ID: 1155235435

View in Genome Browser
Species Human (GRCh38)
Location 18:23813912-23813934
Sequence ACTTCCAGGCACAGAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155235430_1155235435 -2 Left 1155235430 18:23813891-23813913 CCTCAGAGCCTAGAGATGCCGAC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1155235435 18:23813912-23813934 ACTTCCAGGCACAGAATGGATGG 0: 1
1: 0
2: 4
3: 23
4: 230
1155235432_1155235435 -10 Left 1155235432 18:23813899-23813921 CCTAGAGATGCCGACTTCCAGGC 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1155235435 18:23813912-23813934 ACTTCCAGGCACAGAATGGATGG 0: 1
1: 0
2: 4
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155235435 Original CRISPR ACTTCCAGGCACAGAATGGA TGG Intronic
900197772 1:1385829-1385851 ACTTCCAGGCACAGGAAGCTAGG + Intronic
900864270 1:5255976-5255998 ACTTCCAGGAGAAGAGTGGAGGG + Intergenic
901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG + Intronic
903989540 1:27256730-27256752 TGTTCCTGGCACAGAATGAAGGG - Intronic
906047016 1:42838997-42839019 ACTTCCTGGGGCAGAAGGGAGGG + Intronic
907657290 1:56357212-56357234 ACTTCCAGGCTCAGAACTGTGGG - Intergenic
908207748 1:61868855-61868877 TCTCCCAGGCACAAAATAGAGGG - Intronic
908650419 1:66326969-66326991 ACTTCCCTGCACAGATTGCAGGG + Intronic
908878409 1:68703358-68703380 CCTTCAAGGCACAGAATTGGAGG + Intergenic
910226102 1:84937975-84937997 ATTTCCAGGCATATAATGTAAGG - Exonic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
911711829 1:101082315-101082337 ATTTCCAAGTACAGAATGAATGG - Intergenic
912528309 1:110301715-110301737 TCTCCCAGGCTCACAATGGATGG - Intergenic
913971821 1:143422405-143422427 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914066200 1:144248018-144248040 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914112953 1:144718336-144718358 ACTTCCAGGCAGGGGAAGGACGG + Intergenic
917533885 1:175860829-175860851 GCATCCAGGCTCAGAGTGGAGGG + Intergenic
917567677 1:176229760-176229782 TCTTCCAGGCACAGAAGCAATGG - Intergenic
919320613 1:196032247-196032269 TCTTCCAGGCAAAAAATGAATGG + Intergenic
920543049 1:206793660-206793682 GGTTCCAGGCATAAAATGGAGGG - Intergenic
921926889 1:220718215-220718237 GATTCCAGACACAGTATGGAAGG + Intergenic
922817629 1:228461710-228461732 ACCCCCAGGCCCAGAATGAATGG + Intergenic
1064426594 10:15234987-15235009 ACTGCCAGGCAGAAAAAGGAGGG + Intronic
1066255311 10:33672873-33672895 GGCTCCAGGCTCAGAATGGAGGG - Intergenic
1067508099 10:46873475-46873497 ACTTCTAGGCAGAGAATGCTTGG - Intergenic
1067654151 10:48178370-48178392 ACTTCTAGGCAGAGAATGCTTGG + Intronic
1069147120 10:64907564-64907586 ACTTCCATGGACAGCATGAAAGG - Intergenic
1069841771 10:71344248-71344270 GCCACCAGGCACAGCATGGAGGG - Exonic
1071567128 10:86677104-86677126 ACTTCCAGCCACAGCTTGTAGGG + Intronic
1072058245 10:91782321-91782343 ATTTCCAGGCAAAGTATGAAAGG - Intergenic
1073116713 10:101095553-101095575 ACTTCCAGGTAAAGGCTGGAAGG - Intronic
1073155444 10:101342794-101342816 AAATCCAGGCACAGAAAGCAAGG + Intergenic
1073339675 10:102735378-102735400 ACTTGGAGGAACAGCATGGAGGG - Intronic
