ID: 1155209199

View in Genome Browser
Species Human (GRCh38)
Location 18:23586433-23586455
Sequence TCCTCCGCTCCTCCTGCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155209199_1155209208 25 Left 1155209199 18:23586433-23586455 CCCCGCGCAGGAGGAGCGGAGGA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1155209208 18:23586481-23586503 GCAGGCTGCGCGCGCCGGTCAGG 0: 1
1: 0
2: 0
3: 17
4: 120
1155209199_1155209209 29 Left 1155209199 18:23586433-23586455 CCCCGCGCAGGAGGAGCGGAGGA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1155209209 18:23586485-23586507 GCTGCGCGCGCCGGTCAGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1155209199_1155209204 0 Left 1155209199 18:23586433-23586455 CCCCGCGCAGGAGGAGCGGAGGA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1155209204 18:23586456-23586478 GCAGGAGCAGGCGCTGACCGCGG 0: 1
1: 0
2: 1
3: 23
4: 289
1155209199_1155209207 20 Left 1155209199 18:23586433-23586455 CCCCGCGCAGGAGGAGCGGAGGA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1155209207 18:23586476-23586498 CGGCAGCAGGCTGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 16
4: 228
1155209199_1155209205 7 Left 1155209199 18:23586433-23586455 CCCCGCGCAGGAGGAGCGGAGGA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1155209205 18:23586463-23586485 CAGGCGCTGACCGCGGCAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155209199 Original CRISPR TCCTCCGCTCCTCCTGCGCG GGG (reversed) Exonic
900552046 1:3261711-3261733 TCCTCCACTCCTCCTGTGTCAGG + Intronic
901007931 1:6180555-6180577 TCCTCGCCTCCCCCTGCGCCCGG - Intergenic
902508861 1:16954802-16954824 GCCTCCTCACCTCCTGGGCGTGG - Exonic
904500215 1:30908811-30908833 TCCTCCGTTCCGCCCGCGCTGGG - Intergenic
904574985 1:31499766-31499788 TCCTCCCCACCTCCTGCCCTGGG + Intergenic
904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG + Intronic
904815779 1:33197096-33197118 TCTTCTGCTCCTCCTGCTCTTGG + Intergenic
905645800 1:39624502-39624524 TCCTCCTCTCCTGCTGCTCCTGG - Exonic
910207123 1:84759305-84759327 TCCTCCCCACCTCCTTCCCGTGG + Intergenic
915309758 1:155001164-155001186 GACTCCGCCCCTCGTGCGCGGGG + Intergenic
915588960 1:156859989-156860011 TCCTCAGCTCCACCCGCGGGCGG + Intronic
918419561 1:184350719-184350741 TCCTCCTCTCCTGCTGCTCTAGG + Intergenic
921603899 1:217135176-217135198 TCGTCCCCTCCCCCAGCGCGCGG + Intronic
924904206 1:248434120-248434142 CCCTCCGCTCCACCTCCGCGCGG - Intergenic
924923690 1:248657931-248657953 CCCTCCGCTCCACCTCCGCGCGG + Intergenic
1063021615 10:2134791-2134813 GCTTCCACTCCTCCTGCCCGTGG + Intergenic
1075731809 10:124640819-124640841 TCCTCCTCTCTTCCTGCGCTCGG - Intronic
1075885428 10:125896029-125896051 GCCTCCGCGCCTCCTGCTCCGGG - Intronic
1076526444 10:131115349-131115371 TCCTGCCCTCCTCCTGCTCTTGG - Intronic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077600112 11:3568777-3568799 TCCTCAGCTCCTTCTGCAAGGGG - Intergenic
1078660201 11:13279169-13279191 TCCACCGCTACTCCTCAGCGAGG + Intronic
1079095748 11:17509266-17509288 TCCTCCACTGCTCCTGAGAGTGG - Intronic
