427 CCCAGCTACATGGGAAGCTGAGG - Intronic
950711750 3:14818158-14818180 ACTTGCCACATGGATATCTGTGG - Intergenic
951638157 3:24803190-24803212 CCCAGCTACATGATTGGCTGAGG + Intergenic
951773193 3:26281463-26281485 GCCAGTCACATGGTCCTCTGGGG - Intergenic
952485515 3:33805858-33805880 CCCAGCTACATGGTAGGCTGAGG - Intronic
952906879 3:38145447-38145469 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
953744527 3:45564089-45564111 CCCAGCATCTGGGTTATCTGTGG + Intronic
953804591 3:46057211-46057233 CCCAGCTACTTGGCTAGCTGAGG - Intergenic
953911321 3:46894502-46894524 CCCAGTCACATCGAGATCTGGGG + Intronic
953988400 3:47463580-47463602 CCCAGCTACATGGGAAACTGAGG + Intronic
954120808 3:48498569-48498591 CCCAGCTACATGGGAAGCTGAGG + Intronic
954235479 3:49253947-49253969 CCCAGCTACTTGGTTGGCTGAGG - Intronic
954238112 3:49272665-49272687 CCCAGCCACTTGGATGGCTGAGG - Intronic
954487621 3:50868487-50868509 CCCAGCTACTTGGGGATCTGAGG - Intronic
955173717 3:56590641-56590663 CCCAGCTACTTGGGAATCTGAGG + Intronic
955382862 3:58454767-58454789 CCCAGCCACTTGGGTGGCTGAGG - Intergenic
955812636 3:62807375-62807397 CCCAGCTACTTGGGAATCTGAGG - Intronic
957245924 3:77716054-77716076 CCCAGCCAAATGGTATTCAGAGG + Intergenic
958075109 3:88666549-88666571 CCCAGCCACATGGGAGGCTGAGG - Intergenic
959747022 3:109787414-109787436 CCCAGCTACATGGGAAGCTGAGG + Intergenic
960886357 3:122399441-122399463 CCCAGCTACTTGGGTAGCTGAGG - Intronic
961023753 3:123533262-123533284 CCCAGCTACTTGGGAATCTGAGG - Intronic
961379521 3:126487956-126487978 CCCTGCCACATGGGTCTCAGGGG - Intronic
961724563 3:128918355-128918377 CCCAGCCACTTGGGAAGCTGAGG + Intronic
961748474 3:129081358-129081380 GCCAGCCACACTGTGATCTGTGG - Intergenic
962354696 3:134683937-134683959 CCCAGCCACATGCTCACCTGTGG + Intronic
962557629 3:136571763-136571785 CCCAGCCACTTGGAAAGCTGAGG + Intronic
963152775 3:142064067-142064089 CCCAGCTACTTGGATAGCTGAGG - Intronic
964355405 3:155847090-155847112 CCCAGCTACTTGGGAATCTGAGG + Intronic
964388747 3:156176503-156176525 CACAGCCACAGTTTTATCTGTGG + Intronic
964427155 3:156565951-156565973 CCCAGCTACATGGGAAGCTGAGG + Intergenic
964750046 3:160046162-160046184 CCCAGCTACATGGGTGGCTGAGG + Intergenic
965408546 3:168301393-168301415 CCCAGCTACATGGGAAGCTGAGG + Intergenic
966185067 3:177219862-177219884 CCCAGCTACATGGGAAGCTGAGG + Intergenic
966217398 3:177517832-177517854 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
966245600 3:177804621-177804643 ATGAGCCACATGGATATCTGGGG + Intergenic
966528931 3:180951949-180951971 CCCAGCTACTTGGGAATCTGAGG + Intronic
966843954 3:184111978-184112000 CCCAGCTACTTGGTTGGCTGAGG - Intergenic
968012177 3:195290251-195290273 CCCAGCCACTTGGGAAGCTGAGG + Intronic
968193473 3:196688139-196688161 CCTAGCTACATGGTTAAGTGAGG - Intronic
968225923 3:196972035-196972057 CCCAGCTACATGGGAGTCTGAGG - Intergenic
968368303 3:198204352-198204374 CTCAGCCACATGAGTAACTGGGG - Intergenic
969421963 4:7102714-7102736 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
969972250 4:11060085-11060107 CCCAGCCACATGGGAAGCTGAGG - Intergenic