1074829682 10:117240282-117240304 ACGCCCAGGCACAGCATGGTGGG + Intergenic
1075088781 10:119431284-119431306 CCTCCCAGGTAGAGAATGGATGG - Intronic
1075579805 10:123608758-123608780 ACATAAATGCACAGAATGGAAGG - Intergenic
1075919901 10:126201951-126201973 ACGTCCAGGGAAAGAATGGGCGG + Intronic
1076220254 10:128728088-128728110 ACTTCCAGACACAGAGCTGAAGG - Intergenic
1076470889 10:130717253-130717275 TCCTCCAGGCACAGCACGGAGGG + Intergenic
1076682568 10:132181400-132181422 ACTTCCAGGCTGAGAAGGGCCGG - Intronic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079378242 11:19913636-19913658 ACTTCGAGGCACAGAGAGAAAGG + Intronic
1079390908 11:20021557-20021579 AGTTCCAGGGACAGCATAGAAGG + Intronic
1079610234 11:22423993-22424015 AGTGCCAGGGACAGAATGAAAGG + Intergenic
1080920259 11:36701661-36701683 AGTTCCTGGCACAGAATAAATGG - Intergenic
1081943786 11:46969496-46969518 ACTTCTAGGCACAGAAACAAGGG + Intronic
1083939713 11:65889013-65889035 ACTTCCAGGCAGAGCTCGGAGGG - Intergenic
1084894295 11:72254245-72254267 ACTCCCAGACTCAGGATGGAGGG - Intergenic
1086040452 11:82470800-82470822 AATACAAGGCACAAAATGGAGGG - Intergenic
1096600595 12:52725872-52725894 ACTTACAGACACAGAAGGAAGGG - Intergenic
1098209882 12:68152367-68152389 AATTCCAGGCACAGTGTGTAGGG - Intergenic
1100895039 12:99172048-99172070 TCTTCAAGGCACAGATTAGATGG - Intronic
1104004971 12:124885395-124885417 ACCCCCAGGCACAGGAAGGAAGG + Intergenic
1104064080 12:125292285-125292307 AATTGCAGTGACAGAATGGAAGG + Intronic
1108523025 13:51261813-51261835 ACTCACAGGCACAGAGTGGTTGG - Intronic
1108638970 13:52364321-52364343 ACTTCTTGGCACAGTATGGAAGG - Intergenic
1108650972 13:52479236-52479258 ACTTCTTGGCACAGTATGGAAGG + Intergenic
1108756777 13:53512740-53512762 GCTTCCACACACAGAATGGGAGG - Intergenic
1109540415 13:63770297-63770319 ACTTCCAAGTACAGAATTAAAGG - Intergenic
1111643461 13:91000389-91000411 AGTTCCAGGCTCAGGTTGGATGG + Intergenic
1113028200 13:105964481-105964503 ACTTCCAGGTAGAGAATGGAAGG - Intergenic
1113109504 13:106807302-106807324 AGTGCCAGGCACAAAATAGATGG - Intergenic
1113818417 13:113192538-113192560 ACTTCCAGGCAAACAACTGATGG + Intronic
1116280308 14:42898537-42898559 ACTTGAAGACACAGAATGGAAGG - Intergenic
1117351551 14:54886208-54886230 ACATCCAGGAACAAAATGAATGG - Intronic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1118821569 14:69349410-69349432 ACTTGCAGGGGCAGAATGAATGG - Intronic
1119682740 14:76605019-76605041 ACCTCCAGGCACTGTCTGGAGGG - Intergenic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1121565160 14:94903882-94903904 ACTCCCTGGGACAGAAGGGATGG + Intergenic
1121788883 14:96683893-96683915 GCTTCCAGGCACTGATAGGAAGG + Intergenic
1122768925 14:104088554-104088576 CCTTGCAGGCACAGCAGGGAGGG + Intronic
1202854003 14_GL000225v1_random:38397-38419 TTTTCCAGGCTCTGAATGGAGGG - Intergenic
1123789451 15:23706193-23706215 AGTTCCACAGACAGAATGGAAGG - Intergenic
1127015099 15:54676028-54676050 AGCTCCAGGCACTGAATGGATGG + Intergenic
1128046281 15:64620446-64620468 ATTTCCATGCACAGAAGTGAAGG - Intronic
