ID: 1155215053

View in Genome Browser
Species Human (GRCh38)
Location 18:23635870-23635892
Sequence CAGAGGCAGGCTCTGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 1, 2: 2, 3: 64, 4: 570}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155215042_1155215053 12 Left 1155215042 18:23635835-23635857 CCTATGGGGCTGCGTGTGGCTGG 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1155215053 18:23635870-23635892 CAGAGGCAGGCTCTGTGGTGGGG 0: 1
1: 1
2: 2
3: 64
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155215053 Original CRISPR CAGAGGCAGGCTCTGTGGTG GGG Intronic
900077868 1:832630-832652 GAGAGGCTGGCCCTGGGGTGGGG + Intergenic
900123214 1:1058397-1058419 CAGAGGCGGGGCATGTGGTGTGG + Intergenic
900286661 1:1904476-1904498 CAGGGTCTCGCTCTGTGGTGGGG + Intergenic
900390458 1:2431733-2431755 GAGAGGCAGGGACTGTGATGAGG - Intronic
900511132 1:3061742-3061764 CAGAGCCTGGCCCTGTGGTGGGG - Intergenic
900579300 1:3400619-3400641 CAGAGGCTGGAGCTGAGGTGTGG + Intronic
900599908 1:3498509-3498531 CAGAGGCAGGCACGAGGGTGAGG + Intronic
900712766 1:4124931-4124953 CAGAGGCAGCACCTTTGGTGTGG + Intergenic
900974365 1:6007936-6007958 CTGAGGCAGGGGCAGTGGTGGGG + Intronic
901261411 1:7874558-7874580 CAGGGGCAGCCTCCCTGGTGTGG - Intergenic
901454241 1:9354122-9354144 CAGGGCCAGGCTCTGCAGTGGGG - Intronic
901679492 1:10904849-10904871 CTGAGGCAGGCTGGATGGTGTGG - Intergenic
901758857 1:11457697-11457719 CAGAGTCACGCTGTGAGGTGAGG - Intergenic
901850540 1:12012149-12012171 CTGAGGCGGGCCCTGTGCTGGGG + Exonic
902679177 1:18031012-18031034 CAGAGGCAGGGACTGGGGAGTGG - Intergenic
902814498 1:18908444-18908466 CAGAGAAAGTCTGTGTGGTGTGG + Exonic
903249091 1:22039383-22039405 CAGAGGCTCTCTCTGTTGTGAGG + Intergenic
904093565 1:27961054-27961076 GAGGGGCAAGCGCTGTGGTGGGG - Intronic
904410712 1:30323127-30323149 CAGGGTCAGGCTCTGTGCTAGGG + Intergenic
904432358 1:30472649-30472671 CAGAGGCACGCTCTCCAGTGGGG - Intergenic
904624016 1:31792179-31792201 CAGAGGCAGGGTCTGGTATGGGG + Intronic
905172720 1:36118610-36118632 CAGCGGCAGGCTCTGTGCAAAGG - Intronic
905867787 1:41385659-41385681 CAGAGGCTGGCTGTAGGGTGGGG - Intergenic
906060410 1:42944773-42944795 CAGAGGCAGGCTAAGGGGTCAGG - Intronic
906157950 1:43625184-43625206 CCCAGGCAGGCTCTGCGCTGAGG + Intergenic
906587711 1:46994416-46994438 CAGAAGCAGGCTCAGCAGTGAGG + Intergenic
906901548 1:49842116-49842138 CAGAGGCAGAGGCTGTGGTTGGG - Intronic
906939081 1:50239994-50240016 CAGAGGGAAGCACAGTGGTGTGG + Intergenic
907526641 1:55057592-55057614 CAGTGCCAGGCTCTGTGCAGGGG + Intronic
907551727 1:55310481-55310503 CAGAGGCAGGCCCCGTTTTGAGG + Intergenic
907650342 1:56288785-56288807 CAGAGCCAGGTTATGTGGGGAGG + Intergenic
907664673 1:56424428-56424450 CAGTGCTAGGCTCTGTGGTCAGG - Intergenic
907834388 1:58095165-58095187 GTGAGCCAGGCTCTGTGCTGGGG - Intronic
907848871 1:58235070-58235092 CTGAGGCAGGGTGTGTGGCGAGG - Intronic
908458393 1:64326280-64326302 CATAGGCTGGTTCTCTGGTGGGG - Intergenic
908923549 1:69225364-69225386 CAGAGTCTGGCTCTGTGCAGTGG + Intergenic
911204971 1:95083107-95083129 CAGACACAGGCTTTGTGGGGAGG - Intergenic
912305016 1:108558773-108558795 CAGAGGCAGGTTCGGGGGTGGGG - Intergenic
912443033 1:109713108-109713130 CATAGTCAGGAGCTGTGGTGGGG - Exonic
912533732 1:110346961-110346983 CCGACTCAGGCACTGTGGTGAGG - Intergenic
912554206 1:110504338-110504360 CATAGGACAGCTCTGTGGTGGGG + Intergenic
912639358 1:111330436-111330458 CAGAGGGAGGCTCGTTAGTGAGG + Intergenic
912655574 1:111483598-111483620 CAGAATCAGTCTCTGAGGTGTGG + Exonic
913255165 1:116946266-116946288 CAAATCCAGGCTCTGTGCTGTGG - Intronic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
914079313 1:144391846-144391868 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914099866 1:144574656-144574678 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
914174214 1:145260393-145260415 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914528878 1:148501577-148501599 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914637515 1:149565531-149565553 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
914806670 1:150996998-150997020 CAGACTGAGGCTCTGGGGTGAGG - Intronic
915489043 1:156241456-156241478 GGGAGGCAGGCACTGAGGTGGGG - Intronic
915971915 1:160361071-160361093 CAGAGGCAGGCTGGGTCTTGGGG - Intergenic
916171248 1:162003094-162003116 AAGAGGCAGGCTCTGAGGGCAGG - Intronic
916462991 1:165046026-165046048 CAGAGGCAGGCTCTGTCTTTGGG - Intergenic
916581148 1:166110341-166110363 CAGAGGGAGGATCTGAGGTTGGG - Intronic
917737385 1:177933196-177933218 CTGAGGTAGGCTCTGTGGGAGGG - Exonic
918477339 1:184939396-184939418 AAGAGGCATGCTCTATTGTGGGG - Intronic
919963567 1:202497742-202497764 TAAAGGCAAGCTATGTGGTGTGG + Intronic
920179242 1:204122376-204122398 CAGAGGCAGGCTCGGGGGGCTGG - Exonic
921075643 1:211698511-211698533 CTGATTCAGGGTCTGTGGTGAGG + Intergenic
921102953 1:211946689-211946711 CAGAGGCATGCTGTGTGCTGGGG + Exonic
921384026 1:214551718-214551740 CGGAGCCCGGCTCTGGGGTGGGG - Intronic
921957292 1:220998015-220998037 CAGAGGCAGGCTGGGAGGGGAGG - Intergenic
922580163 1:226691374-226691396 CAGAGGCAGGAGCCGTGCTGGGG + Intronic
924154584 1:241163086-241163108 CAGAGACAGGCTCCGTGGCCAGG + Intronic
924622938 1:245678120-245678142 AGGAGGCAGGGTCAGTGGTGAGG + Intronic
1063248930 10:4253086-4253108 CAGAAGCAGCCTCTCTGTTGTGG + Intergenic
1063950924 10:11222657-11222679 TAGTGGCAGGCTTTGTGGTTTGG - Intronic
1063953609 10:11246512-11246534 CAGAAGTAGGTTCTGTGGAGGGG - Intronic
1063969565 10:11372109-11372131 AGGAGGCCGGCTCAGTGGTGTGG - Intergenic
1064342610 10:14500376-14500398 CAGTCACAGGCTCTGGGGTGGGG - Intergenic