970420660 4:15903126-15903148 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
970569869 4:17369166-17369188 CCCAGCTACATGGGAAGCTGAGG + Intergenic
970978424 4:22069203-22069225 GAAAGCCACATGGATATCTGAGG + Intergenic
972073733 4:35056819-35056841 CCCACCCACATGAGTATCTTAGG + Intergenic
972554623 4:40169264-40169286 CCCAGCTACTTGGGTGTCTGAGG + Intergenic
972564086 4:40254466-40254488 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
972580002 4:40386746-40386768 CCCAGCTACATGGGAAGCTGAGG - Intergenic
972773928 4:42224121-42224143 CCCAGCTACATGGGAACCTGAGG - Intergenic
973113169 4:46420675-46420697 CCCAGCCAGATATTCATCTGGGG - Intronic
973710297 4:53623317-53623339 CCCAGCTACTTGGTAAACTGAGG - Intronic
973711596 4:53634939-53634961 CCCAGCAACATGGGAAGCTGAGG - Intronic
974022650 4:56705551-56705573 ACCAGCCCCATGATTATGTGAGG - Intergenic
974040484 4:56853002-56853024 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
975038557 4:69714243-69714265 CCCAGCTACACGGTTGGCTGAGG + Intergenic
975573851 4:75843734-75843756 CCCAGCTACATGGGAGTCTGAGG - Intergenic
975579099 4:75891066-75891088 CCCAGCTACTTGGGTATCTGAGG + Intronic
975816708 4:78224646-78224668 CCCAGCTACATGGGAAGCTGAGG - Intronic
976288765 4:83396301-83396323 CCCAGCCACTCGGGTGTCTGAGG - Intergenic
976709521 4:88054283-88054305 CCCAGCTACTTGGGAATCTGAGG + Intronic
976971996 4:91115440-91115462 CCCAACCACTTGGTAGTCTGAGG - Intronic
977196755 4:94072129-94072151 CCCAGCTACATGGGAAGCTGAGG + Intergenic
978128101 4:105159369-105159391 CCCAGCTACTTGGGTGTCTGAGG - Intronic
978191351 4:105916333-105916355 CCCAGCCACTTGGGTGGCTGAGG - Intronic
978419154 4:108511674-108511696 CACAACCACATGGTTGTCTGTGG - Intergenic
978797041 4:112718751-112718773 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
979256731 4:118614075-118614097 CTCAGCCACATGAGTAACTGGGG - Intergenic
979265910 4:118702658-118702680 CCCAGCCACTTGGGAAGCTGAGG + Intronic
979331618 4:119426470-119426492 CTCAGCCACATGAGTAACTGGGG + Intergenic
980129519 4:128805452-128805474 CCCAGCTACTTGGTAAGCTGAGG - Intergenic
980370488 4:131863036-131863058 CCCAGCTACTTGGTTGGCTGAGG + Intergenic
980403440 4:132323204-132323226 CCCAGCTACTTGGATGTCTGAGG + Intergenic
980939967 4:139264540-139264562 CCCAGCTACATGGGAAGCTGAGG - Intergenic
981219483 4:142214666-142214688 CCCAGCTACATGGTAGGCTGAGG - Intronic
981438295 4:144751983-144752005 CCCAGCTACATGGGAAGCTGAGG + Intergenic
982104090 4:151996798-151996820 CCCAGCCACTTGGGAGTCTGAGG + Intergenic
983171695 4:164543291-164543313 CCCAGCTACATGGGAGTCTGAGG - Intergenic
983882386 4:172948063-172948085 GCCAGCCACCTGGTTAGTTGAGG + Intronic
984442983 4:179796993-179797015 CCCAGCTACATGGTAGGCTGAGG + Intergenic
984552444 4:181176893-181176915 CCCAGCCACTTGGGAATCTGAGG - Intergenic
984789636 4:183603621-183603643 CCCAGCTACATGGGAAGCTGAGG + Intergenic
984823199 4:183902533-183902555 CCCAGGTACATGATTGTCTGAGG + Intronic
984836720 4:184029128-184029150 CTCAGCCACATGGTTTCCTTGGG + Intergenic
985489129 5:168989-169011 CCCAGCCACTTGGGAAGCTGAGG - Intronic
986260889 5:6145416-6145438 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