1130223310 15:82039554-82039576 ACTTCAAGGCAATGAATGAAGGG + Intergenic
1130320542 15:82837389-82837411 ATTTCCAGGCCCAGAATGCAAGG + Intronic
1130519139 15:84648956-84648978 ACTTCCAGCGGGAGAATGGAGGG - Intronic
1130889508 15:88121540-88121562 ACTTCCAGGCCCAGGATGCAAGG + Intronic
1130970084 15:88725515-88725537 ACATTCAAACACAGAATGGAAGG + Intergenic
1133896063 16:9930039-9930061 ACTTCCAGCCATAAAAGGGAGGG + Intronic
1134349184 16:13420603-13420625 ATTTCAAAGCACAGAAGGGAGGG + Intergenic
1135156993 16:20061164-20061186 AATGCCAGGCCCAGAATGGATGG + Intronic
1137493790 16:48953263-48953285 ACTTCCAGGCACAGTGTGTAAGG - Intergenic
1138312737 16:56041979-56042001 ACACCCAGGCCCAGTATGGAGGG + Intergenic
1140033618 16:71357329-71357351 ACTTGCAGGAACAGACTGGGGGG - Intergenic
1143417661 17:6761328-6761350 ACTTCCTGGCACTGAATCTAGGG + Intronic
1144653848 17:17022934-17022956 ATCTCCAGGCGCAGAAGGGAGGG - Intergenic
1146578214 17:34013126-34013148 AGCTCCAGGCAAAGAAAGGAAGG + Intronic
1147928627 17:43961944-43961966 ACTTCCAGGCAGGGGATTGAGGG - Intronic
1148123484 17:45225290-45225312 ACTGCCAGCCCCAGAAGGGAAGG - Intronic
1149406785 17:56360226-56360248 TGTTACAGGAACAGAATGGAGGG - Intronic
1151848521 17:76675004-76675026 AACTCCAGGCCCAGAATGGTCGG - Exonic
1152079941 17:78180578-78180600 ATTTTCAGGAACATAATGGAAGG + Intronic
1152121852 17:78423667-78423689 GCCATCAGGCACAGAATGGATGG + Intronic
1203179828 17_KI270729v1_random:47942-47964 ACTTCGATGCATGGAATGGAAGG + Intergenic
1152976739 18:228344-228366 ACTAACAGGCAGAGAATAGACGG - Intronic
1153103496 18:1500987-1501009 ACTTCTGGGCACAGAAGGTAGGG + Intergenic
1155235435 18:23813912-23813934 ACTTCCAGGCACAGAATGGATGG + Intronic
1156307266 18:35888684-35888706 ACATCCAGGAGCAGCATGGATGG - Intergenic
1156540650 18:37906447-37906469 TCTTACTGGCAGAGAATGGAAGG - Intergenic
1156676426 18:39531913-39531935 GTTTCCATGCAGAGAATGGACGG + Intergenic
1157394210 18:47328152-47328174 ACTTCTAGGAAGAGAAAGGAAGG + Intergenic
1159813082 18:73040393-73040415 ACCCTCAGGCAGAGAATGGAAGG - Intergenic
1161992083 19:7689925-7689947 AGTTCCATGCACAGATTAGAAGG - Intronic
1163751313 19:19079894-19079916 ACTTCCAGGCACAGAACCAAAGG - Intronic
1163988998 19:20980969-20980991 ACATCCAGACTCAGAATGCAGGG + Intergenic
1164745153 19:30606694-30606716 ACTCCCAGGCACAAACGGGAGGG + Intronic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1164976461 19:32576282-32576304 ACATACAGGCACGGAATTGACGG - Intergenic
1165247994 19:34508694-34508716 ACTTCCAGTCCCAGAAGGCAGGG - Exonic
1165375093 19:35436250-35436272 ACTTCTAGAGACAGAAGGGAAGG + Intergenic
1165403665 19:35617483-35617505 ACTTCCAGGCTGGGAATAGAAGG + Intronic
1166739576 19:45105753-45105775 AGGTCCAGGCACAGCAAGGAAGG - Intronic
1167609856 19:50501811-50501833 GGCTGCAGGCACAGAATGGAGGG - Intergenic
926308837 2:11659888-11659910 ATTTCAAGGCACAGACTGCACGG + Intronic
929449679 2:42028324-42028346 ACTTCCTGCCACGGAAGGGAGGG + Intergenic
930223486 2:48768519-48768541 ACTTCCTGGCACAGCCTTGATGG - Intronic
930952390 2:57158327-57158349 GCTTTGAGGCACAGCATGGAGGG + Intergenic