1065328753 10:24572173-24572195 CAGAGGCTGGCACTGAGGTGTGG - Intergenic
1065797977 10:29324392-29324414 AGGAGGCAGGCTCCGGGGTGTGG - Intergenic
1067065652 10:43102651-43102673 CAGTAGCAGGCACTGTGGGGCGG - Intronic
1067278148 10:44852227-44852249 CAGAAGCAGACTCTGAGATGAGG + Intergenic
1067286704 10:44912359-44912381 CAGAGCCAGGATCTGTTTTGGGG + Intronic
1068983089 10:63081979-63082001 CAGTGGGAGGATCTGTTGTGAGG - Intergenic
1069633991 10:69914281-69914303 CAGAAAAAGGCTCTGTGGGGTGG - Intronic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1071547008 10:86536698-86536720 CAGGGGGAGGCTCAGAGGTGCGG - Intergenic
1071566028 10:86671662-86671684 CAGAGGCTGGGGCTGTGGTCTGG + Intronic
1072563787 10:96600642-96600664 GAGAGGCTGGCTCTGTGCTAAGG - Intronic
1072590225 10:96822272-96822294 CAGAGACAGCATCTGTGGAGTGG + Intergenic
1072900797 10:99404772-99404794 TAGGGGCAGGGTCTGTGCTGAGG - Intronic
1073120521 10:101119856-101119878 CAGAGGAAGCCTCTGAGGTGGGG + Intronic
1073290957 10:102413075-102413097 CAGAAGCAGGCTCTGGAGTTAGG + Intronic
1073317544 10:102593513-102593535 CACAGGCAGGATCTGTGCTCAGG - Intronic
1074204623 10:111272139-111272161 CAGAGGCAGTCACAGTGGTGGGG - Intergenic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074535295 10:114324719-114324741 CACAGGCAGGCTGTGAGGTGGGG + Intronic
1074890727 10:117734956-117734978 CAGAGCCAGGGTCTCTGCTGGGG + Intergenic
1075414971 10:122255895-122255917 CAGAGGCAGGCTCTGCTGGATGG - Intergenic
1075633708 10:124016464-124016486 CAGGGGCAGGCTCAGTGGACAGG - Intronic
1075744267 10:124715613-124715635 CGTGGGCAGGCTCTGTGCTGAGG - Intronic
1076271042 10:129152445-129152467 TCGTGGCATGCTCTGTGGTGGGG + Intergenic
1076910877 10:133388720-133388742 CTGAGGGACGCTCTGTGGGGTGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077191610 11:1258114-1258136 CACAGGCAGGCTCTGGGGGCAGG - Exonic
1077192956 11:1263136-1263158 CAGAGGCAGGCCCCGGTGTGGGG - Intergenic
1077384117 11:2261009-2261031 CAGAGCCAGGCTTTGTGGGAGGG - Intergenic
1077888713 11:6403937-6403959 CAGAAGCAGGAACTGTGTTGTGG - Intronic
1079253450 11:18805579-18805601 CAGAAGCAGAATCTGAGGTGGGG + Intergenic
1079301781 11:19285037-19285059 TAGAGGCAGGCTCTGGGGGTTGG - Intergenic
1079691464 11:23423463-23423485 CAGAGCCAGGCTGTCTGGTAAGG + Intergenic
1079791849 11:24748483-24748505 CAGAGTCTTGCTCTGTGGTCAGG + Intronic
1080546707 11:33326686-33326708 CAGAGCCAGGCTCTGTCTCGGGG - Intronic
1080872479 11:36249125-36249147 CATTGTCAGGCTCTCTGGTGAGG + Intergenic
1081773128 11:45661906-45661928 CTGAGGCAGGCACTGGGGCGGGG + Intronic
1082000199 11:47389947-47389969 CAGGGGAAGGGTCTGGGGTGGGG - Intergenic
1083679005 11:64342763-64342785 GAGAGGCAGGTTCTCTGGAGGGG + Intronic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1083886410 11:65575586-65575608 CAGAGTCAGGTTCTGAGGTTGGG + Intergenic
1084187814 11:67484151-67484173 AAGAGACAGGATGTGTGGTGTGG + Intronic
1084387410 11:68852768-68852790 CAGAGGCAGGAGGTGGGGTGAGG - Intergenic
1084876141 11:72135342-72135364 CAGAGGCAGGCTCAGAGGTTGGG - Intronic
1084881005 11:72171821-72171843 CAGAGGCAGGCTCAGAGGTTGGG - Intergenic
1085457882 11:76675518-76675540 GGCAGGCAGGCTCTGCGGTGGGG + Intergenic
1085642085 11:78199034-78199056 CACAGGCAGGCTGTGTTGTGGGG + Intronic
1085907532 11:80782360-80782382 CAGAGGGAAGCTCTGTGCTTGGG + Intergenic
1086747002 11:90441402-90441424 CAGTGGCAGGCCCTCTGGAGTGG - Intergenic
1087036087 11:93758139-93758161 CAGCGGCAGGCTCTCTGGAGCGG + Intronic
1087107445 11:94424119-94424141 CACAGCCGTGCTCTGTGGTGGGG - Intronic
1087825181 11:102756897-102756919 CAGAGTCTTGCTCTGTGGTCAGG + Intergenic
1088127026 11:106439514-106439536 CAGTGGGAGGCTAGGTGGTGGGG - Intergenic
1088290117 11:108227029-108227051 CAGAGGAAGGCTCTGCGGGGCGG - Intronic
1088321885 11:108563102-108563124 CAGAGGGAGGATCTGTGAGGAGG + Intronic
1088867901 11:113866273-113866295 CAGAGCCAGACTCTGTCTTGGGG + Intronic
1089074276 11:115725662-115725684 CAGAGGCAGGCTGTGGGATCAGG + Intergenic
1089286916 11:117413167-117413189 CATCAGCAGGCTCTGGGGTGGGG + Exonic
1089289524 11:117429259-117429281 CAGAACCAGGCTCCATGGTGGGG - Intronic
1089979732 11:122762411-122762433 CACAGTCAGGCTCTGGGGAGAGG - Intronic
1090183927 11:124723899-124723921 GTGAGGAAGGCTCTGGGGTGTGG - Intergenic
1090185658 11:124737806-124737828 GATGGGCAGGCTCTGAGGTGAGG - Intergenic
1090252239 11:125259794-125259816 CGAAAGCAGGCTGTGTGGTGAGG - Intronic
1090387135 11:126363901-126363923 CAGAGGCAAGCTCTGGGCTGGGG - Intronic
1090493245 11:127184623-127184645 CAGAGACAGGATCTGTGCAGAGG - Intergenic
1090659684 11:128872847-128872869 AAGAGGTAGGCTCTCTGATGGGG + Intergenic
1091008682 11:131978032-131978054 CAGAAGAAGGCTCTGTGGTCAGG + Intronic
1091055043 11:132410024-132410046 CAGAGGTAAGCTCTCTGATGAGG + Intergenic
1091143717 11:133258811-133258833 CAGGGGCAGGCTGGGTGGAGTGG - Intronic
1091589937 12:1836949-1836971 CAGAGCCAGGCCCTGTGGCTGGG + Intronic
1092119404 12:6033653-6033675 GAGAGGCAGGCAGTGTGCTGGGG - Intronic
1094004547 12:25735035-25735057 CAGAGAAAGCCTCTTTGGTGGGG - Intergenic
1094460402 12:30691672-30691694 CAGATCCAGGCTCTGAGGAGAGG - Intronic
1094553458 12:31474180-31474202 CACAGGCATGCAGTGTGGTGTGG + Intronic
1094785275 12:33841446-33841468 CAGATGCTGGCTCTGTTGGGAGG + Intergenic
1095907390 12:47391981-47392003 CAGAAGCAGGCTCTGCAGGGAGG - Intergenic
1096327485 12:50677596-50677618 CAGAGCAAGACTCTGTCGTGGGG + Intronic
1096464072 12:51838556-51838578 CAGAGTCAGCCTCTGAGATGTGG + Intergenic
1096630963 12:52926489-52926511 CTGGGGCAGGCTTTGTGGGGAGG - Intronic
1097989837 12:65823852-65823874 CGCCCGCAGGCTCTGTGGTGAGG + Intergenic
