ID: 1155235431

View in Genome Browser
Species Human (GRCh38)
Location 18:23813898-23813920
Sequence GCCTAGAGATGCCGACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155235431 Original CRISPR GCCTAGAGATGCCGACTTCC AGG Intronic
902263444 1:15244553-15244575 GACTAGAGAAGCCGACATCCTGG + Intergenic
903044054 1:20552817-20552839 GCCTGGAGATGCCCAGTGCCAGG - Exonic
907575631 1:55523267-55523289 GCCTGGAGATGCCTACAGCCTGG - Intergenic
907628935 1:56060714-56060736 GCCCAGAAATGCCTAATTCCAGG + Intergenic
914164929 1:145168158-145168180 GCCTAGAGATGCCCTTTGCCAGG - Intergenic
916756160 1:167772006-167772028 GCCTCGGGCTGCCGACTGCCTGG - Intronic
919897467 1:202018274-202018296 TCCCAGAGCTGCCGTCTTCCAGG - Intergenic
921807294 1:219470773-219470795 GACAAGAGATGCAGACTTCCAGG + Intergenic
922332737 1:224591692-224591714 GCCTAGGGATGCTGGCTTCCTGG - Intronic
1067166703 10:43871118-43871140 GCCTGGAGCTGCCAACTGCCCGG + Intergenic
1072877686 10:99190819-99190841 GCCTAGAGCTGGGGACTCCCAGG - Intronic
1073206301 10:101771044-101771066 GCCTCGAGCTCCCCACTTCCTGG - Intronic
1074396144 10:113099513-113099535 GACCAGAGCTGCCGTCTTCCTGG + Intronic
1076165935 10:128282846-128282868 GCATGGAGATGCCATCTTCCAGG + Intergenic
1076729588 10:132431721-132431743 GCTTAGAGATGGCTTCTTCCAGG - Intergenic
1078606943 11:12785302-12785324 GCCCAGAGATGCCCTTTTCCCGG + Intronic
1082611162 11:55299205-55299227 TCCTGGAGATACCGATTTCCTGG - Intergenic
1090502767 11:127277770-127277792 GCCTAGAGGTGCCAATTTGCAGG + Intergenic
1090792110 11:130099565-130099587 GCCAAGAGTTGCTGACTTCCTGG - Intronic
1101272880 12:103166132-103166154 ACCTAGAGAGGCTGACTTCAGGG - Intronic
1102183069 12:110927293-110927315 GCCAAGAGGTGCTGACTTTCAGG - Intergenic
1113881168 13:113627412-113627434 GACCACAGATGCCGACTTCTGGG - Intronic
1115718035 14:36127307-36127329 CCCTAGTGATCCCTACTTCCTGG + Intergenic
1118499464 14:66345260-66345282 GCCTAGAAATGCAGCCTTTCTGG - Intergenic
1126911126 15:53418159-53418181 GCCCAGAGATGCAGAATCCCTGG - Intergenic
1128984447 15:72208877-72208899 TCATACAGGTGCCGACTTCCTGG - Exonic
1133052099 16:3123048-3123070 GCCAAGTGATGACGGCTTCCAGG - Intergenic
1139848880 16:69939005-69939027 GCCTTGACTTGCGGACTTCCAGG + Exonic
1140141651 16:72264044-72264066 GCCTAGAAATGCAGCCTTCGGGG - Intergenic
1148328355 17:46797339-46797361 GCCTGGAGCTGCCGTCTTCCTGG - Intronic
1148747401 17:49926351-49926373 GGCTAGAGATGGAGCCTTCCAGG + Intergenic
1151688836 17:75667315-75667337 GACTCAAGACGCCGACTTCCGGG - Exonic
1152207322 17:78981111-78981133 TCCCAGAGATGGTGACTTCCTGG - Intergenic
1155235431 18:23813898-23813920 GCCTAGAGATGCCGACTTCCAGG + Intronic
1160044066 18:75370717-75370739 GCTTACAGATGCCGCGTTCCAGG - Intergenic
1162004305 19:7767520-7767542 TCCTACAGCTGCAGACTTCCAGG + Exonic
1163656520 19:18549011-18549033 GCCCAGAGATGGGGACTTTCGGG - Intergenic
925541483 2:4972356-4972378 TCCTAGAGAGGGCGATTTCCTGG - Intergenic
927511069 2:23643873-23643895 GCCCAGAGATGCATACTTTCTGG - Intronic
927852206 2:26506471-26506493 GCCTGGAGAAGCCGGCTGCCCGG + Intronic
932818291 2:74878939-74878961 GCCTGGAGATGCGGAGTTCCTGG + Intronic
