ID: 1155229381

View in Genome Browser
Species Human (GRCh38)
Location 18:23757864-23757886
Sequence AGGCTGCGCCAGCTCCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155229381_1155229385 -2 Left 1155229381 18:23757864-23757886 CCATGATGGAGCTGGCGCAGCCT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1155229385 18:23757885-23757907 CTCTGGAAGCAGAGCCCTCTGGG 0: 1
1: 0
2: 2
3: 19
4: 296
1155229381_1155229388 15 Left 1155229381 18:23757864-23757886 CCATGATGGAGCTGGCGCAGCCT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1155229388 18:23757902-23757924 TCTGGGATCTTATTAGCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 116
1155229381_1155229389 27 Left 1155229381 18:23757864-23757886 CCATGATGGAGCTGGCGCAGCCT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1155229389 18:23757914-23757936 TTAGCAGCTGGTCCTTGAATTGG 0: 1
1: 0
2: 2
3: 10
4: 90
1155229381_1155229384 -3 Left 1155229381 18:23757864-23757886 CCATGATGGAGCTGGCGCAGCCT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1155229384 18:23757884-23757906 CCTCTGGAAGCAGAGCCCTCTGG 0: 1
1: 1
2: 2
3: 34
4: 281
1155229381_1155229390 28 Left 1155229381 18:23757864-23757886 CCATGATGGAGCTGGCGCAGCCT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1155229390 18:23757915-23757937 TAGCAGCTGGTCCTTGAATTGGG 0: 1
1: 0
2: 2
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155229381 Original CRISPR AGGCTGCGCCAGCTCCATCA TGG (reversed) Intronic
900254470 1:1690689-1690711 AGACTGCGCCTGCTCCAGCCTGG + Intronic
900263221 1:1743964-1743986 AGACTGCGCCTGCTCCAGCCTGG + Intronic
901026507 1:6281266-6281288 AGGCTGCGTCATCACCATCTCGG - Exonic
902183544 1:14708175-14708197 AGGCACAGCCAGGTCCATCAGGG - Intronic
906603871 1:47151418-47151440 AGGATGCCCCTGCCCCATCAGGG - Intergenic
907329634 1:53662626-53662648 AGGCTTAGCCAACTCCATAAGGG + Intronic
908154133 1:61335207-61335229 GGGCTGTGTCAGCTCGATCATGG + Intronic
910013809 1:82496623-82496645 CAGCTGCTCCAGCTCCAGCATGG - Intergenic
910209362 1:84777629-84777651 AGGCTGGTGCAGCTCCATGATGG + Intergenic
912528541 1:110303403-110303425 AGACTGCACCAGCCCCATCTGGG + Intergenic
913269112 1:117075576-117075598 AGGCTGCACCAGCAGCACCAGGG + Exonic
915671363 1:157491622-157491644 ACTCGGCACCAGCTCCATCAAGG + Intergenic
916688527 1:167169703-167169725 AGGGTGTGCCAGCTCCAGAAGGG + Intergenic
919983471 1:202657165-202657187 AGGCTGAGCCAACCTCATCATGG + Intronic
921905189 1:220488524-220488546 AGGCTGCCTCAGCTCCATGGCGG - Intergenic
1067251820 10:44593129-44593151 AGGCTGGGTCAGCTCCTCCAGGG + Intergenic
1073006621 10:100329974-100329996 AGTCTGCACCATCTCCAGCACGG - Exonic
1075418892 10:122286219-122286241 AAGCTCCTCCAGCTCCCTCAGGG - Exonic
1075796260 10:125121907-125121929 AGGCTGCGTCACCTGCATCGAGG - Intronic
1076524223 10:131101128-131101150 AGGCAGGCCCAACTCCATCAGGG + Intronic
1077369713 11:2175771-2175793 ATGCTGAGCCAGCTCCACAATGG + Intergenic