1099585341 12:84506941-84506963 GAGAGGCATGTTCTGTGGTATGG + Intergenic
1102492412 12:113297251-113297273 CAGAGGCAGGGTCAGTGCAGAGG + Exonic
1102688684 12:114743719-114743741 CAAAGACAGGGTCTGTGGTAGGG + Intergenic
1103418815 12:120763425-120763447 CAGAGGCAGCCACTGGGGCGGGG + Exonic
1104623861 12:130337691-130337713 CAGGGGCAGGGCCTGTGGGGCGG + Intergenic
1106524316 13:30526790-30526812 CACAGGAAGGCTCTGTGGTATGG - Intronic
1106927378 13:34627649-34627671 CAGAGACAGCCTCCTTGGTGTGG - Intergenic
1107017800 13:35721599-35721621 CAAAGCCAGGCTCTGTGGAGGGG + Intergenic
1107252445 13:38380275-38380297 CAGAGCAATTCTCTGTGGTGTGG - Intergenic
1108144377 13:47461428-47461450 CAGAGTAAGACTCTGTGTTGGGG + Intergenic
1108315055 13:49228659-49228681 GAGAGGCTGGCTCTTGGGTGGGG - Intergenic
1112043897 13:95576041-95576063 CATGGGCAGGCTTTCTGGTGTGG - Intronic
1112504771 13:99969191-99969213 CAGAGGCAGGGCTTGAGGTGGGG + Intronic
1112678298 13:101730838-101730860 CTGACTCAGGCTCTGTGGTGAGG + Intronic
1113579241 13:111417105-111417127 GAGAGGGAAGCTCTGAGGTGTGG + Intergenic
1113611210 13:111646043-111646065 CAGAGGCTGGCCCTGTGGCTGGG + Intronic
1114154605 14:20086484-20086506 CAGAGGCGGGGACTGTGGTGGGG - Intergenic
1114211141 14:20616078-20616100 CAGAGGCTGGCTTTGCGGAGAGG + Intergenic
1114267437 14:21081259-21081281 GAGTGGCAGGCTCTGTGCTAAGG - Intronic
1114666321 14:24379126-24379148 CAGAGGCTGGCTCTGGATTGGGG + Exonic
1115232168 14:31172569-31172591 CAGAGTCTCGCTCTGTTGTGCGG - Intronic
1117546376 14:56797679-56797701 CAGAGGCAGGCTCTGGAATGGGG - Intergenic
1117675511 14:58151772-58151794 CAAAGGCCGGCTCGCTGGTGCGG + Intronic
1118821353 14:69348108-69348130 CAGAGCGAGGATCTGTGGGGAGG + Intronic
1119021725 14:71121885-71121907 CAGGAGCAGGCTCTGTGTGGGGG - Intergenic
1119074645 14:71624019-71624041 GAGAGACAGGTGCTGTGGTGAGG - Intronic
1119263979 14:73253565-73253587 GAGAGCCAGGCCCGGTGGTGGGG + Intronic
1119602109 14:75983044-75983066 CAGAGGCAAGCCCTGTGTTGCGG - Intronic
1119898704 14:78242518-78242540 CAGCGGCAGGCTGTGGGGAGGGG - Intronic
1121109529 14:91303222-91303244 GAGAGGCAGGGTGTGTGGGGAGG - Intronic
1121802712 14:96788184-96788206 GGGAGCCAGGCTCTGAGGTGTGG + Intergenic
1121863835 14:97343867-97343889 CAGTTGCTGGCTCTGAGGTGTGG + Intergenic
1121951047 14:98171537-98171559 AAGAGGCAAGCTCTGTGTGGTGG + Intergenic
1122007189 14:98715285-98715307 CTAAAGCAGGCTCTGGGGTGTGG + Intronic
1122365247 14:101191362-101191384 CAAAGGCAGGCTCTGGGGCTTGG - Intergenic
1122388321 14:101363956-101363978 CCGAGGCAGCATCTGTGGAGGGG - Intergenic
1122813307 14:104299534-104299556 CAGAGGGAAGTTCTGGGGTGGGG + Intergenic
1122828215 14:104382601-104382623 CAGAGGCCGGCTGTGGGGTGTGG + Intergenic
1122834100 14:104422737-104422759 CAGCGCCCCGCTCTGTGGTGTGG + Intergenic
1123057747 14:105579972-105579994 CAGGGGCAGGAGCTGTGGAGTGG - Intergenic
1124248706 15:28094177-28094199 CAGAGGTAGGCTGTGTGCTAGGG - Intronic
1124363184 15:29053834-29053856 CGGAGGCAGCCACTGTGGGGAGG - Exonic
1124383828 15:29190023-29190045 CAGAGGCAGGCCCTGTCATCGGG + Intronic
1124494580 15:30178581-30178603 CTAAGTCAGGCTCTGTGGAGAGG - Intergenic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124614130 15:31229367-31229389 AACAGGCAGGCTCTGTGCCGTGG + Intergenic
1124692979 15:31841121-31841143 CAGAGGTGGGGGCTGTGGTGTGG + Intronic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124748990 15:32360064-32360086 CTAAGTCAGGCTCTGTGGAGAGG + Intergenic
1124822731 15:33063376-33063398 AAGAGGGAGGCTGAGTGGTGTGG - Intronic
1124962524 15:34409551-34409573 CAGAGGCAGCCACTGTGTGGAGG - Intronic
1124979148 15:34555773-34555795 CAGAGGCAGCCACTGTGTGGAGG - Intronic
1125096793 15:35864135-35864157 CAGAGGCAGATTCTCTGATGAGG + Intergenic
1126118316 15:45228874-45228896 TAGAGGCAGGCTCTGTCCTGAGG - Intergenic
1126667702 15:51090119-51090141 AAGAGGCAGCGTCTGTGGGGTGG + Intronic
1127261922 15:57332601-57332623 CAGAGGAAGGCTCCCTGCTGCGG - Intergenic
1127791906 15:62405666-62405688 CTGAGACTGGCTCTGGGGTGGGG + Intronic
1128680340 15:69647001-69647023 CAGAGGCAGGCTGTGGGGGTGGG - Intergenic
1128778944 15:70345255-70345277 CATAGGCAGGCTCTGTGCTAAGG - Intergenic
1129262062 15:74374151-74374173 CAGGGGAAGGCTCTGTGGACAGG - Intergenic
1129884437 15:79028661-79028683 CAGTGGCAGGGTCTGGGGAGTGG + Intronic
1130106146 15:80929946-80929968 CACAGGCTGGGTCAGTGGTGAGG + Intronic
1130262956 15:82373774-82373796 CAGAGGCAGGGGCTGTGTTAGGG - Intergenic
1131693634 15:94853873-94853895 CATAGGCGTGTTCTGTGGTGGGG + Intergenic
1132030830 15:98437596-98437618 CAGGGACATGCTCTGTGCTGGGG - Exonic
1132037146 15:98493970-98493992 CAGACCCAGGCTATGTGCTGTGG + Intronic
1132698662 16:1212989-1213011 CCGAGGCAGGTCCTGGGGTGTGG + Intronic
1132761354 16:1510007-1510029 CAGAGCCAGGCTTTGTAGCGAGG + Exonic
1133008536 16:2897719-2897741 CAGAGGCAGGACCTGCTGTGGGG - Intronic
1133130003 16:3671147-3671169 CAGAGGGAGCCTGTGGGGTGAGG - Intronic
1133332390 16:4982551-4982573 CAGCCCCAGGCTCTGTGCTGGGG - Intronic
1133558313 16:6926403-6926425 CTGAGGCCTGCTGTGTGGTGAGG - Intronic
1133859772 16:9583599-9583621 CATGGACAGGGTCTGTGGTGTGG - Intergenic
1134410426 16:13999413-13999435 CAGAGCCAGTCACTTTGGTGTGG - Intergenic
1134573042 16:15308150-15308172 CAGAGGCAGATCCTGTGATGAGG - Intergenic
1134729340 16:16447806-16447828 CAGAGGCAGATCCTGTGATGAGG + Intergenic
1134938093 16:18264058-18264080 CAGAGGCAGATCCTGTGATGAGG - Intergenic
1135397059 16:22139259-22139281 AAGAGGCAGCCTCTGAGGAGGGG - Intronic
1135862204 16:26066943-26066965 CATTGGCAGGGTCTGTGCTGTGG + Intronic
1136139906 16:28281853-28281875 CCCAGGCAGGCTCTGGGGGGTGG + Intergenic