987035315 5:14013294-14013316 CCCCGCCTCATGGAGATCTGGGG - Intergenic
987154346 5:15073441-15073463 CCCAGCAACATAGTCCTCTGTGG + Intergenic
987180937 5:15367878-15367900 CCCAGCCACATGGAACTGTGAGG + Intergenic
987337700 5:16911614-16911636 CCCAGCTACTTGGGTAACTGAGG + Intronic
988288858 5:29258342-29258364 CCCAGCTACATGGGGAACTGAGG + Intergenic
988928040 5:36008964-36008986 TCCAGCCCCATGGTTTTGTGGGG + Intergenic
989620716 5:43381473-43381495 CCCAGCCACATGGGAGGCTGAGG - Exonic
990196495 5:53322789-53322811 CCCCACCACAAGTTTATCTGGGG + Intergenic
990413114 5:55560887-55560909 CCCAGCCACAGGGTTAGCTAGGG - Intergenic
991020230 5:61972468-61972490 CCCAGCCACTTAGTAATGTGTGG + Intergenic
991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG + Intergenic
991699766 5:69306442-69306464 CCCAGCTACATGGGAAGCTGAGG - Intronic
992498012 5:77312217-77312239 CCCAGCTACTTGGGTAGCTGAGG - Intronic
992799490 5:80282647-80282669 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
993050768 5:82923474-82923496 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
994232606 5:97325117-97325139 CCCAGCCTCCTGGGTAGCTGGGG - Intergenic
994360677 5:98845704-98845726 CCCAGCCACCTGGGAGTCTGAGG - Intergenic
994370102 5:98958272-98958294 CCCAGCTACTTGGGTAACTGAGG - Intergenic
995601193 5:113798612-113798634 CAGAGCCACATGGTGACCTGTGG - Intergenic
995692165 5:114839354-114839376 CCCAGCAACATGGAGATTTGAGG - Intergenic
995868934 5:116724277-116724299 CCCAGCCAGGTGAATATCTGGGG + Intergenic
995969310 5:117948433-117948455 CCCAGCTACTTGGTAAGCTGAGG - Intergenic
996209726 5:120793034-120793056 TCCAGCTACTTGGTTAGCTGAGG + Intergenic
997130321 5:131269943-131269965 CCCAGCCACTTGGGAGTCTGAGG + Intronic
997231565 5:132248105-132248127 CCCAGCCACCTGAGTAGCTGGGG + Intronic
998013759 5:138716281-138716303 CCCAGCTACTTGGTAAACTGAGG - Intronic
998018270 5:138750263-138750285 CCCAGCTACTTGGTAAGCTGAGG + Intronic
998676351 5:144412768-144412790 CCCAGCTACTTGGGTAGCTGAGG + Intronic
998924779 5:147110508-147110530 CCCCTCCACATGGTTATCTTGGG - Intergenic
999456007 5:151716892-151716914 CCCAGCCACCTGGGAAGCTGAGG + Intergenic
999829155 5:155302728-155302750 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1000904583 5:166949158-166949180 TCTAGCCACATTGTTATCTGAGG + Intergenic
1001439744 5:171733314-171733336 CCCAGCTACTTGGGTGTCTGAGG + Intergenic
1001502170 5:172245594-172245616 CCCAGCTACTTGGGTAGCTGAGG + Intronic
1002727524 5:181309579-181309601 CTCAGCCACATGAGTAACTGGGG - Intergenic
1003249685 6:4415259-4415281 CCCAGACTCATGGTTAGTTGTGG + Intergenic
1004155716 6:13166131-13166153 GCCAGCCATCTGGATATCTGGGG - Intronic
1004197571 6:13518663-13518685 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1004286186 6:14322880-14322902 CCCAGGCACATGGGAATCTTTGG - Intergenic
1004369443 6:15039469-15039491 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1004499373 6:16196400-16196422 CCCAGCTACTTGGTAAGCTGAGG + Intergenic
1004511167 6:16285706-16285728 CCCAGTCACTAGGTCATCTGGGG + Intronic
1004595397 6:17094673-17094695 CCCAGCCACCTGGTCAGCTGAGG - Intergenic
