ID: 1155225813

View in Genome Browser
Species Human (GRCh38)
Location 18:23728253-23728275
Sequence GTCCAGGAAGGTCACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 224}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155225813_1155225819 -5 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225819 18:23728271-23728293 TGGACAGCAGCAACAGGCTGGGG 0: 1
1: 0
2: 3
3: 27
4: 319
1155225813_1155225817 -7 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225817 18:23728269-23728291 CCTGGACAGCAGCAACAGGCTGG 0: 1
1: 0
2: 2
3: 35
4: 310
1155225813_1155225831 27 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225831 18:23728303-23728325 CCAGGTGCTCAGGGGGTAGGAGG 0: 1
1: 0
2: 5
3: 47
4: 452
1155225813_1155225826 19 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225826 18:23728295-23728317 GAGGTATCCCAGGTGCTCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 188
1155225813_1155225818 -6 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225818 18:23728270-23728292 CTGGACAGCAGCAACAGGCTGGG 0: 1
1: 0
2: 0
3: 33
4: 236
1155225813_1155225827 20 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225827 18:23728296-23728318 AGGTATCCCAGGTGCTCAGGGGG 0: 1
1: 1
2: 2
3: 100
4: 3960
1155225813_1155225825 18 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225825 18:23728294-23728316 GGAGGTATCCCAGGTGCTCAGGG 0: 1
1: 0
2: 1
3: 23
4: 194
1155225813_1155225822 0 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225822 18:23728276-23728298 AGCAGCAACAGGCTGGGGGGAGG 0: 1
1: 0
2: 4
3: 71
4: 490
1155225813_1155225832 28 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225832 18:23728304-23728326 CAGGTGCTCAGGGGGTAGGAGGG 0: 1
1: 0
2: 0
3: 43
4: 480
1155225813_1155225824 17 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225824 18:23728293-23728315 GGGAGGTATCCCAGGTGCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 179
1155225813_1155225828 24 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225828 18:23728300-23728322 ATCCCAGGTGCTCAGGGGGTAGG 0: 1
1: 0
2: 6
3: 132
4: 1546
1155225813_1155225821 -3 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225821 18:23728273-23728295 GACAGCAGCAACAGGCTGGGGGG 0: 1
1: 0
2: 2
3: 38
4: 378
1155225813_1155225820 -4 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225820 18:23728272-23728294 GGACAGCAGCAACAGGCTGGGGG 0: 1
1: 0
2: 7
3: 37
4: 359
1155225813_1155225823 9 Left 1155225813 18:23728253-23728275 CCAGGCTGGTGACCTTCCTGGAC 0: 1
1: 0
2: 4
3: 13
4: 224
Right 1155225823 18:23728285-23728307 AGGCTGGGGGGAGGTATCCCAGG 0: 1
1: 0
2: 1
3: 18
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155225813 Original CRISPR GTCCAGGAAGGTCACCAGCC TGG (reversed) Intronic
900433293 1:2612852-2612874 GTCCAGAGAGGTGACAAGCCAGG + Intronic