1081915684 11:46728756-46728778 AGGCTTCTTCAGCTTCATCAGGG - Exonic
1084498698 11:69521496-69521518 AGGCTGCTCCAGCTCTAGCTGGG - Intergenic
1084530989 11:69727628-69727650 AGGGTGTGCCACCCCCATCATGG - Intergenic
1090664756 11:128907009-128907031 AGGCTGCCCCAGTCCCCTCAAGG - Intronic
1092053534 12:5490514-5490536 AGGCAGTGCCAGCTCCATCCAGG - Intronic
1092244668 12:6856878-6856900 AGGCTGTACCAGCTCCATCAGGG - Exonic
1097285842 12:57876595-57876617 TGTCTGCTGCAGCTCCATCACGG + Intergenic
1098264759 12:68706978-68707000 CAGCTGCACCAGCTCCACCAGGG + Intronic
1104985811 12:132596382-132596404 ATACTGGGCCAGCGCCATCAGGG + Intergenic
1106563633 13:30867488-30867510 AGGCTGACCCTGCTCCAGCATGG + Intergenic
1115951679 14:38728387-38728409 CAGCTGCACCAGCTCCACCAGGG + Intergenic
1116326843 14:43540949-43540971 CAGCTGCACCAGCTCCACCAGGG - Intergenic
1117368182 14:55051722-55051744 AGGCTGCGCCCGCGTCTTCAGGG + Exonic
1119784342 14:77301214-77301236 AGGCTGAGCCAGAACCACCAGGG + Exonic
1123184889 14:106507271-106507293 AGACTGCACCAGCTGCATCTGGG + Intergenic
1124161714 15:27276197-27276219 AGCCTGTGCCAGCTTCCTCAAGG - Intronic
1128656670 15:69467723-69467745 AGGATGCTCCAGCTCCCACATGG + Intergenic
1129740446 15:77987198-77987220 TGTCTGAGCCAGCTCCATCCTGG - Intronic
1130137182 15:81191047-81191069 AGGCTGAGGCAACTCCATCTTGG - Intronic
1130256537 15:82328461-82328483 TGTCTGAGCCAGCTCCATCCTGG - Intergenic
1130598415 15:85261527-85261549 TGTCTGAGCCAGCTCCATCCTGG + Intergenic
1130651106 15:85762648-85762670 AGGCTCAGCCTGCCCCATCAAGG + Intronic
1132628070 16:901847-901869 GGGCTGGGCCAGAGCCATCATGG - Intronic
1132702821 16:1229300-1229322 CGGCTCCTCCAGCTCCAGCAGGG + Exonic
1132705505 16:1241568-1241590 CGGCTCCTCCAGCTCCAGCAGGG - Exonic
1132708634 16:1256931-1256953 GGGCTCCTCCAGCTCCAGCAGGG - Exonic
1135061973 16:19278824-19278846 AGGCATCTCCAGCTCCATCATGG + Intergenic
1136774603 16:32865085-32865107 AGGATGGGCGAGCTCCATCTGGG + Intergenic
1136896009 16:33996429-33996451 AGGATGGGCGAGCTCCATCTGGG - Intergenic
1138103657 16:54274875-54274897 AGACTGTTCCAGCTCCATCCTGG + Intergenic
1138195567 16:55049306-55049328 TGGATTCGCCAGCTCCACCATGG - Intergenic
1138343526 16:56306388-56306410 AAGCTGCCCCCGCTCCTTCAGGG + Intronic
1142411624 16:89919937-89919959 AGGCAGCGCCCGGTCCACCAGGG + Exonic
1203077030 16_KI270728v1_random:1127221-1127243 AGGATGGGCGAGCTCCATCTGGG + Intergenic
1144679326 17:17182498-17182520 AGGCTCAGCCAGCTCCCTCTGGG - Intronic
1146514931 17:33481799-33481821 AGGCTGAGGCAGCTCGTTCAAGG - Intronic
1148048561 17:44758597-44758619 AGGCTGCCCCAGCCCCAGCTTGG - Intergenic
1148440055 17:47707362-47707384 AGTCTGTTCCAGCTCCATGAGGG + Intronic
1150780915 17:68121378-68121400 AGGCTGAGCCAGGTGGATCACGG + Intergenic
1152287375 17:79420953-79420975 AGTCTTCACCAGCTTCATCATGG - Intronic
1155229381 18:23757864-23757886 AGGCTGCGCCAGCTCCATCATGG - Intronic
1157097510 18:44699774-44699796 AGGCAGCCCCGGCTCCAACACGG - Intronic