1004889667 6:20088562-20088584 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1005474621 6:26196010-26196032 CCCAGCTACATGGAAAGCTGAGG - Intergenic
1005810452 6:29511221-29511243 TCCAGCCCCATGGATATCTCAGG - Intergenic
1005853304 6:29839307-29839329 CCCAGCTACTTGGGTGTCTGAGG - Intergenic
1006450359 6:34102474-34102496 GCGAGCCACATGCATATCTGGGG - Intronic
1006515819 6:34545063-34545085 CCCTCCCACAGGGCTATCTGGGG + Intronic
1007125101 6:39419236-39419258 CCCAGTCACATGGGAAGCTGAGG + Intronic
1007162280 6:39801354-39801376 CCCAACCCCATGCTAATCTGAGG + Intronic
1007486670 6:42185240-42185262 CCCAGCCTCAGGGCTATGTGGGG - Intronic
1007664810 6:43507910-43507932 TCCTGCCACATGGTCACCTGGGG + Exonic
1009609885 6:65927776-65927798 CCCAGCCACATGGAAGGCTGAGG - Intergenic
1011077475 6:83452599-83452621 CCCAGCCACTTGGCTGGCTGAGG + Intergenic
1011411149 6:87067824-87067846 CCCAGCAGCATTGTGATCTGAGG + Intergenic
1012846251 6:104393198-104393220 TCCAGCCACATGGATCTCTTGGG - Intergenic
1013213455 6:108006865-108006887 CCCAGCTACTTGGGTGTCTGAGG - Intergenic
1013320881 6:108987916-108987938 CCCAGCTACATGGGAAGCTGAGG - Intronic
1013715272 6:112953349-112953371 GCAAGTCACATGCTTATCTGGGG + Intergenic
1014254253 6:119145475-119145497 CCTAGCCCCTTGGTTCTCTGTGG - Intronic
1014443389 6:121498731-121498753 CCCAGCTACTTGGTTGGCTGAGG - Intergenic
1015098131 6:129441865-129441887 CCCAGCCACTTGGGAGTCTGAGG + Intronic
1015292778 6:131557601-131557623 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
1015388991 6:132660107-132660129 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
1015630389 6:135226709-135226731 CAGAGCCACATGCTTAACTGTGG + Intergenic
1015696841 6:135990209-135990231 CCCAGCCACTTGGTAGGCTGAGG - Intronic
1015813686 6:137186198-137186220 CCCAGCCCCAGGGTGATCTCAGG - Intergenic
1016021396 6:139239606-139239628 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1016303824 6:142661702-142661724 CCCAGCTACTTGAGTATCTGAGG - Intergenic
1016415966 6:143834130-143834152 CCCAGCCACTTGGTAGGCTGAGG + Intronic
1016785023 6:148001720-148001742 CCTACCCACATGGCTCTCTGAGG + Intergenic
1016836293 6:148480212-148480234 CCCAGCTACATGGGAAGCTGAGG + Intronic
1017238912 6:152145907-152145929 CCCAGCTACATGGGAGTCTGAGG + Intronic
1017483556 6:154881840-154881862 CCCAGCTACATGGGAAGCTGAGG + Intronic
1017957636 6:159191983-159192005 CCCAGCTACATGGGAAGCTGAGG - Intronic
1018368243 6:163144111-163144133 CCCAGCTACATGGGAGTCTGGGG + Intronic
1018671480 6:166181537-166181559 CCCAGCTACTTGGTTGGCTGAGG - Intergenic
1018777701 6:167033224-167033246 CCCAGCTACATGGGAAGCTGAGG - Intronic
1019762112 7:2820852-2820874 CCCAGCTACATGGGAGTCTGAGG - Intronic
1019824157 7:3269716-3269738 CCCAGCTACTTGGGAATCTGAGG + Intergenic
1019944767 7:4318646-4318668 CACAGCCACATGGCAATGTGGGG - Intergenic
1020128221 7:5545056-5545078 CCCAGCCACTTGGGAAACTGAGG + Intronic
1020200734 7:6077800-6077822 CCCAGCAACTTGGTTGGCTGAGG - Intergenic
1020234569 7:6345882-6345904 CCCAGCTACATGGTAGGCTGAGG - Intronic
1021036078 7:15800763-15800785 CTCAGCCTCCTGGGTATCTGGGG - Intergenic
1021229663 7:18070961-18070983 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
