ID: 1155229526

View in Genome Browser
Species Human (GRCh38)
Location 18:23758951-23758973
Sequence CATGGTAGGATTGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155229526 Original CRISPR CATGGTAGGATTGAGGAGGA TGG Intronic
900481240 1:2900443-2900465 CATGGGAGGGGTGATGAGGAGGG + Intergenic
901088735 1:6627735-6627757 GATGGTAAAATTGAGAAGGAAGG - Intronic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902220772 1:14963302-14963324 CCTGGCAGGATTGAGGTGAATGG - Intronic
902750994 1:18510879-18510901 CATGTTACAATGGAGGAGGAAGG + Intergenic
902755919 1:18549041-18549063 CATGTTAGGGTTGTGGAGTAAGG - Intergenic
904430977 1:30463827-30463849 CATGATAGGATTGGAGAGTATGG + Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904755761 1:32767765-32767787 CCTAGTAGGAGGGAGGAGGAAGG - Exonic
906008172 1:42496981-42497003 CATGGTAGGACTGACAAGAAGGG + Intronic
906383903 1:45350670-45350692 CATGGTAGGATTGAGGGCAAGGG - Intronic
906925379 1:50110351-50110373 CATGCTAGGAGTGATGGGGAAGG + Intronic
907728577 1:57043967-57043989 CATGGTAGGAAAGGGGAGAATGG - Intronic
907929822 1:58988960-58988982 AATGGATGGAGTGAGGAGGATGG - Intergenic
908117566 1:60954824-60954846 CCTGGGAGCATTGAGGAAGAGGG + Intronic
908801609 1:67886172-67886194 CCTGGTTGAATGGAGGAGGAAGG + Intergenic
910825838 1:91406132-91406154 CATGTGAGGATACAGGAGGACGG + Intergenic
912156138 1:106922769-106922791 TTTGTTAAGATTGAGGAGGAGGG - Intergenic
914681766 1:149943898-149943920 CAGGGAAGAACTGAGGAGGAGGG - Exonic
916945090 1:169718371-169718393 CCTGATAGGATTGTGGAGGTAGG - Intronic
917255967 1:173116583-173116605 CATGGTGGTATTCAGGAGTAAGG + Intergenic
918337767 1:183537468-183537490 AATAGTAAGAATGAGGAGGAAGG - Intronic
919646441 1:200099453-200099475 CATAGTAGGATTAAGAAGAAAGG - Intronic
919992296 1:202716671-202716693 TAGGGTAGGTTTGGGGAGGAGGG + Intergenic
920165458 1:204032502-204032524 CAAGGCAGGATATAGGAGGAAGG - Intergenic
921115794 1:212089861-212089883 CAAGGCAGGATTGGGGAAGAAGG - Intronic
921129886 1:212210621-212210643 TATGCAAGGGTTGAGGAGGAAGG + Intergenic
921152183 1:212411552-212411574 CTCTGTAGGATTAAGGAGGAGGG + Intronic
921636638 1:217503316-217503338 CATGGTAGGATGGAGCAGAAGGG + Intronic
922070556 1:222188453-222188475 CAAGGCAGGAATGAGGAGGTAGG + Intergenic
923524347 1:234760519-234760541 GCTGGGAGGATTGAGGGGGAAGG + Intergenic
923956321 1:239025699-239025721 CATGGTAGGGCTGAAGAGAAAGG - Intergenic
924858313 1:247896431-247896453 GATGAGAGGATTGAGGAGGGGGG - Exonic
1064310976 10:14211568-14211590 CATGGCAGGAGAAAGGAGGATGG - Intronic
1064612119 10:17114577-17114599 GATGGAAGGGTTGAGGAGGTGGG - Intronic
1066537898 10:36411242-36411264 CATGGGAGGATGCAGCAGGAAGG + Intergenic
1067147302 10:43702924-43702946 CAAGGAAGGAAAGAGGAGGAAGG - Intergenic