1080387022 11:31816392-31816414 TCCTCGGCTCGCCCTGGGCGCGG + Intronic
1083678962 11:64342608-64342630 GCCTCAGCTCCTCCTGCAGGCGG - Exonic
1084732566 11:71082728-71082750 TTCTCCTCTCCTCCTGCTCCAGG - Intronic
1085119371 11:73957388-73957410 CCCTCCGCTCCTCCAGCACCTGG + Intronic
1089468831 11:118704777-118704799 TCCTCAGCTCCTCATGCCAGGGG - Intergenic
1089840524 11:121413519-121413541 CCTTCCGCTCCTCCTGCCCTTGG - Intergenic
1090664896 11:128908304-128908326 TCCTCTGCTCCTCCAGCCCTGGG - Intronic
1091434180 12:460400-460422 GCCCCCGCTGCTCCTGCGCCCGG + Exonic
1092634388 12:10426023-10426045 TCCTTCGTTCCTCCTGCCCTTGG + Intronic
1092635433 12:10441448-10441470 TCCTTCGTTCCTCCTGCCCTTGG + Intronic
1094472060 12:30812055-30812077 TCTTCTGCTCCTCCTGCCCTTGG - Intergenic
1100481811 12:94986285-94986307 CTCTCCACTCCTCCTGCCCGTGG - Intronic
1103786351 12:123436150-123436172 TCTTCAGCTCCTCCAGCGCCAGG + Exonic
1104775600 12:131388477-131388499 TCCTCCGCTCCCCCTGCCCAGGG + Intergenic
1107303628 13:38994324-38994346 ACCTCCGCTCCCCCTGTGCCAGG + Intergenic
1108287952 13:48927408-48927430 CCTTCCGCTCCTCCTGCTCTTGG + Intergenic
1112494757 13:99895998-99896020 CCCCGCGCTCCTCCTGCCCGCGG - Exonic
1113577386 13:111403963-111403985 TCCTCAGCTCTTCCTGCCCCCGG - Intergenic
1123043012 14:105498165-105498187 GCCCCCGCCCCTCCTGCGGGAGG + Intronic
1128451167 15:67806708-67806730 TCCGCCTCTCCTCCAGCGCCCGG - Exonic
1129475635 15:75783010-75783032 CCCTCCACTCCTCCTGCTCTCGG - Intergenic
1133613375 16:7453887-7453909 TCCTCCACTCCTTCTTTGCGAGG - Intronic
1133923900 16:10179386-10179408 TCCTCCGCTCCTCTGGCCCAGGG + Intronic
1134342823 16:13360722-13360744 TCCTCGGCTCCACCTATGCGAGG - Intergenic
1136402181 16:30024949-30024971 CCCTCCCCTCCTCCAGCGCAAGG + Exonic
1136485594 16:30570030-30570052 TCCACCGCTCCTGCTCCGGGGGG - Exonic
1136487466 16:30582674-30582696 TCCACCGCTCCTGCAGCGAGAGG - Exonic
1137676463 16:50305973-50305995 TCCACAGCTGCTCCTGGGCGGGG + Intronic
1139466234 16:67155527-67155549 TCCTCCGCGCCTACCGCGAGGGG - Exonic
1139528178 16:67529069-67529091 TCCTCCCCTCCCCCCGGGCGTGG + Intronic
1139534542 16:67563097-67563119 TCCTCCGCCCCTCCCGCGGCGGG + Intronic
1140079622 16:71732944-71732966 TCTTCAGCTCCTCATGCCCGTGG + Exonic
1141993296 16:87622290-87622312 TCCTCCTCTCCTCCTGGGCTTGG + Intronic
1142272369 16:89096802-89096824 CCGTCCGTTCCTCCTGCCCGTGG + Intronic
1142965281 17:3577226-3577248 CCCTCAGCTCCTCCTGGGCCTGG - Intronic
1143364902 17:6400723-6400745 TCTTCTGCTCCTCCTGCCCTTGG + Intronic
1144173473 17:12682275-12682297 TCCTCTGCTCTTCCTGTGCATGG - Intronic
1146615673 17:34355638-34355660 TCCTGGGCTCCTCCTGCGAGGGG - Intergenic
1148235950 17:45969263-45969285 CCCTCAGCTCCTCCTGTGCCTGG - Intronic
1150168416 17:62966401-62966423 CCCTCCGCGCCTCCTTCGGGCGG + Intergenic
1150625860 17:66840717-66840739 CCCTCTGCTCCTCCTGTGTGGGG + Intronic
1151349421 17:73522882-73522904 TCCCCAGCTCCTCTTGCGGGTGG + Intronic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152386324 17:79977021-79977043 TCCTCCCTTCCTCCTGCCAGAGG - Intronic