932569836 2:72932788-72932810 ACTGCCAGACACAGAATAGGGGG + Intronic
932773332 2:74513680-74513702 CTTCCTAGGCACAGAATGGAGGG + Intronic
933503841 2:83152246-83152268 ACTTCCAGTCACAGACTGATGGG + Intergenic
934176511 2:89583337-89583359 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934286821 2:91657698-91657720 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
936521927 2:113216949-113216971 TGTGCCAGGCACAGTATGGAAGG - Exonic
937292392 2:120789465-120789487 GCTTCCAGTCAGAGAATGAAAGG - Intronic
937779784 2:125823692-125823714 ATTCCCAGGCACAGAAAGCAAGG - Intergenic
938201707 2:129377670-129377692 AAGTCCTGGCCCAGAATGGAGGG - Intergenic
938313949 2:130313900-130313922 ACATGCAGGCACAGAGAGGAGGG - Intergenic
939935139 2:148282368-148282390 ACTTCCAGACTCAAATTGGATGG + Intronic
945087327 2:206145445-206145467 AATTCCTGGCACAGTAAGGAAGG + Intronic
946081335 2:217122171-217122193 ACTTGCAGGCTGAGAAAGGATGG - Intergenic
946782321 2:223204779-223204801 CCTCCCAGGCACAGAAGGAAAGG + Intergenic
948075471 2:235162331-235162353 ACTGCCAGGCAGAAAAAGGAGGG + Intergenic
948768607 2:240236057-240236079 TCTTCCATGCTCACAATGGAAGG + Intergenic
1168913386 20:1467476-1467498 AGTTCCAGGAACAGCAAGGAGGG - Intronic
1171582229 20:26471924-26471946 CATTCAAGTCACAGAATGGAAGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1175036297 20:56004316-56004338 ACTTCAAGCCACAGAATTGGTGG - Exonic
1175138730 20:56843880-56843902 CCTTCCAGGCACCAAATGGGTGG - Intergenic
1175309863 20:58004251-58004273 TCATCCAGGCACAGCCTGGAAGG + Intergenic
1175318856 20:58071419-58071441 GCTTGCAGGCTCAGAAGGGAAGG - Intergenic
1176978020 21:15346248-15346270 ATTTTCAGGAACAAAATGGAAGG - Intergenic
1178783848 21:35633908-35633930 ACTTCTAGGCAGAGCATAGAGGG + Intronic
1179882269 21:44297882-44297904 ATTTCCAGGCACATGATGGCTGG - Exonic
1179960753 21:44765968-44765990 ACTTCCAGGCATGTAAGGGAGGG + Intergenic
1180028679 21:45185557-45185579 ACACCCAGGCACAGAATGGCTGG - Intronic
1181773677 22:25144746-25144768 ACTCCCAGGCATAGAAAGGGAGG + Intronic
1182150495 22:28024042-28024064 AGGTACAGGCACAGAAGGGAGGG - Intronic
1182238390 22:28895066-28895088 ACTTCCAGAGACAGAAAGGATGG - Intronic
1183315327 22:37133853-37133875 ACTTCCAGGAACAGAGTGCAGGG - Intronic
1184786110 22:46672721-46672743 ACATCCAGGCTCAGGGTGGAGGG + Intronic
949715208 3:6922008-6922030 TCTTCCAGGAACAGGTTGGAGGG + Intronic
950634352 3:14304374-14304396 AATGCCAGGCACTGAATGGAAGG + Intergenic
951201237 3:19876967-19876989 ATTCCTAGGCACAGAATTGAAGG + Intergenic
952581459 3:34838255-34838277 ATTTCCAAGCAAAGAGTGGAAGG - Intergenic
953388899 3:42523185-42523207 GTTTCCAGGCCCAGACTGGAGGG + Intronic
953705635 3:45227738-45227760 ACTTCCAAGCACAAAAGTGATGG - Intergenic
959409960 3:106008837-106008859 ACTTCCAGGCACAGAACAGCTGG + Intergenic
960647461 3:119903166-119903188 ACTTCCAGTCAATAAATGGATGG + Intronic
960689153 3:120325884-120325906 ACATCCTGGGACAGAATGCATGG + Exonic
960891110 3:122449302-122449324 AGTTCCAGGCTCATACTGGATGG - Intronic