1137026676 16:35483154-35483176 AACAGACAGGATCTGTGGTGAGG - Intergenic
1137569737 16:49557611-49557633 CAGAAGCAGCCTCTGGGCTGGGG + Intronic
1137586734 16:49668332-49668354 CAGAGTCAGCCTCTGAGTTGTGG - Intronic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1139391418 16:66608225-66608247 CTGAGCCAGGCCCTGTGGTCAGG - Intronic
1140967502 16:79981166-79981188 CTGCGCCAGGCTCTGTGCTGGGG + Intergenic
1141392807 16:83678631-83678653 GAGGGCCAGGCTCTTTGGTGAGG + Intronic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1142225004 16:88872939-88872961 CAGAGCCCGGCTCTGTGCTATGG - Intergenic
1142433731 16:90044271-90044293 CAGGGTCAGGCTTTGTGGGGAGG - Exonic
1142611801 17:1112578-1112600 CAGAGCCAGACTCTGTCTTGAGG + Intronic
1142791782 17:2272331-2272353 CAGAGGCATGGTTTGGGGTGAGG - Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1142969970 17:3604702-3604724 CAGAGGCAGGCAGTGTGTGGCGG + Intergenic
1143200626 17:5110918-5110940 AAGAGGGAGGGTATGTGGTGAGG + Intronic
1143371271 17:6441558-6441580 CTGAGGAAGGCAGTGTGGTGTGG + Intergenic
1143539982 17:7563003-7563025 GAGAGGCAGGATCTGCGGTGGGG + Intronic
1143610227 17:8013822-8013844 CAGAGGCAGCCTTTGTGTTCTGG + Intronic
1144672592 17:17141378-17141400 CGGAGGCAGGCGCTGGGGTAGGG - Intronic
1144834994 17:18152057-18152079 AACAGGCAGGCCCTGTGGAGGGG - Intronic
1146056514 17:29584046-29584068 CAGAGGCAGGACCTGTGGACGGG - Intronic
1146477304 17:33173277-33173299 CAGAAGCAGGCTATCTGGGGTGG + Intronic
1146946328 17:36876175-36876197 CAGATGCAGGCTCTGATCTGGGG + Intergenic
1146964172 17:37010793-37010815 CAGAAGCAGCCTCTGGTGTGAGG + Intronic
1147853266 17:43458812-43458834 CAGAGGAAGCCTCTGTAGTTTGG + Intergenic
1147882225 17:43661307-43661329 CTGGGGCAGGCTGTGTGGGGTGG + Exonic
1149078214 17:52622474-52622496 CAGAAGCAGAATCTGTGGTGGGG + Intergenic
1149996413 17:61408275-61408297 CAGAGGCCAGCCCGGTGGTGAGG - Exonic
1151434798 17:74088414-74088436 CAGAGGCAGGCTGTGTGCAGAGG - Intergenic
1151465400 17:74281776-74281798 CAGAGGGAGGGTGTGGGGTGAGG - Exonic
1151482495 17:74378705-74378727 CAGAGGCTGCGTGTGTGGTGGGG - Intergenic
1151494569 17:74451826-74451848 CAGAGGCAGGGTCGGGGGTGGGG - Intergenic
1151672489 17:75579082-75579104 GAGAGCCAGGCTCGGGGGTGTGG + Intergenic
1151815132 17:76468034-76468056 CACATGCAGGATTTGTGGTGGGG - Intronic
1151944317 17:77311232-77311254 CCTAGGGAGGCTCTGGGGTGGGG - Intronic
1152093341 17:78258666-78258688 CAGGCGCAGGCGCTGGGGTGTGG + Intergenic
1152187360 17:78866234-78866256 CAGAGGCATGGTCTGCAGTGTGG - Intronic
1152756258 17:82088325-82088347 CAGACGCCCGCTCTGTGCTGAGG - Intronic
1153122840 18:1751434-1751456 GAGAGGCAGGCCCTCTGTTGGGG - Intergenic
1153728052 18:7978118-7978140 CAGAGGCTGGCTTTGTAGTGAGG - Intronic
1154172348 18:12061032-12061054 CAGTGGCAGGCGGGGTGGTGAGG + Intergenic
1155215053 18:23635870-23635892 CAGAGGCAGGCTCTGTGGTGGGG + Intronic
1155238334 18:23843451-23843473 CAGAGAAAGACTCTGGGGTGTGG - Intronic
1155245467 18:23904509-23904531 CAGAGGAAGGCTGTGGGGAGTGG + Intronic
1155791116 18:29971828-29971850 CAGAGGCAGGCTGGGTGCGGTGG - Intergenic
1156022798 18:32619119-32619141 TGGAGGCAGGTTCTGAGGTGGGG + Intergenic
1156384125 18:36590909-36590931 CAGAGGGAGCCTCTGTGAGGTGG + Intronic
1156496787 18:37531027-37531049 CTGAGGCAGGAGCTGGGGTGGGG + Intronic
1156605713 18:38664770-38664792 CTGAGTCAGGCTGTGTAGTGAGG + Intergenic
1156868653 18:41917557-41917579 TATTGACAGGCTCTGTGGTGGGG + Intergenic
1157452699 18:47800278-47800300 CAGGAGCAGGCTCTGGGGAGAGG + Intergenic
1157608112 18:48939060-48939082 CACAGGCAGGCTCTGGGATAGGG - Intronic
1160524360 18:79526314-79526336 CAGAGCCAGGCTCTCTGCAGAGG - Intronic
1160874336 19:1290221-1290243 CCGAGGCAGCTCCTGTGGTGGGG + Intronic
1161052358 19:2171201-2171223 CAGCCTCAGGCTGTGTGGTGGGG + Intronic
1162478746 19:10915902-10915924 CCTAGGCAGTCCCTGTGGTGTGG + Intronic
1162761703 19:12892306-12892328 CAGAGCCAGACTCTGTTGGGGGG - Intronic
1163264073 19:16207823-16207845 CAGTGGCTGGCTGTGGGGTGGGG - Intronic
1163415498 19:17184050-17184072 CAGAAGCAGGGTCTGAGATGGGG + Intronic
1163452235 19:17385236-17385258 CAGTGGCTGGCTCTGTAGGGTGG + Intergenic
1163575827 19:18110290-18110312 CAGAGGCCGCCTCTGTGCGGCGG - Intronic
1164523992 19:29000254-29000276 CTGAGGCAGGCTCAGAGCTGTGG + Intergenic
1164916457 19:32056114-32056136 CAAAGGCTGACTCTGTGGAGGGG + Intergenic
1165362765 19:35346865-35346887 CAGAGCCAGTCTTTTTGGTGAGG + Exonic
1165589571 19:36955985-36956007 CAGAAGCAGGCTTTGAGATGAGG + Intronic
1165827042 19:38711473-38711495 CAGGGTCAGTCTGTGTGGTGTGG - Intronic
1166532247 19:43550050-43550072 CAGGGGCAGGCTCTGTTGGGAGG - Intronic
1167076185 19:47250920-47250942 CAGAGCCAGGCTCTGTGGGGAGG - Intergenic
1167100861 19:47403542-47403564 CGGAGGCTGGGTCTGTGGAGAGG + Exonic
1167151758 19:47714008-47714030 GAGAGGCAGGATCTGGGATGTGG - Intronic
1167851624 19:52206678-52206700 CACAGGCAGGCAGTGGGGTGGGG - Intronic
925031740 2:655065-655087 CAGAGGCACGCTCTGAGCAGAGG + Intergenic
925167685 2:1728347-1728369 TAGAGAGAGGCTCTGTGCTGAGG - Intronic
925404086 2:3594900-3594922 CTGAGGCCGGCTTTGGGGTGGGG - Intronic
926112651 2:10192862-10192884 CAGAGGCTGGCTCTGGAGAGGGG - Intronic
926197280 2:10771642-10771664 CAGGGCCAGGCTCTGTGCTGGGG - Intronic
926777875 2:16439987-16440009 GAGAGCCTTGCTCTGTGGTGAGG - Intergenic
926789214 2:16553294-16553316 CAGGGGCAGCCTCAGTGGTCAGG - Intronic
926896342 2:17693532-17693554 CCGGGGCCGGCTGTGTGGTGGGG + Intronic
927141947 2:20136731-20136753 CAGAGAGAGGCTCTGCGGAGAGG + Intergenic
927554087 2:24020451-24020473 CAGAGGCTGCCTCTGGGGAGGGG - Intronic