900745092 1:4355658-4355680 GTTCAGGAAGGGAACCAGGCAGG + Intergenic
900774700 1:4573831-4573853 GACCAGGAAGGGCTGCAGCCTGG - Intergenic
901321678 1:8343901-8343923 GCCCAGGAAGGACACGAGGCTGG - Exonic
901798231 1:11692452-11692474 GCCCAGGAAGGTACTCAGCCTGG + Intronic
902341191 1:15784695-15784717 GTCAGGGAAGGGCCCCAGCCGGG - Intronic
905624313 1:39477430-39477452 GTCCAGGCTGGTCTCCAACCTGG + Intronic
906038178 1:42766328-42766350 GGCGAGGAAGGTCTCCTGCCAGG + Intronic
907240483 1:53078359-53078381 CCCCAGGAAGCTCTCCAGCCTGG + Exonic
907386044 1:54125878-54125900 TTCCAGGAAGGAGGCCAGCCAGG + Intergenic
908169197 1:61488056-61488078 TTGCAGCAAGGTCAGCAGCCAGG + Intergenic
912421261 1:109543808-109543830 CTCCACGATGGTCACCAGCTCGG + Exonic
912429637 1:109622260-109622282 GGCCAGGAAGGGCCCCACCCAGG - Intronic
913076224 1:115342620-115342642 GCCCAGGAAAGTCACCAGTTTGG + Intergenic
916581634 1:166114573-166114595 GTCTGGGAAGGTTTCCAGCCAGG + Intronic
917768452 1:178249567-178249589 GTCCAGCAAGGGCACCAAACTGG - Intronic
919657791 1:200214352-200214374 GCCCAGGATGGTCAGCTGCCTGG + Intergenic
919786402 1:201261078-201261100 ATCCAGGAAGGTAAGGAGCCAGG + Intergenic
919925284 1:202188868-202188890 GGCCAGGAAGGTGCCCAGCTGGG - Intergenic
921219329 1:212962030-212962052 AACCAAGCAGGTCACCAGCCTGG - Intronic
923030162 1:230243348-230243370 GTCCAGGAAGGTCAGGACCTTGG - Exonic
923119192 1:230975161-230975183 GTCCAGGAGTTTGACCAGCCTGG + Intronic
924324937 1:242886307-242886329 GCCCAGGAAGTTCAGCAGCCAGG - Intergenic
1066620499 10:37344662-37344684 CTCCAGGCAGGCCACCAGCAGGG + Intronic
1066623761 10:37385199-37385221 CTCCAGGCAGGCCACCAGCAGGG + Intergenic
1067226437 10:44379256-44379278 GACCGGGAGGGTGACCAGCCAGG + Intronic
1067282606 10:44883743-44883765 TTCCCGGAAGGTCAGCAGACAGG + Intergenic
1070602137 10:77873417-77873439 GTCCCAGAGGGTCACCAGGCTGG - Intronic
1071308947 10:84325650-84325672 GGCCAGGAGTGTGACCAGCCTGG - Intergenic
1071347178 10:84703894-84703916 GTCAAGGCAGGTCACCATCTTGG + Intergenic
1071579062 10:86754031-86754053 GTCCAGGTAGGTCACAAGAGAGG - Intergenic
1072828028 10:98628270-98628292 GTCCAGGAAGGAAATCAGCATGG + Intronic
1074586160 10:114768821-114768843 GTTCAGAGTGGTCACCAGCCCGG - Intergenic
1074690394 10:115999103-115999125 GCCCAGGTAGGTCAGCAGGCAGG - Intergenic
1075612027 10:123862103-123862125 CTCCAGGAGGGAGACCAGCCAGG + Intronic
1075745055 10:124721282-124721304 GTCCAGGCAGGGGACCTGCCAGG - Intronic
1076807607 10:132866816-132866838 ATAAAGGAAGGTGACCAGCCTGG - Intronic
1076862469 10:133145478-133145500 CTCCAGGCAGTTCATCAGCCTGG - Intergenic
1077117867 11:893450-893472 GACCAGGAGGGCCAGCAGCCGGG + Exonic
1077393238 11:2309336-2309358 CTCCAGGCAGGTCAGCATCCAGG - Intronic
1078403441 11:11047324-11047346 GTCCAGGCAGGGCAACAGCATGG + Intergenic
