ID: 1155234306

View in Genome Browser
Species Human (GRCh38)
Location 18:23804165-23804187
Sequence GCTTATATGTAGACGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155234300_1155234306 30 Left 1155234300 18:23804112-23804134 CCCAGTAGAAAGTGAAAAGCTGT 0: 1
1: 0
2: 3
3: 30
4: 316
Right 1155234306 18:23804165-23804187 GCTTATATGTAGACGGTGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 53
1155234301_1155234306 29 Left 1155234301 18:23804113-23804135 CCAGTAGAAAGTGAAAAGCTGTT 0: 1
1: 0
2: 4
3: 28
4: 244
Right 1155234306 18:23804165-23804187 GCTTATATGTAGACGGTGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155234306 Original CRISPR GCTTATATGTAGACGGTGGC AGG Intronic
901779997 1:11587626-11587648 GCTTATAGCCAGATGGTGGCTGG - Intergenic
904712694 1:32442698-32442720 GTTTAAAAGTAGAAGGTGGCTGG + Intergenic
910887972 1:91986390-91986412 GCTTATATTTAGACAGTTCCTGG - Intronic
915447915 1:155984647-155984669 GGTTATGTGGAGACAGTGGCTGG + Intronic
915837762 1:159191522-159191544 TCTTATATGTAGGTGGTGGCAGG + Intronic
922921716 1:229310872-229310894 GCTGAGAAGTAGACGGTGACGGG - Intergenic
923328132 1:232898570-232898592 GGTGACATGTAGATGGTGGCAGG + Intergenic
924427130 1:243962193-243962215 GCTTAGAAATAGACAGTGGCTGG - Intergenic
1066601631 10:37114262-37114284 GATTAAATGTAAACTGTGGCTGG - Intergenic
1069561803 10:69435961-69435983 GATGACATGTAGATGGTGGCAGG - Intergenic
1077381072 11:2237901-2237923 GGTTATCTGTGGATGGTGGCAGG - Intergenic
1077966823 11:7143125-7143147 GCTTATATGTTTATGGAGGCTGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1096608476 12:52784928-52784950 GTTTATATGTTGAAGGGGGCTGG + Intergenic
1097677191 12:62615612-62615634 GCTTACAGCTAGATGGTGGCTGG - Intergenic
1120097445 14:80404263-80404285 CCTTATATGTGGATGGTGTCAGG + Intergenic
1123988393 15:25665248-25665270 GTTTATCTGAAGAGGGTGGCAGG + Intergenic
1127245725 15:57171945-57171967 GTTTAAATGTAGAAGGTGGCAGG + Intronic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1132271483 15:100530301-100530323 TCCTATAGGTAGAAGGTGGCTGG - Intronic
1135697296 16:24601027-24601049 GCTTGAATGTAGACGGTGATAGG - Intergenic
1146422314 17:32699207-32699229 GCTTATTTGGAGACTGAGGCAGG - Intronic
1148158611 17:45437326-45437348 GCTTAGAGGTAGCGGGTGGCTGG - Exonic
1151266730 17:72962347-72962369 GCTGAAATGAAGACAGTGGCTGG + Intronic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1155234306 18:23804165-23804187 GCTTATATGTAGACGGTGGCAGG + Intronic
931020306 2:58037245-58037267 GTTTAAATGTACACGGTCGCAGG + Intronic
945721276 2:213421453-213421475 GATGACATGTAGATGGTGGCAGG + Intronic
1176902597 21:14461351-14461373 GCTTGTATGTAGACTGAGGTTGG + Intergenic
949716233 3:6934696-6934718 GTTTAAATGAGGACGGTGGCAGG + Intronic
953987853 3:47459247-47459269 GCTCATGTGTAGCTGGTGGCAGG - Intronic
957025342 3:75175062-75175084 GCTTATAATTATACTGTGGCTGG + Intergenic
960517975 3:118623357-118623379 GTGTATATGTTGAGGGTGGCAGG + Intergenic
965190333 3:165519794-165519816 GCTTATTTGCAGGCGGGGGCTGG + Intergenic
966777464 3:183555563-183555585 GCTCATCTGTAGAAGGTGCCAGG + Exonic
967879290 3:194287874-194287896 GCTTATATTAAGCTGGTGGCTGG - Intergenic
973026945 4:45284483-45284505 GATTATATGTAGATGGTGGCAGG - Intergenic
974507820 4:62799674-62799696 GCTTGTATGTAGACTGTTTCAGG - Intergenic
976122249 4:81795967-81795989 GGTTATATGTAGAAGGGGCCAGG + Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
981309657 4:143284508-143284530 GCGTATATGTGGACTGTAGCAGG + Intergenic
981333100 4:143535541-143535563 GGTTATCTGTAGAAGGTGGTTGG + Intronic
986521722 5:8626414-8626436 GCTTATATGTTTATGGGGGCTGG - Intergenic
1000242133 5:159418382-159418404 GCTTATATGTAGATGGCAGTGGG + Intergenic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1007711878 6:43829720-43829742 GCTTTTATGTACACGGCGTCTGG + Intergenic
1013595933 6:111661174-111661196 GCTAATGTGGAGACTGTGGCCGG - Exonic
1018319900 6:162596897-162596919 TCTTGTATGTAGGAGGTGGCGGG - Intronic
1023229701 7:38013539-38013561 GCTTGTCTGTGGACGGTGACAGG - Intronic
1033381778 7:140827820-140827842 GTTTATATGTTGTCTGTGGCTGG - Intronic
1037510102 8:19574030-19574052 GCTTATCTGGAGGCTGTGGCGGG - Intronic
1038574347 8:28691599-28691621 ACTAATATGTAGATGTTGGCCGG + Intronic
1053169337 9:35867728-35867750 GCTTACCTGTAGCCGGGGGCAGG + Intergenic
1194214748 X:91115981-91116003 GCTTAAAGGTGGAGGGTGGCAGG + Intergenic
1195885006 X:109628589-109628611 GCTTATAACTATACTGTGGCTGG - Intronic
1196733705 X:118966130-118966152 TCTTATATGAAGACTTTGGCAGG - Intergenic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic