ID: 1155209154

View in Genome Browser
Species Human (GRCh38)
Location 18:23586251-23586273
Sequence GGCCACCGGGACGCCCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155209154_1155209167 27 Left 1155209154 18:23586251-23586273 CCCCACAGGGCGTCCCGGTGGCC 0: 1
1: 0
2: 2
3: 20
4: 107
Right 1155209167 18:23586301-23586323 GTAGCAGCAGGAGGAGGCCAAGG 0: 1
1: 0
2: 9
3: 80
4: 703
1155209154_1155209164 15 Left 1155209154 18:23586251-23586273 CCCCACAGGGCGTCCCGGTGGCC 0: 1
1: 0
2: 2
3: 20
4: 107
Right 1155209164 18:23586289-23586311 GCGCTGGACACAGTAGCAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 119
1155209154_1155209166 21 Left 1155209154 18:23586251-23586273 CCCCACAGGGCGTCCCGGTGGCC 0: 1
1: 0
2: 2
3: 20
4: 107
Right 1155209166 18:23586295-23586317 GACACAGTAGCAGCAGGAGGAGG 0: 1
1: 0
2: 2
3: 45
4: 561
1155209154_1155209165 18 Left 1155209154 18:23586251-23586273 CCCCACAGGGCGTCCCGGTGGCC 0: 1
1: 0
2: 2
3: 20
4: 107
Right 1155209165 18:23586292-23586314 CTGGACACAGTAGCAGCAGGAGG 0: 1
1: 0
2: 1
3: 29
4: 255
1155209154_1155209161 -1 Left 1155209154 18:23586251-23586273 CCCCACAGGGCGTCCCGGTGGCC 0: 1
1: 0
2: 2
3: 20
4: 107
Right 1155209161 18:23586273-23586295 CGGCGACCGCTCACCTGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 60
1155209154_1155209168 28 Left 1155209154 18:23586251-23586273 CCCCACAGGGCGTCCCGGTGGCC 0: 1
1: 0
2: 2
3: 20
4: 107
Right 1155209168 18:23586302-23586324 TAGCAGCAGGAGGAGGCCAAGGG 0: 1
1: 0
2: 1
3: 35
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155209154 Original CRISPR GGCCACCGGGACGCCCTGTG GGG (reversed) Intronic
900143721 1:1149305-1149327 TGCCACGGGGGCACCCTGTGTGG + Intergenic
900145731 1:1158004-1158026 GGCCACCGGGGCGCCCACAGCGG - Intergenic
900409681 1:2507013-2507035 GGCCACCGGCAGGCCCTGCATGG + Intergenic
904380725 1:30109004-30109026 AGCCACCTGGACCCGCTGTGGGG + Intergenic
905690771 1:39941086-39941108 TGCCACAGGGAGGCCCTCTGCGG - Intergenic
906663310 1:47597921-47597943 GGTCACCAGGACACTCTGTGAGG - Intergenic
910935112 1:92480881-92480903 GGCCACCCGGCCGCGCTGTACGG - Exonic
913975152 1:143450029-143450051 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914069545 1:144275645-144275667 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914109610 1:144690709-144690731 GGCCAACTGGACGCCCTGGGAGG + Intergenic
917964566 1:180170147-180170169 GGAAGCAGGGACGCCCTGTGAGG + Intronic
919148645 1:193666931-193666953 GGACACCTTGACACCCTGTGTGG - Intergenic
1062860787 10:807636-807658 GGCCGCAGGGCCGCCCGGTGGGG - Exonic
1067260039 10:44681408-44681430 GGCCACAAGGACTCCCTGAGAGG - Intergenic
1069828297 10:71267751-71267773 GGCCAAAGGGAAGGCCTGTGTGG - Intronic