1079446551 11:20561971-20561993 ATACAGGAAGGTCACCAACTGGG - Intergenic
1079690034 11:23406346-23406368 GTCCAGCAGGGGCAGCAGCCAGG + Intergenic
1080767743 11:35312249-35312271 GTCCAGGAAGGCATCCAGGCTGG + Exonic
1083167580 11:60900599-60900621 TACCAAGAAGGTCACCAGCGTGG - Exonic
1083864469 11:65446077-65446099 GTGCAGGAAGGCCAACAGCTGGG + Intergenic
1084219743 11:67670706-67670728 GGCCAGGAAGGTGCCCAGCATGG - Intronic
1084565159 11:69924389-69924411 GGCCAGGAAGTTCAGCAGGCTGG - Intergenic
1085751211 11:79162765-79162787 GTCCTGGAAGGTCTCCCTCCTGG + Intronic
1089018155 11:115183982-115184004 GTCCAGCAAGATCTCCACCCAGG - Intronic
1089773523 11:120819991-120820013 TTCCTGGAGGGTCTCCAGCCAGG - Intronic
1089929414 11:122294936-122294958 GGACAAGAAGGTCACCAGTCAGG + Intergenic
1090003471 11:122981087-122981109 GGCCAGGAAGATCACGAGCAGGG + Intronic
1091266012 11:134271671-134271693 GTCCAGGCAGGTCTGCAGACCGG + Intergenic
1091400396 12:177555-177577 GTCCAGGAAGCAGCCCAGCCGGG + Exonic
1097224724 12:57470669-57470691 GAGCAGGACGGTCAGCAGCCTGG - Exonic
1097641651 12:62190870-62190892 GTCCAAAATGGTTACCAGCCAGG + Intronic
1100252939 12:92848932-92848954 GTCCAGGAGTTTAACCAGCCTGG - Intronic
1101878061 12:108608422-108608444 CCCCAGGAAGGTGACCAGCCTGG + Intergenic
1102438909 12:112946651-112946673 GGCCTGGAAGGTCCCCAGTCTGG + Intronic
1106250836 13:27980473-27980495 GCCCAGGACGGTAACCTGCCCGG + Intronic
1108676464 13:52741147-52741169 CTCCAGCAAGATCTCCAGCCAGG + Intergenic
1109319727 13:60795626-60795648 GTCAAGCAAGCTCACCAGACTGG + Intergenic
1115265976 14:31500697-31500719 ATCCAGTAAGGTCACCTGCTGGG - Intronic
1115548967 14:34488138-34488160 CTACAGGAAGGTGTCCAGCCTGG - Intergenic
1118327469 14:64791354-64791376 GGCCAGGAATGAGACCAGCCTGG + Intronic
1118923830 14:70173606-70173628 CTCCGGGCATGTCACCAGCCTGG + Intronic
1119437352 14:74605973-74605995 GCCCAGGGAGGTAACCAGCTGGG + Intronic
1121111124 14:91313851-91313873 CTCCAGGGAGGTCACCTTCCTGG + Exonic
1121111125 14:91313853-91313875 GGCCAGGAAGGTGACCTCCCTGG - Exonic
1121560347 14:94870175-94870197 ATCCTGGAAGGTCACCTGGCAGG - Intergenic
1124371421 15:29106759-29106781 GTCCATCAATGGCACCAGCCTGG + Exonic
1125332790 15:38598664-38598686 GTCCAAGAAAGTCACCAACTTGG + Intergenic
1126848973 15:52786298-52786320 GTCCAGGAGGGTCTCCTGCAAGG - Intronic
1126915764 15:53464555-53464577 TTGCAGGTAGGTCACCAGCCAGG - Intergenic
1129159769 15:73740735-73740757 GTCCAGTACGCTCATCAGCCAGG - Intronic
1129708726 15:77809381-77809403 GTTCAGGGTGGTCACCCGCCTGG - Intronic
1130882724 15:88069038-88069060 GTACATGAAGGTCACCGGCAAGG + Intronic
1132527335 16:424052-424074 TTCCATGGAGGACACCAGCCGGG + Intergenic
1132577833 16:672080-672102 GTCCAGGTAGGTCACCAGGCTGG - Exonic
1132598872 16:765160-765182 GCCCAGGCAGGTCGCAAGCCAGG - Exonic