1067427474 10:46220838-46220860 CATGGGAGGACACAGGAGGAAGG + Intergenic
1067582904 10:47456748-47456770 CATGGGAGGACACAGGAGGAAGG + Intergenic
1068139147 10:52982815-52982837 CATGATTGGAGTGAGGAGAATGG - Intergenic
1068734661 10:60399378-60399400 CGTGGTGGGAGGGAGGAGGATGG - Intronic
1069408353 10:68126565-68126587 TGTGGTAGGAACGAGGAGGAAGG + Intronic
1069604978 10:69733190-69733212 GATGGGAGGGATGAGGAGGATGG - Intergenic
1069642043 10:69962385-69962407 CCTGGGAGGATTGTGGAGGCGGG + Intronic
1070555644 10:77525776-77525798 CATGTTAGTAACGAGGAGGAGGG - Intronic
1073533016 10:104250130-104250152 CATGGTAGAATTGAAAAGCAGGG - Intronic
1075450608 10:122549506-122549528 GATGCTGGGAGTGAGGAGGAGGG + Intergenic
1075924515 10:126239976-126239998 CACGGAAGGATGGAGGAGGAGGG - Intronic
1076399936 10:130175864-130175886 CATGGTGGCATCGAGGAGGGTGG + Intronic
1078403458 11:11047425-11047447 CATGGCAGGAATCAGGAGGTTGG + Intergenic
1078852978 11:15180671-15180693 CATGGTAGGAGTGAGGGGGGGGG + Intronic
1081458678 11:43250890-43250912 CATGGAGGGACTGAGGAGGGAGG - Intergenic
1083272398 11:61579067-61579089 CATGGGAGGAAAGAGGAGGGAGG + Intronic
1083287721 11:61671149-61671171 CATGGTGGGAGTGCGGAGGGTGG + Intergenic
1083881110 11:65548704-65548726 CATGGCAGGAGTGAGGGGGAAGG - Intronic
1083886785 11:65576953-65576975 GCTGGGAGGATTGAGGAGGGAGG + Intronic
1084468509 11:69341484-69341506 CAAGGTAGGAAGGAAGAGGAAGG - Intronic
1084712799 11:70854528-70854550 CATGGCTGGATTGAGGGAGAGGG + Intronic
1084782752 11:71421499-71421521 CTTGGTAGGACAGGGGAGGAAGG + Intergenic
1086283145 11:85214102-85214124 CATGGTAGGAGTGAACAGCATGG - Intronic
1087094294 11:94305316-94305338 CATCACAGGAATGAGGAGGAGGG - Intergenic
1088456443 11:110037315-110037337 ATTGATAGGATTTAGGAGGAGGG - Intergenic
1090130033 11:124131297-124131319 CAGGGTGGGATTGAGCAGCATGG + Intronic
1091398553 12:169266-169288 AGTGGTGGGAGTGAGGAGGAAGG + Intronic
1092921397 12:13234710-13234732 CATGCAATGATTGAGGAGGCGGG - Intergenic
1094152737 12:27303268-27303290 CTTGGTAGGATTGAAGTGGGAGG + Intronic
1095328173 12:40923407-40923429 CATGGTAGGGTTTATCAGGAGGG + Intronic
1101281658 12:103263679-103263701 CATGGTAGGATGCAGGGGCATGG - Intronic
1102792348 12:115657936-115657958 GATGATAGTAATGAGGAGGAGGG - Intergenic
1103500791 12:121400245-121400267 CAGGATAGGATTGGCGAGGAGGG - Intronic
1103509022 12:121461488-121461510 AATGGAAGGAATGAAGAGGAGGG + Intronic
1103751739 12:123168706-123168728 GATGGGAGGTTTGAGGAGGGTGG - Intronic
1103941429 12:124503367-124503389 GATGGGAGGATGGAGGAGAAAGG + Intronic
1107137877 13:36964351-36964373 CATGGTAGTATGGAGAAGGATGG + Intronic
1107985502 13:45772502-45772524 CATCATAGCAATGAGGAGGAAGG - Intergenic
1108519628 13:51234655-51234677 GATGGAAGGAAGGAGGAGGAAGG + Intronic
1110648591 13:77918047-77918069 CATGGTGGGCTTGAGGAAGGGGG - Intronic