1069921426 10:71818025-71818047 GGTCACAGGGAAGCCCGGTGAGG + Intronic
1071514108 10:86285610-86285632 GGCATCCTGGAAGCCCTGTGTGG - Intronic
1074361219 10:112825312-112825334 GGGCACAGGCACACCCTGTGGGG + Intergenic
1076238769 10:128886443-128886465 GCCCACGGGGACCCCATGTGTGG + Intergenic
1076551300 10:131279675-131279697 GGCCACCCAGCCGCCCGGTGAGG + Intronic
1076789755 10:132770565-132770587 GGCCACCGGGGCGGCCAGCGAGG - Intronic
1076810394 10:132883575-132883597 GGGCACACGGTCGCCCTGTGTGG - Intronic
1076922886 10:133464797-133464819 GGGCACCGGGACCGCCTGGGTGG + Intergenic
1077374042 11:2197371-2197393 GGCCACCTGGACACCCTGCAGGG - Intergenic
1081906170 11:46671839-46671861 GGGCATCGGGACCCCCTGGGGGG - Intronic
1083615344 11:64023454-64023476 TGCCACAGTGAAGCCCTGTGAGG - Intronic
1083664161 11:64265643-64265665 GGACACAGGGACGCCTGGTGTGG - Intronic
1084527000 11:69703934-69703956 GGCGACCGGGATGCGCTGCGGGG + Exonic
1087545194 11:99575971-99575993 GGCCACCGGGGCCCTCTGTGTGG - Intronic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089296208 11:117469916-117469938 GGTCACCTGGATGCTCTGTGAGG + Exonic
1090204144 11:124875576-124875598 GGCCACCGCCACTCCCTGTGGGG - Exonic
1091059094 11:132445061-132445083 GGCCACCAGGACCTCCTCTGCGG + Intronic
1097218204 12:57430669-57430691 GGCGGCCCGGACGGCCTGTGGGG - Intronic
1101817125 12:108153773-108153795 GGCCAACGGGAGGCCCTGGCAGG - Intronic
1103685658 12:122730224-122730246 GGCAATGGGGTCGCCCTGTGTGG - Exonic
1104399010 12:128460348-128460370 GGCCACCTGGCTACCCTGTGAGG - Intronic
1108044177 13:46367234-46367256 TGGGACCGGGAAGCCCTGTGGGG - Intronic
1108453914 13:50594623-50594645 GGCCACCGGGTGGCCCCTTGGGG + Intronic
1114409266 14:22485440-22485462 GGTCACCGGGCTGCTCTGTGAGG + Intergenic
1118643563 14:67816464-67816486 GGCCGCAGGGACGCTCTCTGCGG + Intronic
1119219626 14:72895214-72895236 GGGCACCGGGAAGCTCTGGGGGG + Intergenic
1120537297 14:85712705-85712727 AGCCACCGGTACCCCCTGAGAGG - Intergenic
1122972151 14:105156748-105156770 GGCGGCCGGGACGCCCCTTGGGG - Intronic
1124339488 15:28880841-28880863 ACCCACCGGGAGGGCCTGTGAGG - Intergenic
1128247411 15:66142593-66142615 TGCCACAGGGAGGCCCTGTGAGG + Intronic
1128752557 15:70159610-70159632 GGTCAGTGGGAGGCCCTGTGGGG - Intergenic
1132398119 15:101489211-101489233 GGCGGCCGGGGCGCCCTGCGGGG - Intronic
1132650027 16:1016452-1016474 GCCCGCCGGGAAGCTCTGTGTGG + Intergenic
1132926069 16:2429645-2429667 GGCCGCCGGGGCTCCCTGCGCGG - Intronic
1136561597 16:31042340-31042362 GGCCACCGGGAGGCGCAGTCGGG - Intronic
1136561604 16:31042361-31042383 GGCCACCGGGAGGCGCTGCGGGG - Intronic
1139902921 16:70342319-70342341 GGAGACCTGGACACCCTGTGTGG + Intronic