927670112 2:25061829-25061851 CACAGGCTGGCTCCCTGGTGTGG - Intronic
927886168 2:26720378-26720400 CAGAGGCCGGCTTTGTGCAGAGG - Intronic
928325619 2:30317317-30317339 CAGTGGCAGGACATGTGGTGTGG - Intronic
929584095 2:43102511-43102533 AGGAGCCAGGCCCTGTGGTGCGG - Intergenic
929779886 2:44950815-44950837 TAGAGTCAAGCTCTGTGGTTTGG - Intergenic
929907406 2:46058308-46058330 CAGAGGCTGGATGGGTGGTGTGG - Intronic
929979193 2:46663116-46663138 CAGAGGCAGGCTCTGGTTTCAGG + Intergenic
930075998 2:47406133-47406155 CAGAGTCTGGCTCTGTGGCTAGG + Intronic
930159436 2:48139056-48139078 CACCTGCAGCCTCTGTGGTGCGG + Intergenic
930700852 2:54456758-54456780 GGGCGGCAGGCTCTGCGGTGAGG + Intronic
931063230 2:58554807-58554829 AAGGGGAAGGGTCTGTGGTGTGG - Intergenic
931206259 2:60148847-60148869 CAGAGGAAGTCTCTGTGGCTAGG + Intergenic
931538126 2:63300768-63300790 GAGAGACAGTCACTGTGGTGGGG - Intronic
931698578 2:64890514-64890536 CAGTGGGAGGATCTGTGGTCAGG - Intergenic
932480485 2:72036207-72036229 CAGAGGAGAGCTCTGTGGAGAGG + Intergenic
932730072 2:74213521-74213543 CTGAGGCAGGGTGTGAGGTGGGG - Intronic
932871992 2:75410028-75410050 CAGGGGCAGGCTATCTGGTGTGG - Intergenic
932911363 2:75809585-75809607 CAGAAGCAGACTCTGAGTTGAGG + Intergenic
934474882 2:94587254-94587276 GAGAGGCAGGCTCTGGACTGGGG + Intergenic
934502326 2:94870673-94870695 CGGAGGCAGGTCCTGTGCTGCGG - Intergenic
934602808 2:95671085-95671107 CAGAGGCAAATTCTCTGGTGGGG - Intergenic
935313522 2:101808208-101808230 AAGATGAGGGCTCTGTGGTGTGG + Intronic
935681004 2:105636948-105636970 CAGAGGCAGGCCCTGGTGAGGGG - Intergenic
935706778 2:105864088-105864110 CTGGGGCAGCCTCTGGGGTGGGG + Intronic
936548055 2:113409659-113409681 CAGGGCCAGGCTCTGGAGTGTGG - Intergenic
936777906 2:115995910-115995932 CAGAGGTAGGGTCTGTTGAGAGG + Intergenic
937311243 2:120904705-120904727 CAGAAGCAGACTCTCTGGGGTGG - Intronic
937777170 2:125791843-125791865 CAGAGGCACCCTGTATGGTGTGG - Intergenic
937989815 2:127655933-127655955 CAGAGGCAGGCCCTGCTGTGGGG + Intronic
938064877 2:128276480-128276502 CAGAGGCTAGCCCTGGGGTGTGG + Intronic
938951106 2:136255336-136255358 CAGATGCAGCCTCTGAAGTGAGG - Intergenic
938951249 2:136256697-136256719 CAGAGGAAGGCTCTGTTAGGAGG - Intergenic
943256910 2:185606052-185606074 CAGGGGCAGAGTCAGTGGTGGGG + Intergenic
944182762 2:196913668-196913690 CATAGGAAGGATCTGTGTTGGGG - Intronic
944507868 2:200432242-200432264 CAGAGGGAGGAGCTTTGGTGGGG + Intronic
945151153 2:206793194-206793216 CAGAGTCTCGCTCTGTGGTCAGG - Intergenic
945558580 2:211309486-211309508 TAGGGGCAGGTTCTGTGTTGAGG + Intergenic
945942004 2:215959693-215959715 CAGAGGCAGACTCTGTGTGGAGG - Intronic
946131706 2:217611626-217611648 CAAAAGCAGGCTCTGTGTAGGGG + Intronic
946618494 2:221535142-221535164 CAGAGTCAGCCTTAGTGGTGTGG + Intronic
947055261 2:226092405-226092427 CATAGGCATGCTATGTGGTGAGG - Intergenic
947605738 2:231484031-231484053 CGGAGGCTGCCTCTGGGGTGCGG + Intergenic
947712601 2:232324633-232324655 CAGAGGGTGGCTTTGTGGTGAGG + Intronic
947926230 2:233924991-233925013 CAGTGCCAGTCTCTGAGGTGTGG + Intronic
948577374 2:238963626-238963648 CAGAGGGAGGCTCTGCCCTGAGG - Intergenic
948883405 2:240871488-240871510 CAGAGCCAGGCTATGGGGAGGGG + Intronic
1168814326 20:726454-726476 CAGAGGTGGGCTCTGGGGTGAGG - Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1169971101 20:11270374-11270396 CAGAAGCAGGCCCTGTGATAAGG + Intergenic
1170591104 20:17772667-17772689 CTGAGGCAGGCACTTTGCTGGGG - Intergenic
1170896618 20:20420623-20420645 CAGAAGCAGGCTCTCCGGTGAGG + Intronic
1172163844 20:32886749-32886771 CAGAGGAAGGCTCTCTGGGAAGG + Intronic
1172229722 20:33328562-33328584 CAGAAGCAGACTCTGAGCTGGGG + Intergenic
1172282262 20:33716296-33716318 CAGAGGAGGGCCCTGGGGTGAGG - Intronic
1172570216 20:35964405-35964427 CAGAGATAGACTCTGTGGTTGGG - Intronic
1172740164 20:37160353-37160375 CAGAGCCAGGGTCTGGGGTCTGG - Intronic
1172799286 20:37564837-37564859 CACAGGCTGGCTCAGAGGTGGGG + Intergenic
1173737614 20:45373064-45373086 CAGAGGCAGGCTGCATGGAGTGG - Exonic
1173809272 20:45946432-45946454 CAGAGGCGGGCCCTGTGCTCTGG - Intronic
1174044750 20:47725716-47725738 GAGAGGCAGGCTGGGTGGGGAGG - Intronic
1174265629 20:49329636-49329658 CAGAGTCAGGTCATGTGGTGAGG - Intergenic
1174324588 20:49769062-49769084 CAGAAGCAGACTCTGAGATGAGG + Intergenic
1175333192 20:58178653-58178675 CAGAGGCATGGTCTGAAGTGAGG + Intergenic
1175828962 20:61951706-61951728 CAGGGTGAGGCCCTGTGGTGGGG + Intergenic
1175935980 20:62514224-62514246 AGGAGGCAGGGTCTGAGGTGGGG + Intergenic
1176056816 20:63153153-63153175 CAGAGGCCTCCTCTGTGGAGGGG - Intergenic
1176125780 20:63473830-63473852 CAGAGGAAGGCCCAGTGGCGGGG - Intergenic
1178375104 21:32060181-32060203 TACAGGCAGGTGCTGTGGTGGGG + Intergenic
1178752954 21:35321652-35321674 CAGAGGCCGTCTCTGGAGTGAGG + Intronic
1179158410 21:38872272-38872294 TACAGGCATGCACTGTGGTGTGG + Intergenic
1179309658 21:40184502-40184524 CAGAGACAGGGCCAGTGGTGTGG - Intronic
1179465402 21:41568357-41568379 AGGAGGCAGAATCTGTGGTGGGG - Intergenic
1179534750 21:42044286-42044308 CTGAGGCAGGCTGGGTGGTGAGG - Intergenic
1179987781 21:44931072-44931094 GAGGGGCAGGCTCTGGGGTCTGG - Intronic
1180917528 22:19499439-19499461 TAGAGGCAGGTGCTGAGGTGTGG + Intronic
1180933374 22:19608279-19608301 CGGATGCAGCCTCTGTGGGGAGG + Intergenic
1180985879 22:19903705-19903727 CAGAGGCAGGCACTGGGGGTCGG - Intronic
1181130206 22:20726765-20726787 CTGAGGCAGGCTCCCTAGTGAGG - Intronic
1181133464 22:20748352-20748374 AACAGGCAGGCTGTGTGGTGTGG + Intronic
1181343516 22:22200878-22200900 CTGAGGCAGACACTGAGGTGGGG - Intergenic
1181391754 22:22588158-22588180 TAGAGGCAGGCCCGGTGCTGGGG + Intergenic