1113090123 13:106609205-106609227 CATTGTAGGGTTTAGGATGAAGG + Intergenic
1115735165 14:36320284-36320306 CTCGGTCGGAGTGAGGAGGACGG - Intronic
1116307795 14:43281074-43281096 CCTGGGAGGATTGAGAAAGAAGG - Intergenic
1118482518 14:66181245-66181267 CATGGCAGGAGTGAGAAGCAGGG + Intergenic
1118909978 14:70053529-70053551 CATGGGGGAATTGGGGAGGAAGG - Intronic
1119500812 14:75126273-75126295 CAAGGTCGGGGTGAGGAGGAGGG - Intronic
1120866871 14:89302658-89302680 CCAGGTAGCATTGAAGAGGAAGG - Intronic
1120950815 14:90040206-90040228 CATGGTAGCACTGTAGAGGATGG - Intronic
1121048723 14:90805925-90805947 CATGGGAGGAACCAGGAGGAAGG - Intronic
1121097133 14:91225393-91225415 CTAGGTAGGATGGAGCAGGATGG - Intronic
1121661778 14:95640517-95640539 CATGGCAGTAATGGGGAGGAGGG + Intergenic
1121685349 14:95831490-95831512 CATGGTAGGAAAGAGGTGGGTGG - Intergenic
1121932135 14:97981906-97981928 CACGGTAGTATTGGGGAAGAGGG + Intergenic
1124068706 15:26371034-26371056 TTTGGGAGGCTTGAGGAGGAAGG + Intergenic
1124864914 15:33480057-33480079 CATGGTAAGACTGGGGAGGAGGG + Intronic
1124929475 15:34105225-34105247 CAAGGTTGTATTGGGGAGGAGGG + Exonic
1126644509 15:50861545-50861567 CATGGTGGGATTGAGTAGTCAGG - Intergenic
1127615923 15:60685471-60685493 CAACTCAGGATTGAGGAGGAGGG - Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1127799009 15:62461906-62461928 CATTGTTGGAGTCAGGAGGAAGG + Intronic
1128997088 15:72305129-72305151 CATGAGAGGATTGGGAAGGAGGG + Intronic
1129777638 15:78247148-78247170 CATGGAGTGACTGAGGAGGACGG + Intergenic
1130176029 15:81571887-81571909 CATGGAAGGGTTGGGTAGGAAGG + Intergenic
1131143099 15:89993506-89993528 TAGGGTGGGAATGAGGAGGATGG - Intergenic
1131604982 15:93893939-93893961 CATGGAAGGATGGAGCAGGATGG + Intergenic
1132405474 15:101539668-101539690 CATGGAAGTGTTGAGAAGGACGG + Intergenic
1133054135 16:3137128-3137150 AATGGCAGGACTGAGGAGGAAGG - Intronic
1135299622 16:21314336-21314358 CATGGTAGGGGTGACGTGGAAGG - Intergenic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1135588679 16:23690265-23690287 TATGGTGGGGTTGAGGGGGAGGG - Exonic
1136637085 16:31531246-31531268 CAGGGTAGGATTCAGGTTGAGGG - Intergenic
1137638796 16:50010400-50010422 CATGTAAGGAGTGAGGAGGAGGG + Intergenic
1137897786 16:52232950-52232972 AACAGTAGGATTGAGGAAGAAGG - Intergenic
1138312387 16:56038922-56038944 CATGGTTGAATGGAGGAGGAAGG + Intergenic
1138735171 16:59242273-59242295 CAGGGTAGGATGGAGTAGAATGG - Intergenic
1139636876 16:68263574-68263596 CGTGGGAGGAGTGGGGAGGAAGG + Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1141526808 16:84617273-84617295 CATTGTAGGATGGCGGAGGCAGG + Intronic
1145819076 17:27817416-27817438 CAGGGTAGGAGAGAGGCGGAGGG + Intronic
1146674535 17:34764228-34764250 CAAGGAGGGATGGAGGAGGAGGG + Intergenic