1139956126 16:70693856-70693878 TGTCAGCGGGACCCCCTGTGTGG - Intronic
1141044403 16:80703588-80703610 GGCCACAGGGCCTCCCTGTGGGG + Intronic
1142136720 16:88454886-88454908 TGCCACCAGGACCCCTTGTGCGG + Intronic
1142143574 16:88483291-88483313 GGCCACCGGGGAGCCATGGGGGG - Intronic
1142758521 17:2029746-2029768 GGTCACCCGGCCGCCGTGTGGGG - Intergenic
1144737638 17:17563944-17563966 GGCCACAGCCCCGCCCTGTGAGG - Intronic
1148229159 17:45920456-45920478 GGCCACCGCAATGCCCTGTGTGG - Intronic
1148867214 17:50634931-50634953 GGCCCCATGGACGCCCTGTGCGG + Exonic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1152904132 17:82961167-82961189 GTCCTCCGGGACGCCCTGCAGGG + Exonic
1154292419 18:13121360-13121382 GGCCACCGGAAGGCCTGGTGGGG + Intronic
1155209154 18:23586251-23586273 GGCCACCGGGACGCCCTGTGGGG - Intronic
1157867010 18:51196604-51196626 GGGCACCGGGACGCACTCGGTGG + Exonic
1160437934 18:78866020-78866042 AGCCACCGGGACCCAGTGTGGGG + Intergenic
1161072938 19:2271314-2271336 GGCCGCCCGGACGCCCTGGAGGG + Intronic
1161327490 19:3670730-3670752 GGCCACCTGGATGCCCTGCAGGG + Intronic
1161767175 19:6214238-6214260 GGCCACCCAGAGGCCCTTTGGGG + Intronic
1162486085 19:10961259-10961281 GGCTGCCGGCGCGCCCTGTGCGG + Intronic
1163597019 19:18226221-18226243 GGTCACCGGGACGCCCGGTGTGG - Intronic
1166054308 19:40279425-40279447 GGCCTCCGGGCCGCACGGTGGGG - Intronic
1166996787 19:46723233-46723255 GGCCACGGGGACGCCGTGTGGGG - Exonic
1167001039 19:46746035-46746057 GGCCGCCGGGACGGCCGGCGGGG - Exonic
1167166578 19:47803278-47803300 GGGCACCGGGAGACCCCGTGGGG + Intronic
1167175261 19:47860486-47860508 GGGCACCGGGAGACCCCGTGGGG - Intergenic
1167295240 19:48645745-48645767 GGGAACTGGGACTCCCTGTGGGG - Exonic
1167433035 19:49464186-49464208 GGCCAACGGGACGCCCCGCGGGG + Exonic
927477609 2:23425913-23425935 GGCCACCCTGAGGCCCTGGGCGG - Intronic
934179852 2:89611002-89611024 GGCCAACTGGACGCCCTGGGAGG - Intergenic
934290148 2:91685263-91685285 GGCCAACTGGACGCCCTGGGAGG - Intergenic
935064512 2:99636269-99636291 GGCCACAGGGAGGCCATGTGGGG + Intronic
935688441 2:105708487-105708509 GGACACAGGCAGGCCCTGTGAGG + Intergenic
943037716 2:182767189-182767211 GGGCACCGGTACGCTCTGCGTGG - Intronic
946843107 2:223837300-223837322 GGCCACAGGGACGCACGGTTCGG + Intronic
948559906 2:238845914-238845936 GGCCCCGGGGACGCCCTGGAAGG - Intergenic
1168788872 20:562739-562761 GCCTACCTGGACACCCTGTGGGG - Intergenic
1170964290 20:21052587-21052609 GACCCCCAGGAAGCCCTGTGAGG + Intergenic
1172199992 20:33118741-33118763 GGGCTCCTGGAAGCCCTGTGTGG + Intergenic
1173278072 20:41601981-41602003 GGCCAGAGGGAGGCCCTGTGTGG - Intronic