1021729068 7:23578902-23578924 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1021752495 7:23817070-23817092 CCCAGCTACTTGGGAATCTGAGG + Intronic
1022129393 7:27390548-27390570 CCCAGCTACCTGGGTAGCTGAGG + Intergenic
1022268409 7:28782012-28782034 CCCAGCTACATGGGAAGCTGAGG - Intronic
1022941349 7:35243091-35243113 CCCAGCCACTTGGGTGGCTGAGG - Intronic
1023315885 7:38936017-38936039 CCCAGCTACTTGGTAGTCTGAGG - Intergenic
1023822934 7:43990161-43990183 CCCAGCCATAGGGCTCTCTGCGG - Intergenic
1024420673 7:49162072-49162094 ACCCCCAACATGGTTATCTGAGG - Intergenic
1024603923 7:51009910-51009932 GCCAGCCACAGGGCAATCTGGGG + Intergenic
1024835970 7:53519252-53519274 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1025139590 7:56450893-56450915 CTCAGCCTCCTGGTTATCTGGGG - Intergenic
1025164055 7:56695292-56695314 CCCAGCTACTTGGTAGTCTGAGG + Intergenic
1025239789 7:57261575-57261597 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1025960716 7:66218729-66218751 CCCAGCTACTTGGGTGTCTGAGG + Intronic
1026312917 7:69203636-69203658 CCCAGCCACTTGGGTGGCTGAGG - Intergenic
1026420869 7:70235765-70235787 CCCAGCTACATGGTGGGCTGAGG - Intronic
1026470249 7:70689059-70689081 CCCAGCCACATGGATATTCTTGG - Intronic
1026593587 7:71715956-71715978 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1026962409 7:74417232-74417254 CCCAGCTACTTGGTTGGCTGAGG + Intergenic
1027236180 7:76299286-76299308 CCCAGCCACTTGGGAGTCTGAGG + Intergenic
1027664220 7:81024225-81024247 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1027762466 7:82297128-82297150 CTCAGCCACCTGATTAGCTGGGG - Intronic
1027912609 7:84271301-84271323 CCCAGCTACATGGAAAGCTGAGG - Intronic
1028730319 7:94140311-94140333 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1029463224 7:100708485-100708507 CCCAGCTACCTCGTTAGCTGAGG + Intergenic
1029530726 7:101123539-101123561 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1029591586 7:101510621-101510643 CCCAGCTACATGGGAAGCTGAGG - Intronic
1029645245 7:101850991-101851013 CCCAGCTACATGGGTAGCTGGGG + Intronic
1029716089 7:102326994-102327016 CCCAGCCACCTGGGAGTCTGAGG + Intergenic
1030332473 7:108285826-108285848 CCCATCCACATAGTTACCTTAGG + Intronic
1030655982 7:112168587-112168609 CCCAGCCACCTGGGAACCTGAGG + Intronic
1032002417 7:128273983-128274005 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1032049039 7:128634846-128634868 CTCAGCCACATGAGTAACTGGGG - Intergenic
1032235556 7:130119091-130119113 CCCAGCTACCTGGACATCTGAGG + Intronic
1033035610 7:137873464-137873486 CCCAGACTCATGGGCATCTGGGG - Intergenic
1033137479 7:138797331-138797353 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1033265232 7:139879997-139880019 CCCAGCAACTTGGTTGGCTGAGG - Intronic
1033826347 7:145194843-145194865 CCCAGCTCCAGGGTTCTCTGTGG - Intergenic
1035142965 7:156782658-156782680 CCCAGCTACTTGGGTAGCTGAGG - Intronic
1035410727 7:158638353-158638375 CCCAGCTACATGGACAGCTGAGG - Intronic
1035494572 7:159312155-159312177 CCCAGCTACTTGGTGAACTGAGG + Intergenic
1036296951 8:7545023-7545045 CCAAGCAACATGGTTTTCTTCGG - Intergenic
