ID: 1155218761

View in Genome Browser
Species Human (GRCh38)
Location 18:23665882-23665904
Sequence GTCCCAGTTGATGGTCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155218756_1155218761 17 Left 1155218756 18:23665842-23665864 CCAGCACAGACCTTGATGTGTTT No data
Right 1155218761 18:23665882-23665904 GTCCCAGTTGATGGTCCAACAGG No data
1155218758_1155218761 7 Left 1155218758 18:23665852-23665874 CCTTGATGTGTTTGGCCTCTATT No data
Right 1155218761 18:23665882-23665904 GTCCCAGTTGATGGTCCAACAGG No data
1155218759_1155218761 -8 Left 1155218759 18:23665867-23665889 CCTCTATTTTGCACTGTCCCAGT No data
Right 1155218761 18:23665882-23665904 GTCCCAGTTGATGGTCCAACAGG No data
1155218755_1155218761 30 Left 1155218755 18:23665829-23665851 CCTTCTGTTCACACCAGCACAGA No data
Right 1155218761 18:23665882-23665904 GTCCCAGTTGATGGTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155218761 Original CRISPR GTCCCAGTTGATGGTCCAAC AGG Intergenic
No off target data available for this crispr