1133737630 16:8627947-8627969 GCCCAGGAATTTGACCAGCCTGG - Intronic
1136249300 16:28993453-28993475 GTCGAGGTGGGTGACCAGCCTGG - Intergenic
1137732051 16:50696613-50696635 GCTCAGGAAGCTCACCAGCTTGG - Intronic
1139283619 16:65790871-65790893 GTCTTGGAAGGTCACCATGCAGG + Intergenic
1140568531 16:76073727-76073749 GTCCAGGAAAGTCACCAAACAGG - Intergenic
1141336337 16:83158714-83158736 GGCCAGGAAGGTGCCCAGCTGGG + Intronic
1141490200 16:84367746-84367768 GTACAGGAAGGTCTCGAGCAGGG - Intergenic
1141615185 16:85206271-85206293 CTCCAAGAAGGTCTCCGGCCCGG - Intergenic
1142750282 17:1983374-1983396 GTCCAGTAATGACACCAGCGGGG + Intronic
1142957204 17:3530128-3530150 GTCCAGGAAGTTCACCGACTGGG - Exonic
1143419118 17:6775691-6775713 GGCCAGGAATGGCAGCAGCCAGG + Intergenic
1143619559 17:8073223-8073245 GTCCATGAAGGTCTCCAGAGTGG + Exonic
1144757191 17:17686793-17686815 GGCCAGGAAGGAAAGCAGCCAGG + Intronic
1145269476 17:21396958-21396980 GTCCATCAAGGTCATCTGCCTGG + Intronic
1146380318 17:32322957-32322979 GGCCAGGATGGGCACCAGGCTGG - Exonic
1147872627 17:43598306-43598328 GGCCAGGAGGGTCACAAGGCTGG + Intergenic
1150299872 17:64038880-64038902 TTCCAGGAAGGTGGCCAGCTGGG - Intergenic
1150723565 17:67633802-67633824 GTCCAGGTAGGACAGCAGCCCGG - Intronic
1151173701 17:72269633-72269655 GTCCCGAAAGGTCAAAAGCCAGG - Intergenic
1151724620 17:75876984-75877006 GTTCAGGAAAGGCACCAGCCTGG - Intronic
1152596739 17:81241539-81241561 GTCCAGGAAAGCCACCTGCGAGG - Intergenic
1152856246 17:82666151-82666173 GTCCAGGAGGTTGACCAGCCTGG - Intronic
1153572855 18:6490834-6490856 GTCCAGGAAGGTCTGCTCCCTGG - Intergenic
1153989098 18:10379448-10379470 GTTCAGGAAGTTCACCTGTCAGG + Intergenic
1154321803 18:13360172-13360194 CTGCAGGAAGGTCAGAAGCCTGG - Intronic
1155225813 18:23728253-23728275 GTCCAGGAAGGTCACCAGCCTGG - Intronic
1160014703 18:75131730-75131752 GACGAACAAGGTCACCAGCCGGG - Intergenic
1160038407 18:75321915-75321937 GTGCTGGAAGGTCACCTGCAAGG + Intergenic
1160756167 19:758087-758109 GTCTCGGAGGGTCCCCAGCCCGG + Exonic
1161599736 19:5174353-5174375 GTCCAGAAAGGCGACCAGCTTGG - Intronic
1162099071 19:8328822-8328844 GTCAAGGAAGGAGAGCAGCCAGG + Intronic
1162800271 19:13106282-13106304 GCCCAGGAATGAAACCAGCCTGG - Intronic
1162883427 19:13677829-13677851 GTTGAGGAAGGTCACCAGTGAGG + Intergenic
1163021908 19:14486172-14486194 GTTAAGGAAGGTCACAGGCCGGG - Intronic
1163152335 19:15422814-15422836 GTCCAGCAGGGGCAGCAGCCAGG - Exonic
1165190784 19:34061706-34061728 GTCCCTCAAGGTCACCAGACGGG - Intergenic
1165248767 19:34513560-34513582 GGCCAGGGAAGTCACCAGGCTGG + Intergenic
1165256313 19:34578935-34578957 GGCCAGGGAAGTCACCAGGCTGG + Intergenic
1165259034 19:34597404-34597426 GGCCAGGGAAGTCACCAGGCTGG + Intronic
1165273889 19:34732486-34732508 GGCCAGGGAAGTCACCAGGCTGG - Intergenic