1148189290 17:45667430-45667452 CCTGGTGGGACTAAGGAGGAAGG - Intergenic
1148905838 17:50911631-50911653 TAAGGTAGGGGTGAGGAGGAGGG - Intergenic
1149218250 17:54384404-54384426 GATGGTAGAAATCAGGAGGAGGG - Intergenic
1151009816 17:70481788-70481810 CAGGGTTGGGTTGGGGAGGAGGG - Intergenic
1152293144 17:79452182-79452204 CATGGGATGTTTGAGGAGGAAGG + Intronic
1154280092 18:12995024-12995046 CATGTTAGGATGGAGGAGGCAGG - Intronic
1154952472 18:21223760-21223782 CCTGGTAGGATGGAGTGGGACGG - Intergenic
1155229526 18:23758951-23758973 CATGGTAGGATTGAGGAGGATGG + Intronic
1155733487 18:29191653-29191675 CATGGTAGTATTTAAGAGGACGG + Intergenic
1156634261 18:39008762-39008784 CATGTTGGGGTTGGGGAGGATGG + Intergenic
1157264887 18:46210023-46210045 GAAGGTAGGGTAGAGGAGGATGG - Intronic
1158532604 18:58277082-58277104 CATGGTAGGTCTCAGGAAGAAGG + Intronic
1160654402 19:255647-255669 CTTGATAGTACTGAGGAGGATGG - Intergenic
1160955634 19:1690474-1690496 CCTGGTAGGAAGGAGGAGGTTGG + Intergenic
1165200794 19:34142783-34142805 CATGGTGGGGTTGAGCAGGTTGG - Intergenic
1165677924 19:37744339-37744361 CATGGTTTGAATGAGAAGGAGGG + Intronic
1166723791 19:45012939-45012961 CATGGTAGGGCTGAGGTGGGAGG + Intronic
1167295544 19:48646863-48646885 CCAGGCAGGAGTGAGGAGGAGGG + Intergenic
1167381394 19:49140236-49140258 CAAGGTAGGCGGGAGGAGGAGGG + Intronic
925228253 2:2205695-2205717 CCTGGTAGCATTGAGGAGAGTGG - Intronic
927920929 2:26971155-26971177 CCTAGGAGGAGTGAGGAGGAGGG - Intronic
929723662 2:44399718-44399740 CATGATAGAATTGAGGAAGACGG + Intronic
932309347 2:70727351-70727373 AATGGAAGGATGGATGAGGAAGG - Intronic
932631375 2:73346151-73346173 CATTGTCAGAGTGAGGAGGAAGG - Intergenic
934220174 2:90075147-90075169 CATGATAGGAAACAGGAGGAGGG - Intergenic
934573617 2:95386553-95386575 CCTGGGAGGAGGGAGGAGGAGGG + Intergenic
936341052 2:111633138-111633160 GGTGGTATGAGTGAGGAGGAGGG - Intergenic
940622499 2:156129975-156129997 TATGTTTGGATTCAGGAGGAGGG - Intergenic
941195380 2:162444202-162444224 CATTCTAGAATTGAGGAAGAGGG - Intronic
941910596 2:170760822-170760844 CCTAGAAGGAATGAGGAGGATGG + Intergenic
943458679 2:188141572-188141594 CATGATAAGAATGAGCAGGAAGG + Intergenic
943692083 2:190880174-190880196 CATGGGAGGGTGGAGGTGGAGGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946063631 2:216967761-216967783 TATGGCAGGATTGGGGAGGATGG + Intergenic
946308281 2:218868440-218868462 GAGGGCAGGGTTGAGGAGGAGGG + Intronic
947586152 2:231358173-231358195 CAGGGTATGAATGAGGGGGAGGG + Intronic
947705865 2:232275054-232275076 CAAGGCAGGAGGGAGGAGGAAGG - Intronic
947926346 2:233925626-233925648 CTTGGAAGGGGTGAGGAGGAAGG + Intronic
948256813 2:236574384-236574406 CCTGGTAGGAATGAGGTGGAGGG + Intronic
948643803 2:239391472-239391494 CTTGGGAGGAATGAGGAGTAGGG - Intronic
1169656065 20:7924464-7924486 CATGCTGGGCTTGATGAGGAAGG + Intronic