1157340194 18:46771455-46771477 AAGCTGCTCCAGCTCCACCCAGG + Intergenic
1160059740 18:75518167-75518189 AGGCTGCGCCAATGCCCTCAGGG + Intergenic
1160318189 18:77867263-77867285 GGCCTGAGCAAGCTCCATCAGGG - Intergenic
1160348338 18:78153027-78153049 AGACTGAGGCAGCTCCATCCTGG + Intergenic
1167497831 19:49829865-49829887 AGGCTGCAGCGGCTCCAGCAAGG - Exonic
925101099 2:1246390-1246412 AGCCGGCGCCAGCTCCAGGATGG - Intronic
926159608 2:10478294-10478316 AGGCTGGGTCAGCTGCATGATGG + Intergenic
927514134 2:23662108-23662130 AGGATGGGGCAGCTCCAGCAAGG + Intronic
927636798 2:24822510-24822532 TGGCTTTGCCAGCTCCAACAAGG - Exonic
927971301 2:27307581-27307603 CGTCCGCGCCAGCTCCAGCAGGG + Exonic
932278701 2:70471400-70471422 AGGATGAGCCAGCTCCAGGAGGG + Intronic
935637956 2:105264586-105264608 GGGCTGCCCCAGTTGCATCATGG + Exonic
938755324 2:134373883-134373905 AGGTTGCTCCAGCTTCATCTTGG + Intronic
944772241 2:202926005-202926027 CAGCTGCACCAGCTCCTTCAGGG + Intronic
945943448 2:215972186-215972208 AGGCTGCTCCAACTCCAACGTGG + Intronic
946320823 2:218953479-218953501 CAGCTGCACCAGCTCCACCAGGG - Intergenic
948281182 2:236749000-236749022 AGGCTGGGCTGGCTCCTTCAGGG + Intergenic
948562408 2:238863436-238863458 GGACGTCGCCAGCTCCATCAGGG - Intronic
948648860 2:239426394-239426416 AGGTTTGGCCAGCTCCATGAAGG - Intergenic
1170136485 20:13079857-13079879 AGGCTGCCTCACCTCCAACAGGG - Intronic
1170947492 20:20904339-20904361 AGGCACCTCCAGCTCCAGCATGG - Intergenic
1170972161 20:21126170-21126192 AGGCTGGGCCAACTCCAGCACGG + Exonic
1174335112 20:49854255-49854277 AGGCAGGACCAGCTCCCTCAAGG - Intronic
1174880991 20:54279564-54279586 AGGCTGAGACATCTACATCAAGG + Intergenic
1175194260 20:57231508-57231530 AGACTGTGCCACCTCCTTCAGGG - Intronic
1175468711 20:59210469-59210491 AGGCTGTGTCAGCTGCAGCAGGG + Intronic
1175478949 20:59298261-59298283 GGGCAGGGCCAGCTCCATCCTGG + Intergenic
1175877406 20:62236938-62236960 AGGCTCAGCCAGCTCCTTCCTGG + Intronic
1176119270 20:63446690-63446712 AGGCAGCTCCAGCTCCTTCCTGG + Intronic
1178880596 21:36447156-36447178 ATGCTGCGCCAGCCCAGTCATGG + Intergenic
1181452919 22:23035921-23035943 AGGGTCCCCCAGCTCCATCGTGG + Intergenic
1185299523 22:50072251-50072273 GGGCTGGGGCAGCTCAATCAAGG + Intronic
950265014 3:11567118-11567140 ATTCTGCGCCATCTCCAGCAGGG + Intronic
950709234 3:14803235-14803257 TGGCTGCTCCACCTCCAGCACGG - Intergenic
953702346 3:45206580-45206602 AGGCTACAACAGCTCCATCCTGG - Intergenic
954718007 3:52536460-52536482 CGCCTGCGCCAGCTCCTTCGAGG + Intronic
957966232 3:87324627-87324649 TAGTTGCACCAGCTCCATCAGGG + Intergenic
961641587 3:128368017-128368039 AGGCTGTGGCAGCACCATCCTGG - Intronic
963062771 3:141238361-141238383 AGGCCGTGCCAGCTCCGTGATGG - Intronic
965374310 3:167903383-167903405 ACACTGGGTCAGCTCCATCAAGG + Intergenic
965813632 3:172615288-172615310 TGGCTCAGCCAGCCCCATCATGG + Intergenic
968230533 3:197002716-197002738 TGGCCGCGCCAGCTCCATCCCGG - Exonic