1165883096 19:39057323-39057345 CTCCTGGTAGCTCACCAGCCAGG + Intergenic
1166194884 19:41198932-41198954 GACCTGGCAGGTCCCCAGCCAGG + Intronic
1167246032 19:48373747-48373769 GTCCTGGGGGCTCACCAGCCAGG - Exonic
1168619777 19:57868807-57868829 CTCAAAGTAGGTCACCAGCCAGG + Intronic
925154364 2:1638569-1638591 CTCCAGCAAGGTCACCTGGCTGG + Intronic
926847685 2:17160115-17160137 ATCCAGGATGGTCACCTGCTGGG - Intergenic
928454180 2:31404366-31404388 TTCCAGAAAGGTCTCCAGGCTGG - Intronic
929283791 2:40113283-40113305 GGCTAGGAATGTCTCCAGCCTGG + Intronic
929816970 2:45240229-45240251 GTACAAGAAAATCACCAGCCTGG + Intergenic
932732968 2:74233459-74233481 GATCAGGATGGTCACCAGCAGGG + Exonic
933246357 2:79979172-79979194 GTCCAGGATTTTGACCAGCCTGG + Intronic
936159160 2:110071005-110071027 TTCCAGGAAGGACACAACCCTGG - Intergenic
936185501 2:110300327-110300349 TTCCAGGAAGGACACAACCCTGG + Intergenic
940105651 2:150096863-150096885 GTCCAGGATGGTCTCCATGCTGG - Intergenic
944996820 2:205303449-205303471 GTCCAAGAAGTCTACCAGCCGGG - Intronic
946502206 2:220261553-220261575 GTCCAGGAAGTTAAGAAGCCAGG + Intergenic
946565950 2:220966143-220966165 CTGCAGGAAGGCCAGCAGCCTGG + Intergenic
947551661 2:231050886-231050908 GCCCAGGAAGGACACCAGAGAGG - Intergenic
947936550 2:234009559-234009581 GTCCAGGAAGTTCGTCAGCCTGG + Intronic
948260087 2:236597750-236597772 CTCCAGGAATGCCACCAGACTGG + Intergenic
948313604 2:237009675-237009697 GTCTGGGGAGGTCACCATCCAGG - Intergenic
948326556 2:237126535-237126557 GTCCTGTCAGGTCAGCAGCCAGG - Intergenic
948837380 2:240632204-240632226 GTCCAGGAGGGTCCCATGCCTGG + Intergenic
1169027117 20:2380652-2380674 GCTCAGAAAGGTCACAAGCCTGG - Intergenic
1169939327 20:10919857-10919879 GTCCATGAGGGTCACCATCAAGG + Intergenic
1173789206 20:45816737-45816759 CTCAAAGCAGGTCACCAGCCAGG + Exonic
1175829405 20:61953766-61953788 GTCCTGGATGGTCACCATGCAGG - Intronic
1175862019 20:62155640-62155662 CTCCAGGAAAGTGACCAGCCTGG - Intronic
1176187278 20:63787905-63787927 GCCCAGGAAGCCCTCCAGCCAGG + Intronic
1180125651 21:45788392-45788414 GGGCAGGCAGGTCACCAGCAGGG - Intronic
1181627575 22:24132126-24132148 GACCAGGATGGACACCTGCCTGG + Intronic
1184805626 22:46793269-46793291 CTCCAGGAAGGTCACCTGGGAGG - Intronic
1184886908 22:47352078-47352100 GCCCAGAGAGGTCACCAGCTGGG - Intergenic
1185277293 22:49955288-49955310 GTCCTCCAAGGTCTCCAGCCTGG + Intergenic
949876235 3:8627864-8627886 GGGGAGGAAGGTCACCAGGCTGG - Intronic
950195982 3:11009585-11009607 GACCAGGAAGGAGACCAGCTGGG + Intronic
950494156 3:13323859-13323881 GTGCAGGGAGGTCTCCAGCCTGG - Intronic
950537552 3:13588456-13588478 GTTCTGGAAGGGCCCCAGCCTGG + Intronic
953520143 3:43634675-43634697 TTCCAGGATGGTCACCAGATGGG - Intronic
953914612 3:46910242-46910264 GACCAGGCAGGTCACCAGCCAGG - Intergenic
959991691 3:112638588-112638610 GCCCAGCAAGGCCACCAGCTTGG - Exonic