1170221938 20:13950615-13950637 CATGGGAGTGTTAAGGAGGATGG + Intronic
1170464657 20:16611653-16611675 CTTGGTGGGAGTGAGCAGGAAGG + Intergenic
1170978719 20:21190954-21190976 AATTGTAAGATGGAGGAGGAGGG + Intronic
1171234471 20:23512875-23512897 CCTGGGAGGACAGAGGAGGAAGG - Intergenic
1171411482 20:24951216-24951238 GATGGTAGGACTGAGGCTGAGGG - Intronic
1172473492 20:35219128-35219150 CCTGGTAGGTTTGAGGAAAAGGG - Intergenic
1172846068 20:37930655-37930677 CCTGGTGGGATGGAGGATGACGG + Intronic
1173006144 20:39141220-39141242 CCTGGTGGCATGGAGGAGGAAGG - Intergenic
1173699951 20:45060911-45060933 CATGTAAGGATCGAGGAGTATGG - Intronic
1174909839 20:54595380-54595402 CACGGTAGGATAGAGGAGATAGG + Intronic
1175610491 20:60347358-60347380 CAAGGGAGGACTGAGGAGCAAGG + Intergenic
1179137822 21:38696169-38696191 CATGGCAGAGCTGAGGAGGAAGG + Intergenic
1180279217 22:10678166-10678188 GTTGGTAGGAATGAGGAAGAGGG + Intergenic
1180967984 22:19800449-19800471 CCTGCCAGGCTTGAGGAGGAGGG + Intronic
1181788467 22:25244426-25244448 CATGGCAGGTTTAAGCAGGAGGG - Intergenic
1181820148 22:25469124-25469146 CATGGCAGGTTTAAGCAGGAGGG - Intergenic
1181971198 22:26691365-26691387 CTGGGTAGGTTGGAGGAGGATGG + Intergenic
1182160556 22:28116895-28116917 CAGGGTAGGATTGAGCAGAAGGG - Intronic
1182457594 22:30461812-30461834 CATAGAAGGCTTGAGGAGGTGGG - Intronic
1183206950 22:36426291-36426313 GATGGGAGGAGAGAGGAGGAGGG - Intergenic
1183330561 22:37218595-37218617 CATGGTAGGAGTGATGGGTAGGG + Intergenic
1183792462 22:40083878-40083900 CAGGGAAGGGTTGGGGAGGAGGG + Intronic
1184848339 22:47102750-47102772 CAGAGTAGGATTGGGTAGGAGGG + Intronic
1184922348 22:47614397-47614419 CGTCGTAGGCTTGGGGAGGAGGG + Intergenic
950195484 3:11006449-11006471 CATGGTGGGGGCGAGGAGGAAGG - Intronic
951464748 3:22989967-22989989 GATGGAAGGAGTGAGGACGAAGG + Intergenic
951536884 3:23748334-23748356 CAAGGAAGGGTTGAGAAGGAAGG - Intergenic
955142081 3:56279464-56279486 CAAGTGAGGATGGAGGAGGAAGG + Intronic
955684203 3:61533712-61533734 GAGGTTAGGATTGAGCAGGATGG + Intergenic
956381905 3:68673160-68673182 CATGGTAGAATTCAGGCAGAAGG + Intergenic
957006700 3:74956777-74956799 GATATTAGTATTGAGGAGGAAGG - Intergenic
958122695 3:89312723-89312745 CATGGTAGGTGGGAGGAGGGAGG - Intronic
958886069 3:99728383-99728405 CATGGTAGGAGGAAGCAGGAAGG - Intronic
960273447 3:115699541-115699563 AATGGGAGGAAAGAGGAGGAGGG - Intronic
960987072 3:123287668-123287690 CTTGGAAGGACTGATGAGGAGGG - Intronic
961029587 3:123590183-123590205 CATGGTGAGACTGAGGAGGCAGG - Intergenic
961924254 3:130460663-130460685 CATGGTAGTAGTGAAGATGATGG + Intronic
963112626 3:141699792-141699814 CAGGGTAAGAATGAGTAGGAGGG + Intergenic
964370538 3:155995578-155995600 CAAGGGAGGATTGAGGAGGTGGG + Intergenic
965059950 3:163772904-163772926 AAGGGTAGGAATGAGTAGGAAGG - Intergenic