1152701447 17:81821853-81821875 TCCCCTGCTCCTCCTCCCCGGGG + Intergenic
1152791986 17:82285269-82285291 CCCTCCCCTCCTCCAGCACGGGG + Intergenic
1152808730 17:82371407-82371429 TCCTGCCCCCCACCTGCGCGCGG + Intergenic
1154346042 18:13544365-13544387 TCCTCCCCACCTCCTGGGCAGGG + Intronic
1155209199 18:23586433-23586455 TCCTCCGCTCCTCCTGCGCGGGG - Exonic
1157590128 18:48831492-48831514 TCCTCCGTTCCTCATGGGAGGGG - Intronic
1160517916 18:79488674-79488696 TCCTCCCCAGCCCCTGCGCGAGG + Intronic
1160577374 18:79864273-79864295 TCACCCGCTCCTCCTCGGCGCGG - Exonic
1160631250 18:80247529-80247551 CCCCGCGCTCCTCCCGCGCGCGG - Exonic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1162362954 19:10230702-10230724 TCCTCCGGTCCCCCGGCGGGGGG - Intronic
1162376690 19:10309377-10309399 TCCTCGGCTTCTCCTGGGAGGGG + Exonic
1167070845 19:47221352-47221374 TCCCCCCCTCCTCCTGGGAGGGG - Exonic
1167573729 19:50307112-50307134 CCCTCCGCTCCTCCTCCACCTGG - Exonic
1168274532 19:55270005-55270027 CCCTCAGCTCCTGCTGCCCGAGG - Intronic
930035493 2:47082885-47082907 TCCTCAGCCCCTCCTGGGCTGGG - Intronic
932043062 2:68319823-68319845 ACCTCTCCTCCTCCTGCCCGGGG - Exonic
933895572 2:86807710-86807732 TCCTCCGCGCCTGCTCCGGGTGG - Exonic
935011573 2:99141242-99141264 TCCTCCGATCCGCCGGGGCGGGG - Intronic
938097780 2:128474711-128474733 TTCTCCGCTCCTCCTGCCTTTGG - Intergenic
938337315 2:130511379-130511401 TCCTCAGCACCCCCTGCACGTGG + Intergenic
938352523 2:130609356-130609378 TCCTCAGCACCCCCTGCACGTGG - Intergenic
941813657 2:169779168-169779190 TCCTCCGTTCCAGCTGGGCGCGG + Intergenic
944743501 2:202634781-202634803 TCCTCCGCTCCCTCCCCGCGGGG + Intergenic
948379434 2:237542323-237542345 TCCTGCGTTCCTCCTGCCTGGGG + Intronic
1171966262 20:31533156-31533178 TCCTCCCCTCCTCCTGGTTGGGG + Intronic
1173166825 20:40691599-40691621 ACCTCCTCTTCTCCTGCGGGCGG + Intergenic
1176389040 21:6154311-6154333 CTCTCCTCTCCTACTGCGCGGGG + Intergenic
1176420168 21:6507820-6507842 TCCTCCGTTCCCCCTGCCCTTGG + Intergenic
1178400223 21:32279058-32279080 ACCGCCGCTGCTCATGCGCGGGG + Exonic
1179695660 21:43116140-43116162 TCCTCCGTTCCCCCTGCCCTTGG + Intergenic
1179734432 21:43383937-43383959 CTCTCCTCTCCTACTGCGCGGGG - Intergenic
1180017375 21:45096194-45096216 TCCTCCTCTCCTCTTGGGCTAGG - Intronic
1182475443 22:30574346-30574368 TACTCCCCTCCTCCGGCGCGTGG + Intronic
1183299513 22:37051987-37052009 TCCTCCGCTCGCCCGACGCGGGG + Intronic
1183545375 22:38452544-38452566 GCCGCCGCTCCCCCTGCACGAGG - Intronic
1184479090 22:44736781-44736803 TCCTCCGCCGCTCCCGCTCGGGG + Exonic
949497787 3:4649518-4649540 TCCTCCCATTCTCCTGCGCTTGG + Intronic
950386405 3:12663861-12663883 TCGCCCGCTCCTCCTCCCCGCGG + Exonic
961263190 3:125619012-125619034 GCCTCCACTCCTCCTGCCCTTGG + Intergenic
964041758 3:152269245-152269267 CCCTCAGCACCTCCTGCCCGGGG + Intronic
966116397 3:176468391-176468413 TTCTCCTCTCCTCCTGCCCTTGG + Intergenic
966594289 3:181712268-181712290 TCCTCCTCTCCCCCCGCCCGCGG + Exonic
966808644 3:183825216-183825238 TCCTCCGCGCCACCTGCGCCCGG - Exonic
973551262 4:52038184-52038206 TCCCCCGCTCCTCCAGCCCGCGG + Intronic