960412899 3:117349675-117349697 GGCCATGAAGGTCTCCAACCAGG - Intergenic
961649436 3:128410114-128410136 GTGCTGGGAGGTGACCAGCCTGG - Intergenic
962427224 3:135281760-135281782 GTCCAAGTAGGTCACAAGGCTGG + Intergenic
962462437 3:135626994-135627016 GGCCAGCAAGGTCACCTGCCTGG + Intergenic
962990470 3:140573053-140573075 CCCCAGGAAGGCCACCTGCCAGG + Exonic
963928709 3:150979157-150979179 TCCCAGGAAGTTCAGCAGCCCGG - Intergenic
966871461 3:184292603-184292625 GTCCAGGAGGTACACCACCCAGG - Exonic
968331311 3:197872918-197872940 GGCCAGGAAGATAACAAGCCGGG + Intronic
968812219 4:2805207-2805229 GGCCCGGAGGGTCAGCAGCCAGG + Intronic
969422831 4:7107368-7107390 GTCCAGGACAGTGCCCAGCCTGG + Intergenic
974026610 4:56738510-56738532 GACCAGGAGGGCCACCAGGCTGG + Intergenic
974988582 4:69059016-69059038 GTACAGGAAGGCCACCAGCCAGG + Intronic
977754176 4:100646834-100646856 CTCCAGGAGGCTCACCAGCCTGG + Intronic
981758034 4:148162491-148162513 GTCTAGTGAGGTCCCCAGCCTGG - Intronic
981920457 4:150079411-150079433 CAGCCGGAAGGTCACCAGCCTGG + Exonic
982142562 4:152340744-152340766 GTTCAGGAAGGACTCCAGGCTGG - Intronic
985542081 5:492039-492061 GTCCCACAAGGTCACCAGCGTGG - Exonic
988478794 5:31612018-31612040 GTCCAAGAGGAGCACCAGCCTGG + Intergenic
990304557 5:54481660-54481682 GCTGAGGCAGGTCACCAGCCTGG - Intergenic
990334583 5:54759603-54759625 GTCCAGGAAGGTCACCTGCATGG - Intergenic
992676474 5:79111367-79111389 GTCCTGGAAGATCTTCAGCCTGG - Intronic
998295283 5:140964330-140964352 TTCCAGCAAGGACACCTGCCAGG - Intronic
998867841 5:146522985-146523007 GTCCAGGAATCTCAGCTGCCAGG + Intergenic
999133103 5:149299536-149299558 GTCCAGGAGGCTGAGCAGCCCGG - Exonic
1001203165 5:169737751-169737773 GTCCAGGAATGCCACCTTCCAGG - Intronic
1001579382 5:172788625-172788647 GTCCAGGCTGCACACCAGCCTGG - Intergenic
1001657547 5:173363684-173363706 GGCCAGGTAAGTGACCAGCCTGG - Intergenic
1001682581 5:173569777-173569799 GCCCAGGAAGCTCAGCAGCGGGG - Intergenic
1003309471 6:4957022-4957044 GGACAGGAAGGCCACCAGCTGGG - Intergenic
1006055395 6:31380100-31380122 GACCAGGGAGGACGCCAGCCAGG + Intergenic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1008491310 6:52089908-52089930 GTTCAGCAAGGTCATCAGGCAGG - Intergenic
1013305206 6:108841299-108841321 CTCCAGGACAGTAACCAGCCAGG + Intergenic
1013403752 6:109823951-109823973 GTCCAGGAAGGTCACAAAAAGGG - Intronic
1015262940 6:131259351-131259373 GGCCAGGATGGTGACGAGCCTGG + Intronic
1015765397 6:136710796-136710818 GACCCAGAAAGTCACCAGCCAGG - Intronic
1016031717 6:139344714-139344736 CTCCAGGAAGGGCACCCTCCAGG + Intergenic
1016841702 6:148532277-148532299 GTCCAGGAGTTCCACCAGCCTGG - Intronic
1016907588 6:149167075-149167097 GACCAGGATGGGCACCGGCCAGG + Intergenic
1016929673 6:149391750-149391772 GCCCAGGAGTTTCACCAGCCTGG - Intronic