966065130 3:175812253-175812275 GATGGTGGCATTGAGTAGGATGG - Intergenic
967651198 3:191989465-191989487 CATGGTAGGATCATGGTGGAGGG + Intergenic
968005906 3:195242633-195242655 CATGGGAGGCTGGAGGAGGTGGG + Intronic
969979842 4:11143216-11143238 CATGGTATGATGGTGCAGGAAGG + Intergenic
970566565 4:17337546-17337568 CATTGTAGGAATGAAGAGTATGG - Intergenic
971180010 4:24321171-24321193 CACGGTATCATTGAGGATGAGGG - Intergenic
972046241 4:34667903-34667925 AATGTTAGAATTGAGGGGGAAGG + Intergenic
972156356 4:36168203-36168225 CCTGGTAGAATGGAAGAGGAGGG + Intronic
972242558 4:37208942-37208964 CATGGTAGTGTGGAGGTGGAGGG - Intergenic
972384492 4:38551437-38551459 TATGGTAGGAGATAGGAGGAAGG + Intergenic
973196542 4:47449437-47449459 CATGGTGGACTTGGGGAGGAAGG + Intergenic
974688789 4:65268394-65268416 TATGCTAGGATGGAGTAGGAAGG - Intergenic
977969597 4:103198306-103198328 CCTGATAGGATGGCGGAGGAAGG - Exonic
979611077 4:122689597-122689619 CATGGAAGGATACAGGAGTAAGG - Intergenic
979846423 4:125518632-125518654 GATGGTAAAATTGAGGAGGTAGG - Intergenic
979922594 4:126519177-126519199 CAAGGCAGGATGGAGCAGGATGG + Intergenic
980773410 4:137408607-137408629 CATGTTAAGTTTGAGGAGTAAGG + Intergenic
984224073 4:177013925-177013947 CACAGTAGGACTGAGGAGTACGG + Intergenic
986221376 5:5771791-5771813 CATGGCTGGATTGAGGGTGAAGG - Intergenic
986592865 5:9389553-9389575 TTTGGTAAGATGGAGGAGGAGGG - Intronic
987018734 5:13847921-13847943 CATGGAAGGACTGAGGGGCAGGG - Intronic
987601629 5:20079248-20079270 CATGGAAGTATTGAGTAGAATGG - Intronic
992685530 5:79195750-79195772 TTTGGTCAGATTGAGGAGGAAGG - Intronic
993656633 5:90585734-90585756 CATGTTAGGATTGAAGTTGATGG + Intronic
993943857 5:94095247-94095269 AATGGTATGATTGAGGATCAGGG - Intronic
994300586 5:98142473-98142495 CATGGTAGCTTTGACAAGGAAGG - Intergenic
996114062 5:119599061-119599083 CCTGGTAGAAATGCGGAGGAAGG + Intronic
997251415 5:132391592-132391614 CCTGGCATGTTTGAGGAGGAGGG + Intronic
997388426 5:133493823-133493845 TATGTTTGGATTGAGGAGAATGG + Intronic
998191163 5:140025886-140025908 CATAGTCGGATGGGGGAGGAGGG - Intronic
998857133 5:146404414-146404436 AAAGATAGGATTGAAGAGGAGGG + Intergenic
999808830 5:155108893-155108915 CTTGGGAGGATTGAGCAGCAGGG + Intergenic
999968613 5:156836191-156836213 AATGGCAGGATGGAGGAGGCAGG - Intergenic
1000792329 5:165622882-165622904 AATGTGAGGATTGAGGAGGAGGG + Intergenic
1001763485 5:174226371-174226393 AATGGTAGGCTTGGGGTGGAGGG - Intronic
1002453647 5:179333176-179333198 CATGGGGGGCTTGAGGTGGAAGG - Intronic
1002814814 6:669663-669685 CCTGGAAGGATGGAGAAGGATGG + Intronic
1006672378 6:35737394-35737416 CAGGGTGGGCTTGAGGAAGATGG - Intronic
1007141848 6:39583527-39583549 CATGGAAGGACAGAGGGGGAAGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007472565 6:42100349-42100371 CATCGGAGAAGTGAGGAGGACGG - Intergenic