968570599 4:1338481-1338503 GGGCTGCGCCAGCTTGTTCAGGG - Exonic
976687039 4:87825491-87825513 AGGCTGCCACTTCTCCATCAAGG + Intronic
980749417 4:137069896-137069918 AAGCTGCACCACCCCCATCAGGG - Intergenic
984835601 4:184017167-184017189 AGGCTGGACCAGCTCCACCATGG - Exonic
985680989 5:1255666-1255688 AGGCTGAAGCAGCTCCATCCTGG + Intronic
985867817 5:2529032-2529054 AGGCAGCTCCTGCTCCATCATGG + Intergenic
994612727 5:102065330-102065352 TGGCTGTGCCATCTCTATCAGGG + Intergenic
997159594 5:131594168-131594190 CAGCTGCTCCAGCTCCATCTGGG + Intronic
1000082178 5:157858807-157858829 TGGCTCTGCCAGCCCCATCATGG - Intronic
1002461089 5:179374199-179374221 GGGCTGCGGCAGGCCCATCAAGG + Intergenic
1004691142 6:17993074-17993096 AGGCTGGGCCAGCTCTCTGATGG - Intergenic
1004920690 6:20372672-20372694 AGGCTGAATCAGCTCCATCTTGG - Intergenic
1008584212 6:52934398-52934420 AGGCTGCTCCAGCTTCCCCAAGG + Intergenic
1009056980 6:58347985-58348007 AGGCTGCAGCAGACCCATCAGGG - Intergenic
1009234264 6:61103584-61103606 AGGCTGCGGCAGACCCATCAGGG + Intergenic
1009707148 6:67266467-67266489 TGGCTGCGCCCGCTCCATCCAGG + Intergenic
1012582771 6:100889517-100889539 AGGCTGCGCCTGCTTCTTCAGGG + Intergenic
1015658465 6:135546605-135546627 AGGGAGCCCCAGTTCCATCAAGG + Intergenic
1017783615 6:157735643-157735665 AGCCTGTGACTGCTCCATCAAGG + Intronic
1018317316 6:162569632-162569654 CAGCTGCACCAGCTCCACCAGGG + Intronic
1018711520 6:166501038-166501060 CTCCTGGGCCAGCTCCATCAGGG - Intronic
1019280992 7:200185-200207 AGGCAGCGCCAGCTCCAGAAAGG + Intronic
1020001669 7:4759546-4759568 CGGCTGCGCCCGCCGCATCATGG - Exonic
1023872244 7:44269447-44269469 AGCCTCTGCCAGCTCCATCCCGG - Intronic
1024396062 7:48868234-48868256 AGGCTGAGACAGCTCCAAGATGG - Intergenic
1024829585 7:53434540-53434562 AGGCTTCGCGAGTTCCATGATGG + Intergenic
1026988801 7:74571338-74571360 AGGCTGTCCCCGCTCCATCCTGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1034440512 7:151083438-151083460 CGGCTCCCCCAGCTCCATCGCGG + Intronic
1036642984 8:10595590-10595612 AGGCTGGGCCAGTCCCATCCTGG - Intergenic
1036970374 8:13348341-13348363 AGGCGGTGCCAGCTCATTCAGGG + Intronic
1038860836 8:31387666-31387688 AGCCTCCCCCAGCTCCATAAAGG - Intergenic
1041894187 8:62904927-62904949 GTCCTGCCCCAGCTCCATCAGGG - Intronic
1044716171 8:95101875-95101897 AGGCTCAGCCAGTGCCATCAGGG + Intronic
1049376697 8:142292769-142292791 AGGCTGCACCAGACCCACCAAGG + Intronic
1049822714 8:144645876-144645898 AGGCAAGGCCAGCTCCATCCGGG - Intergenic
1059336803 9:113574293-113574315 AGGCTGAGCCAGAGCCAGCAGGG - Intronic
1059353617 9:113683466-113683488 AGGCTCCCCCAGCCCCACCACGG + Intergenic
1062344480 9:136108580-136108602 AGTCTCCGCCAGCTCCAGCCAGG - Intergenic
1192221914 X:69203243-69203265 AGGCTGGGTCAGCACCCTCAAGG - Intergenic
1195105868 X:101600937-101600959 AGGCTGGGGCGGCACCATCAAGG - Intergenic
1195107015 X:101612830-101612852 AGGCTGGGGCGGCACCATCAAGG + Intergenic