1036325616 8:7775996-7776018 CCAAGCAACATGGTTTTCTTCGG + Intergenic
1037234188 8:16697029-16697051 CCCAGCTACATGGGAAGCTGAGG + Intergenic
1037463443 8:19136194-19136216 CCCAGCTACTTGGGAATCTGAGG + Intergenic
1037494796 8:19428298-19428320 CCCAGCCACATGGAACTGTGAGG - Intronic
1037744119 8:21629722-21629744 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1038219492 8:25593920-25593942 CCCAGCTACATGGGAGTCTGAGG - Intergenic
1038568855 8:28642328-28642350 CCCAGCCACTTGGGAAACTGAGG + Intronic
1038740329 8:30211469-30211491 CCCAGCCTCATGGCAACCTGGGG - Intergenic
1038769192 8:30460933-30460955 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1039062462 8:33582462-33582484 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1039736145 8:40335098-40335120 CCCAGCCTCTTGGGAATCTGAGG + Intergenic
1039758451 8:40548077-40548099 TCCAGCCACATGGATTTCTTAGG - Intronic
1040010597 8:42658140-42658162 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1040033664 8:42848455-42848477 CCCAGCTACATGGGTGGCTGAGG - Intergenic
1040491024 8:47922354-47922376 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1040930203 8:52726217-52726239 CCCAGCCACTTGGGAGTCTGTGG + Intronic
1041474536 8:58249042-58249064 CCCAGCCACATGCTGCACTGTGG - Intergenic
1041506415 8:58603370-58603392 CTCCGCCACATGGTGCTCTGGGG + Exonic
1041656372 8:60354792-60354814 CCCAGCTACCTGGGTAGCTGAGG + Intergenic
1041863396 8:62539703-62539725 CCCAGCCACCTGGGTGGCTGAGG - Intronic
1041918633 8:63160283-63160305 CCCAGCTACATGGGAAGCTGAGG - Intergenic
1042139872 8:65667158-65667180 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1042288144 8:67137095-67137117 CCCAGCTACTTGGGTGTCTGAGG - Intronic
1042585632 8:70335005-70335027 CCCAGCTACTTGGTAAGCTGAGG + Intronic
1043698847 8:83257655-83257677 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
1044579779 8:93813292-93813314 CCCAGCTACTTGGGTAGCTGAGG - Intronic
1044857532 8:96491978-96492000 CCCAGCTACTTGGTAAGCTGAGG + Intergenic
1045160410 8:99536063-99536085 CCCAGCTACATGGGAGTCTGAGG - Intronic
1046720921 8:117618159-117618181 GCCAGCCACTTCTTTATCTGTGG - Intergenic
1046987945 8:120411175-120411197 CCCAGCTACTTGGTAGTCTGAGG - Intronic
1048551052 8:135433803-135433825 TCCAGCCACATCCTTCTCTGGGG - Intergenic
1048806808 8:138248702-138248724 CCCAGCTACTTGGGTAGCTGAGG + Intronic
1048937120 8:139366640-139366662 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
1048999447 8:139815501-139815523 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1049028929 8:140018437-140018459 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1049884691 9:19136-19158 GCCAGCCACAGGGATGTCTGGGG - Intergenic
1050347012 9:4700269-4700291 CCCAGCTACCTGGGAATCTGAGG - Intronic
1050517757 9:6462799-6462821 CCCAGCTACATGGGTGGCTGAGG + Intronic
1050834409 9:10057725-10057747 CCCAGCTACTTGGGAATCTGAGG + Intronic
1050890981 9:10824101-10824123 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1051408378 9:16763452-16763474 CCCAGCTACATGGGAAGCTGAGG + Intronic
1051445969 9:17139542-17139564 CCCAGCTACATGGGAAGCTGAGG + Intronic