1011371367 6:86640404-86640426 CATGATATCCTTGAGGAGGAAGG - Intergenic
1013029859 6:106322899-106322921 AATGATAGGAGAGAGGAGGAAGG - Intronic
1013721687 6:113038191-113038213 CATGGTCTGAGTGAGGATGAGGG + Intergenic
1013746542 6:113352891-113352913 TATGGCAGGATTGATGAGGTAGG - Intergenic
1014460946 6:121694793-121694815 TAAGGTAGGATTGACTAGGATGG - Intergenic
1014723072 6:124942133-124942155 CATGGTAGTATTTAGGTGGTGGG - Intergenic
1015144730 6:129972863-129972885 CATGGTAGCCCTGAAGAGGATGG + Intergenic
1016520213 6:144938497-144938519 CTGGGTAGTATTGAGGAGAAAGG - Intergenic
1018528821 6:164742096-164742118 GATGGGAGGATTGAGAAGGTGGG - Intergenic
1018528918 6:164742400-164742422 GATGGGAGGAGTGAGGAGGTGGG - Intergenic
1018787758 6:167121548-167121570 GATGGTAGAAATGAGGAGGAGGG + Intergenic
1018871915 6:167790225-167790247 GATGGTGGGGTTGGGGAGGATGG - Intronic
1018996637 6:168715244-168715266 AATGGGGGGATGGAGGAGGATGG + Intergenic
1019877909 7:3831559-3831581 CATGTTATGATTGAAGAGGTTGG - Intronic
1022312710 7:29212281-29212303 CATGTTAGTATTGAGGAAGAGGG - Intronic
1023930132 7:44700420-44700442 CATGGCAGCAGTGAGGAGGAAGG - Intronic
1024241485 7:47439634-47439656 CATGGTGGGACTCAGGATGACGG + Exonic
1024539803 7:50467002-50467024 CATGGCAGGCTTGAGGAAGCGGG + Intronic
1027913346 7:84281249-84281271 GAGGGTTGGATTGAGGAGGCTGG + Intronic
1028509518 7:91608609-91608631 CATGGTAGGAGTCAAGGGGAAGG - Intergenic
1029550514 7:101234846-101234868 CATGGGAGGAGTGGGGAGCAGGG - Intronic
1029705633 7:102274329-102274351 CATGGGAGGAGGGAGGAGGAGGG + Intronic
1030607130 7:111649777-111649799 CAGCGTAGGATTGAGGAAGTTGG - Intergenic
1032874252 7:136020292-136020314 CACGGTAAGATTGGAGAGGAAGG - Intergenic
1034461953 7:151202957-151202979 GATGGGAGGATTCGGGAGGATGG - Exonic
1034471445 7:151256730-151256752 CAAGCTGGGAGTGAGGAGGATGG - Intronic
1037926442 8:22847258-22847280 CAGGGTAGGATGGGAGAGGATGG - Intronic
1038090677 8:24249499-24249521 CATGGCAGAATTTAGAAGGAAGG + Intergenic
1038105874 8:24433159-24433181 CATTGGAGGATTGAGGAGTGAGG + Intergenic
1038670900 8:29582052-29582074 CATTGTAGGAGTGGAGAGGAGGG - Intergenic
1039147791 8:34468437-34468459 GTTGATAGGATTGAGGTGGATGG + Intergenic
1039256638 8:35726158-35726180 CATGGCAGAATTCAGGAGCAGGG - Exonic
1040899884 8:52407601-52407623 CATGGAAGGATTGAGTTGCAAGG - Intronic
1041737901 8:61131247-61131269 CATTTTAGGAATGAGGAGAATGG + Intronic
1043062817 8:75526640-75526662 CTTGGGAGGCTTGAGGTGGAAGG - Intronic
1044074523 8:87802621-87802643 CTGGGTAGGATGGAGTAGGATGG + Intergenic
1044885690 8:96774527-96774549 GATGGTAAGAGTGAAGAGGAGGG + Intronic
1045041527 8:98228817-98228839 AATGGAAGGAATGAGCAGGAAGG + Intronic
1045807737 8:106184996-106185018 CATGGGAGGAGTGAGGCAGATGG - Intergenic