1017855484 6:158347640-158347662 CTTCAGGAAGGTCAGCAGGCAGG - Intronic
1018063015 6:160105032-160105054 GTCATGGAAGGACACCAGCTTGG - Exonic
1021100977 7:16585729-16585751 GTCCAGGAAGGTCCCCGGGGAGG - Intergenic
1022561678 7:31355874-31355896 GAGCAGGAAGGACATCAGCCTGG + Intergenic
1024925349 7:54607191-54607213 GTCCAGGAATGTCAGCAGTTAGG + Intergenic
1026972311 7:74475880-74475902 GATCAGGAATGTCACCAGACAGG - Intronic
1028684177 7:93574677-93574699 GTCCAGGAGGCTCACCTTCCCGG + Exonic
1028982286 7:96980080-96980102 GGCCAGGAATGTGGCCAGCCAGG + Intergenic
1028985727 7:97006768-97006790 GCCCAGAAATGTCCCCAGCCGGG - Intronic
1029211512 7:98912292-98912314 GTCCAGAACGCTGACCAGCCTGG - Intronic
1029680095 7:102102564-102102586 GTGCAGCAAGGGCACCTGCCAGG - Intronic
1034874156 7:154710233-154710255 GTGCACGAGGGTCACCAGACTGG + Intronic
1034956514 7:155338624-155338646 GTGCAGGAAGGCCAGCGGCCGGG + Intergenic
1034956529 7:155338690-155338712 GTGCAGGGAGGTCAGCAGCTGGG + Intergenic
1034969528 7:155410432-155410454 GTGCAGGTAAGTCATCAGCCAGG - Intergenic
1035710322 8:1708711-1708733 GTCCAGGGAGGGGACCAGTCCGG + Intergenic
1036450821 8:8865813-8865835 GTCCAAAAAGGTCAGAAGCCTGG + Intronic
1038574852 8:28696104-28696126 GTCCAGGAGTTTGACCAGCCTGG - Intronic
1039894967 8:41710618-41710640 GTCCAGGACGTCCTCCAGCCTGG - Intronic
1040375875 8:46824120-46824142 GACCAGGTGGGTCTCCAGCCTGG + Intergenic
1042769597 8:72365342-72365364 GGCCAGGAATGCCAGCAGCCAGG + Intergenic
1043270666 8:78329545-78329567 GTCCAGGAAGTTCTCGACCCAGG + Intergenic
1048697492 8:137044508-137044530 GCCCAGGCAGGTCACAAGCCAGG - Intergenic
1049582915 8:143420911-143420933 GTCCAGGGAGGTCGCTGGCCCGG - Intronic
1051109262 9:13616885-13616907 GACCAGGAAGGCCTCCAACCAGG - Intergenic
1053346818 9:37384268-37384290 GTCCAGGAGGTCGACCAGCCTGG - Intergenic
1054812993 9:69449622-69449644 GTCCATTAATGGCACCAGCCTGG - Exonic
1056568569 9:87796534-87796556 GGGAAAGAAGGTCACCAGCCAGG - Intergenic
1057075907 9:92138046-92138068 GGCCAGGAAGGTGCCCAGCTGGG - Intergenic
1058695893 9:107558806-107558828 GTCCATGAAGTTCAACTGCCTGG + Intergenic
1060840522 9:126789688-126789710 GTCTAGGAAGGGAAACAGCCTGG - Intergenic
1060939304 9:127534552-127534574 ACCCAGGAAGGTCACATGCCTGG - Intronic
1062287611 9:135780054-135780076 CTCCATGAAGGGCACCACCCAGG + Intronic
1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG + Intergenic
1188261788 X:28032351-28032373 GTTCAGGAAGTCCACAAGCCTGG - Intergenic
1193568209 X:83106574-83106596 GTAAAGGAAAGTCACAAGCCTGG - Intergenic
1196089382 X:111723481-111723503 GGCCAGGAATGAGACCAGCCTGG - Intronic
1197162072 X:123335106-123335128 ATCAATGATGGTCACCAGCCTGG - Intronic
1199573351 X:149289806-149289828 ATCCTGGAACATCACCAGCCAGG + Intergenic
1201222467 Y:11785298-11785320 TCCCAGGAAGTTCAGCAGCCAGG - Intergenic