1051496973 9:17734243-17734265 TTCAGCCACATGTTTGTCTGAGG + Intronic
1052303361 9:26977345-26977367 CCCAGCTACTTGGATAGCTGAGG + Intronic
1053086722 9:35230353-35230375 CCCAGCTACTTGGGTAGCTGAGG + Intronic
1053115537 9:35498421-35498443 CCCAGCTACTTGGGTAGCTGAGG + Intronic
1053506567 9:38648537-38648559 CCCAGCTACTTGGTTGGCTGAGG + Intergenic
1053616955 9:39777430-39777452 ACCAGCCACATGGGAAACTGAGG - Intergenic
1053635067 9:39989524-39989546 CCCAGCTACTTGGTTGGCTGAGG + Intergenic
1053770863 9:41474784-41474806 CCCAGCTACTTGGTTGGCTGAGG - Intergenic
1053875135 9:42536783-42536805 ACCAGCCACATGGGAAACTGAGG - Intergenic
1054208820 9:62261173-62261195 CCCAGCTACTTGGTTGGCTGAGG - Intergenic
1054236562 9:62564945-62564967 ACCAGCCACATGGGAAACTGAGG + Intergenic
1054267213 9:62930007-62930029 ACCAGCCACATGGGAAACTGAGG + Intergenic
1054315986 9:63586971-63586993 CCCAGCTACTTGGTTGGCTGAGG + Intergenic
1054549595 9:66386610-66386632 CCCAGCTACTTGGTTGGCTGAGG - Intergenic
1054550701 9:66599452-66599474 ACCAGCCACATGGGAAACTGAGG + Intergenic
1054749194 9:68887021-68887043 GCAAGCCACATGGCTATCTGGGG - Intronic
1055432628 9:76259341-76259363 CCCAGCCACATTGGTATCTTGGG - Intronic
1055434674 9:76280618-76280640 CCCAGCTACATGGTGGGCTGAGG + Intronic
1055571432 9:77621047-77621069 CCCAGCTACATGGGAAGCTGAGG - Intronic
1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG + Intronic
1055960057 9:81811926-81811948 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1056078497 9:83064950-83064972 CCCAGCTACTTGGATAGCTGAGG + Intergenic
1056159007 9:83869609-83869631 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1056398141 9:86200332-86200354 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1056421507 9:86432040-86432062 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1056594400 9:87994299-87994321 CCCAGCTACTTGGGTAGCTGAGG - Intergenic
1056792264 9:89633527-89633549 CCCATCCTCATGGTTATCCTGGG - Intergenic
1057127880 9:92633474-92633496 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1057155996 9:92839929-92839951 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1057364506 9:94406353-94406375 CCCAGCTACATGGGAGTCTGAGG - Intronic
1057588946 9:96355132-96355154 CCCAGCTACTTGGGTGTCTGAGG - Intronic
1057658827 9:96981715-96981737 CCCAGCTACATGGGAGTCTGAGG + Intronic
1058786746 9:108395137-108395159 CCCAGCCACATGTATGTTTGGGG + Intergenic
1058994469 9:110286214-110286236 GCCAGCTACATGGGTAGCTGAGG + Intergenic
1059152824 9:111964712-111964734 CCCAGCTACTTGGGTAACTGAGG + Intergenic
1059291876 9:113232726-113232748 CCCAGCCACTTGGTAGGCTGAGG + Intronic
1059879309 9:118672538-118672560 CCCAGCCACTTGGTAGGCTGAGG - Intergenic
1061089129 9:128416968-128416990 CCCAGCCACTTGGGATTCTGAGG - Intronic
1061141051 9:128767056-128767078 CCCAGCTACTTGGTTGGCTGAGG - Intronic
1061311084 9:129763010-129763032 CCCAGCCACTTGGGAGTCTGAGG + Intergenic
1061686698 9:132286234-132286256 CCCAGCCACATGGGAGACTGAGG + Intronic
1061998153 9:134199001-134199023 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
1062440078 9:136565862-136565884 CCTGGCCACATGGTGATCTATGG + Intergenic