1047221145 8:122919118-122919140 GATGGTGGGGTTGGGGAGGAAGG - Intronic
1047531830 8:125684030-125684052 TATGGTAGGATTTAGGAGTTGGG - Intergenic
1047749216 8:127867253-127867275 CCTGGGAGGGTGGAGGAGGAGGG + Intergenic
1047866497 8:129029689-129029711 CATGGAAGGATGAAGGAGTAGGG - Intergenic
1050740466 9:8813671-8813693 CATGAAAGGAGAGAGGAGGAAGG - Intronic
1050821208 9:9882450-9882472 CATTCTAGGCTTGAGGATGAAGG + Intronic
1050869558 9:10549996-10550018 TCTGGCAGGATTGATGAGGATGG + Intronic
1054885661 9:70195591-70195613 CTGGGTAGGATGGAGAAGGATGG - Intronic
1057170475 9:92960441-92960463 AATGGAAGGTTTAAGGAGGAAGG - Intronic
1057827330 9:98381113-98381135 CATGGAGGGATGTAGGAGGAGGG - Intronic
1058383293 9:104403754-104403776 CATTGAGGGATAGAGGAGGATGG + Intergenic
1058383443 9:104405676-104405698 CATTGAGGGATAGAGGAGGATGG + Intergenic
1058569037 9:106320873-106320895 CATGGGAGGAGTGAGAAAGATGG - Intergenic
1058944768 9:109846107-109846129 CATTGGAAGAATGAGGAGGAAGG + Intronic
1060073331 9:120569861-120569883 CATGGTGGGTTGGAGTAGGATGG + Intronic
1060448005 9:123709580-123709602 CAAGCTAGGATGCAGGAGGAAGG - Intronic
1061153389 9:128842412-128842434 CATGATGTGATGGAGGAGGATGG - Intronic
1061429631 9:130523035-130523057 AATGGTAGGATGGAGTAGGGGGG + Intergenic
1185868855 X:3646451-3646473 CATGGTAGGGCTCAGGAGGAAGG + Intronic
1185997457 X:4967690-4967712 CATGGGAGGATGCAGGAAGAAGG + Intergenic
1186345159 X:8684534-8684556 TGTGGAAGGATTTAGGAGGAGGG + Intronic
1187030735 X:15485466-15485488 CATGATAGGAATTAGGAGTAGGG + Intronic
1187462411 X:19499786-19499808 AAAGGTAGGATTGAGGGAGAGGG + Intronic
1187889711 X:23923002-23923024 CAGGGTAGGATTCAAGAGGCAGG - Intronic
1188081874 X:25853055-25853077 CAAGGCAGGTTTGAGGATGAGGG - Intergenic
1188642304 X:32521430-32521452 AATGATAGGGTGGAGGAGGATGG - Intronic
1188979548 X:36714720-36714742 TATGGTAGGAATCAGGAGGAGGG + Intergenic
1189096735 X:38148570-38148592 CATGGGAGAATTGAGGAGTCTGG + Intronic
1192632882 X:72790709-72790731 GCTGGTAGGTTTGGGGAGGAAGG - Intronic
1192648827 X:72930092-72930114 GCTGGTAGGTTTGGGGAGGAAGG + Intronic
1193900583 X:87171718-87171740 CAAGGCAGGATGGAGTAGGAAGG - Intergenic
1194418899 X:93648675-93648697 CAGGGTAGGATTAAGGAGGTGGG - Intergenic
1194732372 X:97471173-97471195 CATATTTGGATTCAGGAGGAAGG + Intronic
1195255150 X:103082722-103082744 CATGCTGGGATTGAGGGTGAAGG - Intronic
1196156012 X:112431165-112431187 CATGGTAGGTTGGAGGGGGCTGG + Intergenic
1197172581 X:123450963-123450985 CTTGGTAGGTTTGAGGAAGAAGG + Intronic
1197561648 X:128030378-128030400 CCTGTGAGAATTGAGGAGGAAGG - Intergenic
1198675152 X:139123377-139123399 CATGGCGGGAGTGAGGGGGAAGG - Intronic
1200063342 X:153493544-153493566 CATGGTTGGAATGAGGAGATTGG - Intronic
1200877428 Y:8172675-8172697 CATTGTAAGATAGAAGAGGAGGG - Intergenic