975983415 4:80183653-80183675 GCCTCCGCTCCTCCTCCCCAGGG + Intergenic
976765249 4:88592320-88592342 CTCTCCCCTCCTCCTGCCCGCGG + Intronic
978589040 4:110304156-110304178 TCCTTCCCTCCTCCTGCTCAAGG - Intergenic
980988613 4:139718936-139718958 TCCTCAGCCCCTCCTGCCCCAGG - Exonic
981044529 4:140253063-140253085 TCCTCCTCTCTCCCTGGGCGCGG - Intergenic
990007742 5:50963559-50963581 GCCTCCGCTCCTCCTCCGCCCGG + Intergenic
991457737 5:66822600-66822622 TCCTCCACCCCTCCTGCCCAGGG + Intronic
998250376 5:140548311-140548333 TCCTCCCCTCCGCTTCCGCGTGG - Intronic
999750084 5:154621694-154621716 TCCCCAGCTACTCCTGAGCGAGG + Intergenic
1001246048 5:170106293-170106315 TCATCAGCTCCTCCTGCGAGGGG - Exonic
1001577046 5:172771257-172771279 ACCCCCCCTCCCCCTGCGCGCGG - Intergenic
1012199828 6:96392161-96392183 TCCTCCCCTCCCCCTGCTCTGGG + Intergenic
1017913310 6:158813541-158813563 TCCACCCCTCCTCCTCCACGAGG - Intronic
1019442823 7:1056025-1056047 TTCTCCCCTCCTGCTGCGCCAGG - Intronic
1019693767 7:2432993-2433015 TCCTCCGCTCCGCCTGCTGCCGG - Exonic
1026471137 7:70694684-70694706 CCCGCCGCTCCTGCGGCGCGCGG - Intronic
1026851583 7:73727030-73727052 TCCTCCTCTCCTGCTCCCCGAGG - Intergenic
1028417456 7:90595919-90595941 TCCCCCGCCCCGCCCGCGCGCGG - Intronic
1032260435 7:130331765-130331787 TCCTCCCTCCCTCCTGCGCCAGG + Intergenic
1035580797 8:738127-738149 TTCTCCGCTCTGCCTGCCCGGGG + Intergenic
1036897360 8:12646856-12646878 TCCCCAGCTCCTTCTGCACGGGG - Intergenic
1038267741 8:26049394-26049416 TCCTCTGCTCCTCCTCCCCCTGG + Intergenic
1041714490 8:60921839-60921861 TTCTCCCCTCCCCCTGCGCCAGG + Intergenic
1045047645 8:98294323-98294345 TCCTCTCCTCCTCCGGTGCGAGG + Exonic
1045291148 8:100833917-100833939 GCCTCTGCTCCTCCTGCCCTTGG - Intergenic
1045461228 8:102427415-102427437 TGCTCCGCTCCGCCTGCCAGGGG + Intergenic
1046876514 8:119260588-119260610 TCCTCAGCTCCTTCTGCACTTGG + Intergenic
1047732299 8:127737403-127737425 TCCTCCGCATCTCGGGCGCGAGG - Intronic
1048254262 8:132893844-132893866 TCCTCCGCTCTTCCCGCCCCGGG + Exonic
1049047843 8:140166627-140166649 TCCTCCACTCCTCCAGCATGAGG + Intronic
1049069708 8:140347058-140347080 TCCTCTGCTCCTCCAGCTCTGGG + Intronic
1049424507 8:142532134-142532156 TCCTCCCCTCCTCCTACACAGGG - Intronic
1049539673 8:143202523-143202545 TCCTCCCGGCCTCCTGCACGGGG + Intergenic
1051106622 9:13587846-13587868 TCCTCCGCTCCTCCCACCCTGGG + Intergenic
1056815071 9:89795191-89795213 TCCTCCTCTCCTCCTCCCTGTGG + Intergenic
1059405932 9:114098429-114098451 TCCTCCGCCCCACCCGCGCCAGG - Intronic
1059528123 9:115012002-115012024 TCCTCAGCTCCTGCTGAGCTGGG + Intergenic
1061290189 9:129646385-129646407 TCCTCAGCTCCTCCAGCTCTGGG + Intergenic
1061747744 9:132752747-132752769 TCCTCCCCTCCTCCTGCAGCTGG + Intronic
1062030998 9:134361981-134362003 TCCTCCCCTCCTGCTGGGCTTGG + Intronic
1062729453 9:138100994-138101016 TCCGCCGCCACGCCTGCGCGAGG + Intronic
1203731831 Un_GL000216v2:98654-98676 GCCTCCGCGCCTCCTGCTCCGGG - Intergenic
1199978318 X:152907216-152907238 GCCCCCGCTCCTCCAGCGCACGG + Intergenic