1173399060 20:42708484-42708506 GGCCACAAGGAGGGCCTGTGTGG - Intronic
1174034641 20:47661126-47661148 GGGCATCGGGCCACCCTGTGTGG - Intronic
1175465883 20:59191208-59191230 GGCCCCCGGGAGGCACCGTGTGG - Exonic
1175699950 20:61129744-61129766 GGTCCCCGGGAAGCACTGTGTGG - Intergenic
1176036767 20:63043402-63043424 GGCCACAGGGACCCCATGCGGGG + Intergenic
1179532362 21:42028640-42028662 GGGCACCGCCACACCCTGTGGGG + Intergenic
1181049643 22:20232455-20232477 GGCCACCAGGACGTCCTAGGAGG + Intergenic
1183306007 22:37083592-37083614 GGCCACCAGGAAGCCATGGGTGG - Intronic
1183437708 22:37804999-37805021 GGCCAGCGGGCCGCCCGGCGGGG + Intergenic
1184473184 22:44707336-44707358 GGCCCCAGGGAGGGCCTGTGTGG + Intronic
1185253107 22:49816004-49816026 TGGCACCGGGAGGCCCTGTGTGG - Intronic
953534055 3:43764036-43764058 GGCCACCTGGCTGCCCTATGAGG + Intergenic
954468911 3:50675107-50675129 GGCATCCCGGACGGCCTGTGAGG + Intergenic
954708240 3:52492429-52492451 CGCCAGTGGGAGGCCCTGTGTGG + Exonic
954955832 3:54517714-54517736 TGACACCTGGATGCCCTGTGAGG - Intronic
968549179 4:1213673-1213695 GGGCACTGGAACCCCCTGTGGGG + Intronic
969392630 4:6901534-6901556 GGCCACCAAGATGCTCTGTGGGG - Intergenic
969829428 4:9782620-9782642 GGCCAACTGGACGCCCTGGGAGG + Exonic
971095706 4:23399658-23399680 GGGCACTGGGACGACTTGTGAGG - Intergenic
985760754 5:1747345-1747367 GGCCACCCTGAGGCCCTGTCAGG - Intergenic
988623092 5:32843337-32843359 GGCCACCGTGCAGCCCTCTGTGG - Intergenic
997710729 5:136001821-136001843 GGCCATGGGGTCACCCTGTGGGG - Intergenic
1001293644 5:170484089-170484111 GGCCAGCGGGATGCTCTGTGGGG - Intronic
1007764318 6:44152035-44152057 GGCCACCAGGGGGCGCTGTGCGG - Intronic
1010124184 6:72413202-72413224 GGGCACCTGGAGGCCATGTGAGG - Intergenic
1015910093 6:138161583-138161605 GGACACCGGGACCCCCAGCGTGG - Intergenic
1018124176 6:160665951-160665973 GGCCACCGGGACACCCCAGGAGG + Intergenic
1018715625 6:166530465-166530487 TGCCCCCGTGACGCCCTGTGTGG + Intronic
1018951620 6:168382002-168382024 GGCCACAGGGCCGCTCTGGGCGG - Intergenic
1022044407 7:26611691-26611713 AGCCACAGGGGCGCCCTTTGGGG - Intergenic
1040549367 8:48426890-48426912 GGCCATCTGCACGCTCTGTGGGG - Intergenic
1057546982 9:96026286-96026308 GGCCACCACGCCGCCCTCTGGGG + Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061885989 9:133591355-133591377 GGCCACCTGGGTGTCCTGTGGGG + Intergenic
1062033516 9:134372558-134372580 GGCCTCCGTGATGCCCTCTGAGG - Intronic
1062157550 9:135061585-135061607 GGCTAGCGGGAGGCCCTCTGTGG - Intergenic
1062600917 9:137318275-137318297 GGCGCCTGGGAAGCCCTGTGGGG - Intronic
1187173248 X:16870987-16871009 AGCCGCCGGGCCGCCCTGTTAGG + Intergenic
1194977339 X:100408731-100408753 CGCCGCCGGGCCGCCCTGGGCGG - Exonic