ID: 1155218314

View in Genome Browser
Species Human (GRCh38)
Location 18:23662579-23662601
Sequence GAGAGGAAGGAGGAGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2453
Summary {0: 1, 1: 0, 2: 20, 3: 275, 4: 2157}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155218302_1155218314 3 Left 1155218302 18:23662553-23662575 CCCGGGCCTCGCCCGCAGCTGGA 0: 1
1: 1
2: 0
3: 26
4: 360
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218293_1155218314 21 Left 1155218293 18:23662535-23662557 CCAGCCCCGCCGCTTCCTCCCGG 0: 1
1: 1
2: 9
3: 86
4: 787
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218297_1155218314 16 Left 1155218297 18:23662540-23662562 CCCGCCGCTTCCTCCCGGGCCTC 0: 1
1: 0
2: 4
3: 130
4: 477
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218307_1155218314 -8 Left 1155218307 18:23662564-23662586 CCCGCAGCTGGAGGAGAGAGGAA 0: 1
1: 1
2: 5
3: 96
4: 725
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218308_1155218314 -9 Left 1155218308 18:23662565-23662587 CCGCAGCTGGAGGAGAGAGGAAG 0: 1
1: 0
2: 5
3: 86
4: 620
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218305_1155218314 -3 Left 1155218305 18:23662559-23662581 CCTCGCCCGCAGCTGGAGGAGAG 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218292_1155218314 22 Left 1155218292 18:23662534-23662556 CCCAGCCCCGCCGCTTCCTCCCG 0: 1
1: 0
2: 7
3: 54
4: 528
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218299_1155218314 12 Left 1155218299 18:23662544-23662566 CCGCTTCCTCCCGGGCCTCGCCC 0: 1
1: 0
2: 6
3: 65
4: 749
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218300_1155218314 6 Left 1155218300 18:23662550-23662572 CCTCCCGGGCCTCGCCCGCAGCT 0: 1
1: 0
2: 2
3: 22
4: 285
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218303_1155218314 2 Left 1155218303 18:23662554-23662576 CCGGGCCTCGCCCGCAGCTGGAG 0: 1
1: 0
2: 1
3: 14
4: 261
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218298_1155218314 15 Left 1155218298 18:23662541-23662563 CCGCCGCTTCCTCCCGGGCCTCG 0: 1
1: 0
2: 1
3: 42
4: 416
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157
1155218296_1155218314 17 Left 1155218296 18:23662539-23662561 CCCCGCCGCTTCCTCCCGGGCCT 0: 1
1: 1
2: 3
3: 46
4: 394
Right 1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG 0: 1
1: 0
2: 20
3: 275
4: 2157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155218314 Original CRISPR GAGAGGAAGGAGGAGGCGGC GGG Intronic
Too many off-targets to display for this crispr