1062548499 9:137074834-137074856 CCCAGCCACACGTTTCTCTGGGG + Intergenic
1062726943 9:138079625-138079647 CCCAGCCACCTGGGGAGCTGAGG + Intronic
1062752644 9:138267057-138267079 CTCAGCCACATGAGTAACTGGGG - Intergenic
1203575161 Un_KI270745v1:1832-1854 CTCAGCCACATGAGTAACTGGGG - Intergenic
1185926379 X:4151705-4151727 CCCAGCCACTTGGGAACCTGAGG - Intergenic
1186269025 X:7865144-7865166 CCCAGCCATTTGGTTGCCTGGGG + Intergenic
1186273714 X:7918261-7918283 CCCAGCCACATGGAATTGTGAGG - Intronic
1186393398 X:9183298-9183320 CCCATCCACTTGGGTCTCTGTGG + Intergenic
1186797823 X:13063730-13063752 CCCAGCTACTTGGTAAGCTGAGG - Intergenic
1187175034 X:16888634-16888656 GGGAGCCACATGGCTATCTGGGG + Intergenic
1187319385 X:18226484-18226506 ACCAGGCACATGGGCATCTGTGG - Intergenic
1187323403 X:18262829-18262851 CCCAGCTACATGGGAAGCTGAGG - Intronic
1187423061 X:19153359-19153381 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1187879359 X:23831999-23832021 CCCAGCTACTTGGGTGTCTGTGG - Intergenic
1188600691 X:31959878-31959900 CCCAGCTACATGGGAGTCTGAGG - Intronic
1189089248 X:38062081-38062103 CCCAGCCACTTGGGAAACTGAGG - Intronic
1189156714 X:38765166-38765188 CCCAGCTACTTGGGTAGCTGAGG + Intergenic
1189522334 X:41783027-41783049 CCCAGCTACATGGGAAGCTGAGG + Intronic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1190254158 X:48750077-48750099 CCCAGCCACTTGGGAAGCTGAGG + Intergenic
1190586124 X:51944467-51944489 CCCAGCTACTTGGGAATCTGAGG - Intergenic
1190661793 X:52661549-52661571 CCCAGCCACATGGGAGGCTGAGG - Intronic
1191055974 X:56241279-56241301 CCCAGCCACTTGGTAGGCTGAGG - Intronic
1192131289 X:68553694-68553716 CCCAGCTACTTGGTAAGCTGAGG - Intergenic
1192416041 X:70981582-70981604 CCCAACTACATGGTGAGCTGAGG + Intergenic
1192828084 X:74719671-74719693 CCCAGCTACTTGGTTGGCTGAGG + Intergenic
1192831016 X:74751112-74751134 CCCAGCCACTTGGTGGGCTGAGG + Intronic
1193128719 X:77896941-77896963 CCCAGCTACATGGGAGTCTGAGG + Intergenic
1193823245 X:86191823-86191845 CCCAGCCACTTGGGAAGCTGAGG + Intronic
1194214186 X:91108385-91108407 CCCAGCCACACGGGAGTCTGAGG + Intergenic
1194326548 X:92525513-92525535 CCCAGCTACATGGGTGGCTGAGG + Intronic
1195667859 X:107446940-107446962 CCCAGCTACATGATTTTCTGGGG + Intergenic
1195677626 X:107519379-107519401 CCCAGCTACTTGGGTGTCTGAGG + Intergenic
1195949087 X:110248268-110248290 ACCAGCCACATGGGTGGCTGAGG + Intronic
1196674477 X:118405149-118405171 CCCAGCTACTTGGTAAGCTGAGG - Intronic
1197876943 X:131118496-131118518 CCCAGCCACTTGGGAAGCTGAGG - Intergenic
1198275166 X:135093228-135093250 CCCAGCTACTTGGTTGGCTGAGG - Intergenic
1199671488 X:150151736-150151758 CCCAGCCCCATGGCTACCTGGGG + Intergenic
1199774130 X:150996130-150996152 CCCAGCCACATGGGAGGCTGAGG - Intergenic
1200055654 X:153458872-153458894 CCCAGCCACTTGGGAAGCTGAGG - Intronic
1200401116 X:156021016-156021038 GCCAGCCACAGGGATGTCTGGGG + Intergenic
1200635263 Y:5644716-5644738 CCCAGCTACATGGGTGGCTGAGG + Intronic
1201328445 Y:12792168-12792190 CCCAGCTACATGGGTGGCTGAGG + Intronic
1201652998 Y:16312064-16312086 CCCAGCTACCTGGTAAGCTGAGG + Intergenic