933376789 2:81490118-81490140 ACCTATAGATGCAAACTTCCTGG - Intergenic
937032957 2:118756084-118756106 TCCTAGAGATGCTGAATCCCAGG + Intergenic
937970002 2:127542076-127542098 GCCTAGAGATGCAGTGCTCCTGG - Intronic
947534779 2:230933734-230933756 TCCTGGAGACGCTGACTTCCAGG - Intronic
948405386 2:237713552-237713574 GACTAGAAATGCCAACTTCTTGG + Intronic
1168984395 20:2035586-2035608 GCCTAGAGATGCAGAGTCACTGG - Intergenic
1170225806 20:13990957-13990979 GCCTAGAGATACCAGCTTACAGG - Intronic
1171981458 20:31632103-31632125 GCCTAGAGATGGAAACTTCCTGG - Intergenic
1173164207 20:40674894-40674916 GCCTCCAGATTCAGACTTCCCGG + Intergenic
1174185976 20:48706616-48706638 GCCTGGAGCTGCCGCCTTCATGG + Intronic
1175036116 20:56003536-56003558 GCCAAGAGATAACGACGTCCAGG + Intronic
1182165918 22:28172723-28172745 TTCTAGAGATACGGACTTCCAGG - Intronic
1183667983 22:39256208-39256230 GCCCAGAGATGCCTAGTTCCTGG + Intergenic
1184944687 22:47794882-47794904 GCCTAGAGTTTCTGGCTTCCAGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950527604 3:13533505-13533527 GCCTAAATATGCAGACATCCAGG - Intergenic
950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG + Intergenic
954431086 3:50471190-50471212 GCCTGGAGATGCTGGCTTCAAGG + Intronic
956825403 3:72993284-72993306 TCCTACTGATGCCGATTTCCTGG - Intronic
959748235 3:109802887-109802909 GCATAGGGATGCCAACTCCCTGG + Intergenic
965960732 3:174425703-174425725 GCCTAGAGCTGCTGACAGCCAGG - Intergenic
967118555 3:186362709-186362731 TCCTAGAGATACTGAGTTCCTGG - Intergenic
967267491 3:187703245-187703267 GTCTAGGGATCCAGACTTCCGGG - Intronic
969038234 4:4273354-4273376 GCCGAGAGATGCCCCCTTCTGGG - Intronic
969056855 4:4407655-4407677 GCCTGGAGATGAAGACCTCCGGG + Intronic
979264731 4:118688217-118688239 GCCTCGAACTCCCGACTTCCTGG - Intronic
982138609 4:152296222-152296244 GCCCAGGGCTGCCAACTTCCTGG - Intergenic
984597080 4:181682357-181682379 GCCTAGAGATGCATACTTAAAGG - Intergenic
988596265 5:32594210-32594232 TACTAGAGATGCTTACTTCCTGG + Intronic
989195611 5:38713507-38713529 GCCTTGGGAGGTCGACTTCCTGG + Intergenic
1000995150 5:167951009-167951031 GCCTAGAGATGCGAACTTCAAGG + Intronic
1001651798 5:173321024-173321046 GCCTAGAGATGCTGACTTAGGGG + Intronic
1003339580 6:5206583-5206605 GCCTAGAGGTGAGGACTTCATGG + Intronic
1003393874 6:5736383-5736405 CCCTAGAGATCCCCACCTCCTGG - Intronic
1006917256 6:37602558-37602580 GGCTAGAGATGCAGAATTTCAGG + Intergenic
1012965303 6:105667382-105667404 GTCTAGCGATGGCGCCTTCCTGG + Intergenic
1015798015 6:137032361-137032383 GCCCAGAGATGACCACTGCCTGG - Intronic
1022531580 7:31070161-31070183 GCCTGGAGATGCCAATTCCCAGG - Intronic
1023045226 7:36204701-36204723 GCCTGGAGCTGCCACCTTCCTGG + Intronic
1025253926 7:57370337-57370359 GCCTAGACATGCCAGCCTCCAGG - Intergenic
1035067240 7:156115711-156115733 GCCAAGAGATGCCCACGACCCGG + Intergenic
1043935449 8:86137245-86137267 CCCTACAGATGCCTACTTCCAGG + Intronic
1188276264 X:28205427-28205449 CCCTAGAGATCCCTATTTCCTGG - Intergenic
1192169674 X:68846547-68846569 GCCTTGAGATGCCCAATTCTGGG - Intergenic
1200056153 X:153462445-153462467 GCCTAGAGAAGCAGCCTGCCCGG + Intronic
1201595970 Y:15669559-15669581 GCTTGGAGATGCTGACTTCGGGG + Intergenic