1181541960 22:23578432-23578454 CAGGGTCAGGCTCTGTGCTGGGG - Intronic
1181765361 22:25087674-25087696 CAGAAGCAGACTCTGAGGTGGGG + Intronic
1181788296 22:25243484-25243506 CAGAGACAGGCTCTGTGCACAGG - Intergenic
1181817842 22:25452473-25452495 CAGAGCAAGACTCTGTCGTGGGG - Intergenic
1181820037 22:25468498-25468520 CAGAGACAGGCTCTGTGCACAGG - Intergenic
1183244810 22:36685521-36685543 CAGAGGCAGAACGTGTGGTGTGG - Intronic
1183685906 22:39361300-39361322 CGGGGGCAGGCACTGGGGTGAGG + Intronic
1184149248 22:42628925-42628947 CAGAGGGTGGCTATGGGGTGTGG + Intronic
1184265498 22:43343698-43343720 CAGAGGCAGCCTCGGGGGCGGGG + Intergenic
1184466380 22:44670757-44670779 CAGAGGCGGGCAGCGTGGTGTGG + Intronic
1184586662 22:45452620-45452642 CAGAGGCAGTCCCTGCAGTGAGG + Intergenic
1184667542 22:45996774-45996796 AAGAGGCAGGCTCTGCAGAGAGG - Intergenic
1185304167 22:50103451-50103473 CTGAAGCACTCTCTGTGGTGGGG + Intronic
949477422 3:4461947-4461969 CAGTGGCAGAAGCTGTGGTGTGG - Intronic
950139097 3:10602872-10602894 AGGAGGGAGGCTCTGAGGTGTGG - Intronic
950531978 3:13557542-13557564 CCCAGGCAGGCTCTGCCGTGTGG + Intronic
950556699 3:13700426-13700448 CATAGGCAGGCTTGCTGGTGGGG - Intergenic
952716552 3:36486023-36486045 GAGAAGCAGGCTCTGTGCAGAGG - Intronic
952833902 3:37588416-37588438 CAAGGGCAGCCTCTGTGGGGAGG - Intronic
953041162 3:39256032-39256054 CAGAGACAGGGTCTGAGGAGGGG + Intergenic
953912560 3:46900262-46900284 CAGATGCAGGCTCTGGGGCTAGG + Intronic
954214671 3:49117664-49117686 CAGATACAGACTGTGTGGTGCGG - Exonic
954416815 3:50397345-50397367 AACAGGCAGGCCCGGTGGTGGGG + Intronic
954437539 3:50503877-50503899 GAGCGGCAGGGTCTGAGGTGTGG - Intronic
954689796 3:52389611-52389633 CCCAGGCAGGGCCTGTGGTGTGG + Intronic
954895090 3:53968288-53968310 CAGAGCCAGGCACTCTGCTGAGG - Intergenic
955228018 3:57077187-57077209 GAGAGGCAGGCTGTGAGGTTAGG - Intronic
955339702 3:58116001-58116023 TAGGGCCAGGCTCTGTGCTGGGG - Intronic
955458503 3:59152291-59152313 TATAGGCAGGCTCTGAGATGGGG - Intergenic
956770548 3:72522464-72522486 CAGAAGCTGTCTTTGTGGTGGGG - Intergenic
956774017 3:72550050-72550072 CAGGGGCAGGTACTGTGGGGAGG + Intergenic
960360212 3:116701994-116702016 CTGAGGGAGTCGCTGTGGTGTGG - Intronic
960621483 3:119640937-119640959 CAGAGTCTGGCTCTGTCCTGAGG - Intronic
960766534 3:121136307-121136329 TAGAGTCAGGAGCTGTGGTGGGG - Intronic
961029256 3:123587601-123587623 CAGAAGCAGGCTCAGTGCAGGGG - Intergenic
961384874 3:126517738-126517760 CAGAGGCCAGCACTGTGGGGAGG + Exonic
962198268 3:133381077-133381099 CAGATGGTGGCTCTGTGCTGCGG - Exonic
962273495 3:133995373-133995395 GAGAGGCAGCCACGGTGGTGGGG - Intronic
962347659 3:134630435-134630457 CAGAGGCAGACACAGTTGTGGGG + Intronic
966350842 3:179032024-179032046 CAGAGGGAGGCTGTGTGGAGGGG - Intronic
967445073 3:189555829-189555851 CAGTGGCAGGCAGTCTGGTGTGG - Intergenic
967821814 3:193845654-193845676 CAGAGGCAGAATGTGTGGTTGGG - Intergenic
967874406 3:194257143-194257165 CAGAGGCGGGATCAGAGGTGGGG - Intergenic
968151218 3:196338171-196338193 CAGAGCCAGGCTCACTGGAGTGG + Intronic
968433533 4:573436-573458 CAGGTGCAGGCTCTGGAGTGAGG - Intergenic
968615821 4:1577330-1577352 CAGAGGCAGGGCCTGTGCTCAGG + Intergenic
968688798 4:1979055-1979077 CTGAGGATGGCTCAGTGGTGGGG - Exonic
968837409 4:2975275-2975297 CAGAGTCTGGCTCTGTGGCCAGG - Intronic
968927972 4:3559957-3559979 CACAGACAGGCTCAGTGGGGTGG - Intergenic
968943463 4:3651451-3651473 CACAGGCTGGCACTGTGGGGCGG - Intergenic
969297606 4:6279055-6279077 CAGCTGCAGGCCCAGTGGTGGGG - Intronic
969324234 4:6431685-6431707 CAGAGGCAGGCCCCGAGGTGTGG - Intronic
969397599 4:6932763-6932785 TAGAGCCAGGCACAGTGGTGTGG - Intronic
969482835 4:7455804-7455826 TAGGGTCAGGCTCTGTGTTGGGG + Intronic
970350065 4:15193337-15193359 CAGAAGCAGGCTCTGAGATAAGG + Intergenic
971030356 4:22630362-22630384 CAGAGGCAAGCTCTGAGGGTTGG - Intergenic
971361269 4:25940668-25940690 CAGAGCCAGGATCTGTGCTTGGG - Intergenic
971727130 4:30328183-30328205 CAGAGGCAGGGGCTGTGGAGTGG + Intergenic
975923377 4:79419850-79419872 CAGAGACAGGCTGGGTGTTGTGG - Intergenic
976350434 4:84054343-84054365 CAGAGGTGGGCTCTGTAGGGGGG - Intergenic
976511246 4:85911339-85911361 CAGTGGCAGGCTGTCTGGAGCGG + Intronic
976725013 4:88207335-88207357 CAGAGGCAGACTCTGTAAAGTGG + Intronic
976912272 4:90322776-90322798 CAGAAGGAGACTCTGTGGTAAGG + Intronic
978986368 4:115017835-115017857 CAGGAGCAGGCTATGTGGTTGGG - Intronic
981658233 4:147136589-147136611 CAGAGGCAGGGAGTGTGGTGGGG - Intergenic
983343970 4:166502688-166502710 CAGAGTCAGACTCAGTTGTGAGG + Intergenic
983666326 4:170188598-170188620 CAGATGCAAGCTCAGTGATGAGG + Intergenic
984542767 4:181060860-181060882 CAGAGGCAAGCCTGGTGGTGAGG - Intergenic
985516258 5:346462-346484 CAAATGCAGTCCCTGTGGTGGGG - Intronic
985997476 5:3604986-3605008 CAGAGGCAAGGTCTAGGGTGGGG + Intergenic
986286850 5:6365509-6365531 CAGAGCCAAGCCCTGTGATGAGG + Intergenic
986725750 5:10595130-10595152 CAGAGGGAGGTGCTGTGTTGGGG + Intronic
988483067 5:31645813-31645835 CAGGGGCACGCTTTGTGCTGTGG + Intronic
990278966 5:54229778-54229800 CAGAGGGAGCCCCTATGGTGTGG - Intronic
991040425 5:62169445-62169467 CAGAGGCTGGCTCAGAGCTGTGG - Intergenic
991054270 5:62305586-62305608 CAGAAAGAAGCTCTGTGGTGGGG - Intergenic
991930597 5:71749805-71749827 TACAGGCAGGCTCTATGGGGAGG + Intergenic
992139435 5:73780852-73780874 CAGAGGCAAGATCAGGGGTGTGG + Intronic
992419167 5:76584475-76584497 CAGAGGTAGGAGCTGTCGTGAGG + Intronic
992494844 5:77282132-77282154 CAGAGGCAGACCCTGTGATTTGG + Intronic
992507959 5:77406621-77406643 AGGAGGCAGGCTCTGATGTGGGG + Intronic
992671829 5:79069436-79069458 CTGAGGCAGGCTCAGGGGTTAGG - Intronic
993883912 5:93394947-93394969 CAGACTCAGGGTCTGTTGTGGGG - Intergenic
995275574 5:110274169-110274191 CAGAGCCAGGCTCTGTCTTGGGG - Intergenic
995783461 5:115802570-115802592 CAGAGGCAGGGAGAGTGGTGAGG + Intergenic
996873420 5:128216408-128216430 CAGAGGAAGGCTCTCAGTTGTGG + Intergenic
997841740 5:137247202-137247224 CAGAGGAGGGCACTGTGGAGGGG + Intronic
997949416 5:138230411-138230433 CAGAGGCAGGAGCTGGGGAGAGG - Intergenic
998904947 5:146894725-146894747 CAGAGGCAGGCTAGGTGTGGTGG - Intronic
999750884 5:154627575-154627597 CAGAGGCAGGGTGTGTGTTGGGG - Intergenic
1000337568 5:160253179-160253201 CAGAGGAATGCTCTCGGGTGAGG + Exonic
1001225862 5:169944173-169944195 CAAAGGCAGGGCCTTTGGTGTGG - Intronic
1001315308 5:170637503-170637525 CAGAGGGAGGAGCTGAGGTGTGG - Intronic
1001603049 5:172941498-172941520 CAGAGGCAGGCACTGGGGTCAGG - Intronic
1002100283 5:176854258-176854280 CAGAGACAGCACCTGTGGTGAGG - Intronic
1002196510 5:177504373-177504395 TAGCGGCAGGCTCTGGGGTCCGG + Exonic
1002604373 5:180373465-180373487 ATGGGGCAGGCTCTGTGGTCAGG + Intergenic
1002609033 5:180401963-180401985 CAGAGGCAGGATCGCTGGTAGGG - Intergenic
1003269287 6:4593137-4593159 CAGAGCCAGGCCCTGCGGTGGGG - Intergenic
1005302159 6:24481584-24481606 CTGAGCCAAACTCTGTGGTGAGG - Intronic
1005573790 6:27173021-27173043 AAGAGTCAGACTGTGTGGTGGGG + Intergenic
1006694666 6:35920890-35920912 CAGAGGCAGGGGGTGTGGGGCGG + Intronic
1006813524 6:36836365-36836387 CAGAAGAAGGCTCTGTGGTAGGG + Intronic
1007116549 6:39347303-39347325 CAGGGGCAGGCAGTGTGGTCAGG - Intronic
1007291289 6:40788926-40788948 CAGGGGCAGGCCGTGTTGTGGGG + Intergenic
1010316468 6:74456521-74456543 CAGAGTCTCGCTCTGTCGTGAGG - Intergenic
1011276966 6:85641940-85641962 CAGGGGCGGGCTTTGGGGTGCGG - Intronic
1014262016 6:119230376-119230398 CACTGACAGACTCTGTGGTGGGG - Intronic
1015884102 6:137898589-137898611 CAGAAGCAGGCTCTGGATTGAGG - Intergenic
1016536201 6:145109534-145109556 CAGAGGCAAGCCCTGAGCTGTGG + Intergenic
1016585803 6:145683689-145683711 GACAGGCAGGGTCTGTTGTGGGG - Intronic
1016997611 6:149971170-149971192 CCTGGGCTGGCTCTGTGGTGTGG + Intronic
1018083206 6:160276639-160276661 AATGGGAAGGCTCTGTGGTGTGG - Intronic
1018253362 6:161894487-161894509 GAAAGGCAGGTGCTGTGGTGAGG - Intronic
1018620351 6:165724863-165724885 CAGAGGCAGGTTCCCTGGTCAGG + Intronic
1018729826 6:166640446-166640468 GAGAGGCGCGCCCTGTGGTGCGG + Intronic
1018915135 6:168128450-168128472 CAGAGGCAGGGTCACTGCTGGGG - Intergenic
1018934034 6:168261544-168261566 CCAAGGCAGCCTCTGTGGTCAGG - Intergenic
1019200497 6:170310392-170310414 CACAGGGTGGCTCTGTGGTGAGG + Intronic
1019979913 7:4613848-4613870 CAGAAGCAAACTCTGTGGTAAGG - Intergenic
1021195923 7:17674189-17674211 CGGAGGCAGGCTCTTTATTGGGG + Intergenic
1021999141 7:26208225-26208247 CGGAGGCAGGCTGGGGGGTGGGG + Intronic
1022467002 7:30658666-30658688 CTAAGGCAAGCTCTGTGGTTAGG - Intronic
1022506618 7:30911741-30911763 CAGAGGAGGTCTGTGTGGTGTGG + Intergenic
1022525311 7:31033400-31033422 AAGAGGAAGGCCCTGAGGTGTGG + Intergenic
1022970535 7:35512996-35513018 CAGAGGCTGCCTCTGGGGAGGGG + Intergenic
1023333206 7:39140909-39140931 CAGAGGCAGGATGTCTGGTTAGG + Intronic
1025968840 7:66302938-66302960 GAAAGGGAGGCACTGTGGTGTGG - Intronic
1026101846 7:67390282-67390304 CAGAGCCAGGAGCTGTGCTGTGG - Intergenic
1026362943 7:69619442-69619464 CACAGGAAGGCTCTGAGCTGTGG + Intronic
1029610601 7:101624685-101624707 AAGAGGCAGATCCTGTGGTGGGG - Intronic
1030213676 7:107021464-107021486 CAGAGGCAGCCTCTGGATTGAGG - Intergenic
1030259245 7:107544609-107544631 CCTAGGCAGGCTTTCTGGTGTGG - Intronic
1030330347 7:108263687-108263709 GTGAGCCAGGCTCTGTGGAGTGG - Intronic
1031411420 7:121444327-121444349 CAGAGGCAGTATCTCTGGGGAGG - Intergenic
1032624317 7:133573501-133573523 CAGAGGCAGCTTCTGTAATGGGG + Intronic
1034374615 7:150631102-150631124 CAGATGAAGGGTCTGGGGTGTGG + Intronic
1034452370 7:151143874-151143896 CATTGGCAGGCTCTCTGTTGGGG - Exonic
1034878828 7:154748628-154748650 CAGAGGCAGGCTGTGCAGGGAGG - Intronic
1035262972 7:157673633-157673655 CAGAGGGGGCCTCTGTGGGGCGG - Intronic
1035262992 7:157673702-157673724 CAGAGGGGGCCTCTGTGGGGCGG - Intronic
1035269849 7:157712821-157712843 CAGAGGCAGGGACTGGAGTGGGG + Intronic
1035357555 7:158285633-158285655 CAGCAGCATGCTCTGTGGTGTGG - Intronic
1035387147 7:158481103-158481125 CACAGGCTGGCTCTCTTGTGAGG + Intronic
1035527752 8:327007-327029 GAGAGGCTGGCCCTGGGGTGGGG - Intergenic
1035934854 8:3825531-3825553 CAGGGGCAGGTTCAGGGGTGTGG + Intronic
1036397205 8:8379384-8379406 CAGAGGCAGGCCCTGCTTTGAGG - Intronic
1036496710 8:9276869-9276891 TAGAGGCAGGAAATGTGGTGCGG - Intergenic
1036813272 8:11882339-11882361 CAGAGCCAGGCTCTGCAATGAGG - Intergenic
1037069425 8:14625316-14625338 CAGAAGCAGCTTCTGTTGTGTGG + Intronic
1037492906 8:19412557-19412579 CAGACGCAGCCTCAGTGCTGAGG - Intronic
1037947298 8:22997398-22997420 CAGAGGCAGGAGCTTTGCTGGGG - Intronic
1038347734 8:26747672-26747694 CAAAGGCAGGTGCTGGGGTGTGG - Intergenic
1038596533 8:28890859-28890881 CAGACGCGGGCTGTGGGGTGGGG + Exonic
1039108325 8:34014216-34014238 CAGAGTCAGGTACTGTGATGAGG + Intergenic
1039177445 8:34825562-34825584 CAGAGGCATGCTTGGTGGCGTGG + Intergenic
1039177461 8:34825653-34825675 CAGAGGCATGCTTGGTGGTGTGG + Intergenic
1039557322 8:38485806-38485828 CAGTGGCAGGGGCTGTGTTGTGG - Intergenic
1042608879 8:70576671-70576693 CAGCGGCAGCCCCTGTGGAGTGG + Intronic
1043750216 8:83925730-83925752 CAGTGCCTGGCTCTGTGCTGTGG - Intergenic
1044792600 8:95863361-95863383 AAGAGGCAGGGTGGGTGGTGAGG - Intergenic
1046448513 8:114357361-114357383 CAGAGGGAGGCTCTATGTTTGGG + Intergenic
1047198989 8:122747921-122747943 CAGAGGCACAGCCTGTGGTGAGG - Intergenic
1047960787 8:130010322-130010344 CAGAGGGTGGCACTGTGGAGCGG + Intronic
1048002843 8:130393737-130393759 CAGAGCGAGACTCTGTGTTGCGG + Intronic
1048970936 8:139644718-139644740 CAGTGGGAGGCTCTGGGGGGGGG - Intronic
1049095638 8:140546660-140546682 CATAGGCAGCCCCTGTGGCGTGG - Intronic
1049190453 8:141284728-141284750 CACAGGCAGGCTTTGTACTGGGG - Intronic
1049364759 8:142231826-142231848 CAGCAGCAGGCTCTGTGGCTGGG - Intronic
1049436985 8:142591045-142591067 AAGAGGCAGGGTCTTTGGTGGGG - Intergenic
1049445143 8:142626671-142626693 AAGTGGCAAGCACTGTGGTGTGG - Intergenic
1049548064 8:143243834-143243856 CAGAGGCAGCCTCTCTGAAGAGG - Intergenic
1049608276 8:143540017-143540039 CGGGGGCAGGGCCTGTGGTGGGG - Intronic
1049725630 8:144144431-144144453 CAGAGGTAGGCTCAGGAGTGGGG - Intergenic
1049749783 8:144277651-144277673 CACAGGCAGGCTCTGGGCAGGGG + Intronic
1049833033 8:144714128-144714150 CAGAAGCAGACCCTGAGGTGAGG + Intergenic
1050276913 9:4009842-4009864 TAGAGGCAGGGTCTGAGGAGGGG + Intronic
1050324327 9:4485405-4485427 CAGAGTCGGTCTCTGGGGTGGGG - Intergenic
1052855172 9:33402505-33402527 GAGAGGCAGGCTCTGGACTGGGG - Exonic
1052930556 9:34052044-34052066 CAGTGGCTGGCTCTGAGGGGTGG + Intergenic
1053350817 9:37412231-37412253 CAGAAGCAGGCTCTCTGCTGAGG - Intergenic
1053555508 9:39132958-39132980 CAGCGGCTGGCTCTGCGCTGCGG - Exonic
1053576864 9:39362931-39362953 CAGAGACAGACCCTGGGGTGTGG - Intergenic
1053683187 9:40498847-40498869 GAGAGGCAGGCTCTGGACTGGGG - Intergenic
1053802830 9:41775038-41775060 CACAGACAGGCTCAGTGGGGTGG - Intergenic
1053819622 9:41953209-41953231 CAGCGGCTGGCTCTGCGCTGCGG - Exonic
1053841377 9:42190856-42190878 CAGAGACAGACCCTGGGGTGTGG - Intergenic
1053933165 9:43127163-43127185 GAGAGGCAGGCTCTGGACTGGGG - Intergenic
1054098434 9:60921622-60921644 CAGAGACAGACCCTGGGGTGTGG - Intergenic
1054119835 9:61197252-61197274 CAGAGACAGACCCTGGGGTGTGG - Intergenic
1054142417 9:61540032-61540054 CACAGACAGGCTCAGTGGGGTGG + Intergenic
1054191135 9:61986384-61986406 CACAGACAGGCTCAGTGGGGTGG - Intergenic
1054280527 9:63126081-63126103 GAGAGGCAGGCTCTGGACTGGGG + Intergenic
1054296290 9:63334345-63334367 GAGAGGCAGGCTCTGGACTGGGG - Intergenic
1054394307 9:64638850-64638872 GAGAGGCAGGCTCTGGACTGGGG - Intergenic
1054428956 9:65144049-65144071 GAGAGGCAGGCTCTGGACTGGGG - Intergenic
1054462161 9:65471182-65471204 CACAGACAGGCTCAGTGGGGTGG + Intergenic
1054501426 9:65877486-65877508 GAGAGGCAGGCTCTGGACTGGGG + Exonic
1054587919 9:66985310-66985332 CAGAGACAGACCCTGGGGTGTGG + Intergenic
1054647234 9:67601333-67601355 CACAGACAGGCTCAGTGGGGTGG + Intergenic
1055804614 9:80078274-80078296 AAGAGGCAGGGCCTGTGGTGGGG - Intergenic
1056149812 9:83774733-83774755 CAGAGGCTGGCTCTGTTGCCAGG + Intronic
1056235536 9:84590261-84590283 CTTATGCAGGCTCTGGGGTGGGG - Intergenic
1057601338 9:96460356-96460378 CAAAGAAAGGCTGTGTGGTGTGG - Intronic
1057890099 9:98863435-98863457 CATTGGCAGGCTGTGGGGTGGGG + Intergenic
1058604779 9:106708566-106708588 CAGAGGCAGGGTAGGGGGTGGGG - Intergenic
1058650852 9:107174659-107174681 CACAGGCAGCCTCTGTGGTGAGG + Intergenic
1058779088 9:108315520-108315542 CAGAGTCAGCCTCTGTGGTAGGG + Intergenic
1058811569 9:108644582-108644604 AAGAGCCAGGCTCTGTGATGTGG + Intergenic
1059311519 9:113391684-113391706 CAGAGGCACACAGTGTGGTGGGG - Intronic
1060050062 9:120372104-120372126 CTGAGGCAGGGGCTGTGCTGAGG + Intergenic
1060245810 9:121945475-121945497 CAGAGGCATGCTCAGTGGGTGGG - Intronic
1060533633 9:124365190-124365212 CATGGGCAGGCTCTGTGTTCAGG - Intronic
1060824416 9:126679814-126679836 CAGAGTCAGGCTCTGTGTAGAGG - Intronic
1060881582 9:127121844-127121866 CAAAGGCAAGCGCTGTGCTGAGG - Intronic
1060908243 9:127327351-127327373 CAGAGGTGGGGTGTGTGGTGAGG + Intronic
1061015807 9:127980419-127980441 CAGAGGCAGGGGCGGAGGTGCGG + Exonic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061382002 9:130264422-130264444 CAGAAGCAGCCTCAGAGGTGGGG + Intergenic
1061412590 9:130429526-130429548 CAGGGGCATGGTCGGTGGTGGGG - Intronic
1061441670 9:130608497-130608519 CAGGGGCTGAGTCTGTGGTGAGG + Intronic
1061709796 9:132479864-132479886 CAGAGACAGGCTCAAGGGTGAGG + Intronic
1061770891 9:132920569-132920591 TAGAGGCAGTGTCTGTGGTGAGG + Intronic
1062609662 9:137368308-137368330 CAGAGGAAGGCTAGGAGGTGGGG + Intronic
1203746874 Un_GL000218v1:44923-44945 CAGAGGCAGGTCTTGTGCTGCGG + Intergenic
1203563233 Un_KI270744v1:74557-74579 CGGAGGCAGGTCCTGTGCTGCGG - Intergenic
1186411429 X:9347693-9347715 CTGGAGCATGCTCTGTGGTGGGG - Intergenic
1187325141 X:18279138-18279160 CACAGGCATGCTCTATAGTGGGG - Intronic
1190058329 X:47195025-47195047 CAGAGGCTGGGTCTAGGGTGGGG - Intronic
1190492519 X:50997135-50997157 CAGAGGCAGGGTGAGTGGTGTGG - Intergenic
1190873793 X:54445792-54445814 TGGAGGCAGGATCTGTGGTAGGG + Exonic
1192360373 X:70435130-70435152 CAGAGGCTGGCGCTGGGTTGGGG - Intergenic
1195432103 X:104800752-104800774 CAGAGGCCTGCTCTCTGCTGGGG - Intronic
1196193754 X:112819319-112819341 GAAAGGCAGTTTCTGTGGTGAGG - Intronic
1196261820 X:113592137-113592159 CAGAGGCAGAGGTTGTGGTGAGG - Intergenic
1196274433 X:113750625-113750647 CAGAGGCAGGATGTGCAGTGAGG + Intergenic
1197326862 X:125105255-125105277 GAAAGGCAGTCTCTGTGGTTTGG - Intergenic
1198457283 X:136828923-136828945 CAGAAGCAGGCTCTGAGATGAGG + Intergenic
1199872540 X:151912516-151912538 CAGGCGCAGGCTCTGTGAGGAGG + Intronic
1200805257 Y:7427311-7427333 CTGGAGGAGGCTCTGTGGTGTGG + Intergenic
1201963580 Y:19707928-19707950 GAGACCCAGGCTCTGTGGTAAGG - Exonic