961340494 3:126213911-126213933 CCAGCCAGGCACAGAAGGGAAGG + Intergenic
964307567 3:155357285-155357307 ATTTACAGGCACAGGATGGAGGG + Intergenic
964729948 3:159854166-159854188 ATTTCCAGGCCCATGATGGAAGG - Intronic
965071917 3:163925199-163925221 ACCTCCAGGCAAAGAAGGCAAGG + Intergenic
965213591 3:165829647-165829669 ACTTCCGTGGCCAGAATGGATGG - Exonic
969110602 4:4841789-4841811 GCCCCCAGGCACAGAAAGGAGGG + Intergenic
969807842 4:9624627-9624649 ACTTCCAGGCTCAGAAAAGCAGG - Intergenic
970214715 4:13746566-13746588 GTTTGCAGGCACAGAATGGGTGG + Intergenic
972357415 4:38293354-38293376 ATTTCCAGGCAGAGTATTGAAGG + Intergenic
972558418 4:40203588-40203610 ACTTAAAGGCTCAGAATTGAAGG + Intronic
975351653 4:73353803-73353825 ACCTAGAGGCACAGAATTGAAGG - Intergenic
977237792 4:94529201-94529223 ACTTACAGTCACGGAAAGGAAGG + Intronic
978354223 4:107853684-107853706 TCTTTCTGGCACAGAATTGAGGG - Intronic
978616068 4:110597359-110597381 ACTTCCAGTCAGAGTTTGGAAGG - Intergenic
978739579 4:112121659-112121681 ACATCCAGGCTCAGCATGGTTGG - Intergenic
981617915 4:146661891-146661913 CCTTCCAGGCCCAGAAAGGTGGG - Intergenic
982096611 4:151929111-151929133 ACTTCCAAGCATTGAAGGGAAGG + Intergenic
984811349 4:183798234-183798256 ACTTCCTGGCACCGAAAGGAGGG + Intergenic
987552703 5:19404638-19404660 AATTCCAGGAACAGAACAGAGGG + Intergenic
989273453 5:39558803-39558825 ATTTCTGGGCACAGAGTGGAAGG + Intergenic
989305276 5:39947978-39948000 ACTTCCAGTCACACACTGGAGGG - Intergenic
989362816 5:40623085-40623107 ACTACCAGGCCCAGAGTAGAAGG - Intergenic
992508385 5:77409864-77409886 AGTTCCAGGTGGAGAATGGAGGG - Intronic
992880546 5:81105181-81105203 ACTAACAGTCAGAGAATGGAAGG - Intronic
994431083 5:99662123-99662145 ACTTCCAGGCCCTCAATTGATGG + Intergenic
994466124 5:100134213-100134235 ACTTCCAAAAACAGAAAGGAAGG - Intergenic
994559249 5:101346663-101346685 TCTTCCTGGCCCAGAATGGCAGG - Intergenic
994986574 5:106941121-106941143 CTTTCCAGGCAAAGAATGGTAGG - Intergenic
996597000 5:125215840-125215862 ACTTCAAGTCACAGAATTTAGGG + Intergenic
998560463 5:143166525-143166547 AAGCCCAGGCACAGAATGGTGGG - Intronic
998809105 5:145948454-145948476 ACTTGCATGCACAGCATAGAGGG + Intronic
999366354 5:151026269-151026291 ATTGCCAGGCAGAGCATGGAGGG - Intronic
1000265605 5:159633326-159633348 ACTCCCAGGAAAAGAATGGCAGG - Intergenic
1001682024 5:173565079-173565101 ACTTCTAGGGAAAGAAAGGATGG + Intergenic
1001789764 5:174446061-174446083 ACTTAGAGTCACAGAATTGAGGG - Intergenic
1002716554 5:181231627-181231649 ACTGCTAGGCACTGAATGGTAGG + Intronic
1006655807 6:35591710-35591732 ACTTCCAGTCACATAAGTGAAGG + Intronic
1007331993 6:41119080-41119102 ACTTTCTGGCACAGAAAGAAGGG + Intergenic
1008744020 6:54646855-54646877 ACGTCCTGGCAAAGAAAGGAGGG - Intergenic
1011239810 6:85258836-85258858 GCTTCTAGTCACAGAAAGGAAGG - Intergenic
1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG + Intergenic
1016112549 6:140243159-140243181 ACTTCCAAGCACAGAATTACTGG - Intergenic
1016679407 6:146810864-146810886 TATTTCAGGTACAGAATGGATGG + Intronic
1018369467 6:163154566-163154588 ACATCTAGGCACAGAATGGAGGG - Intronic
1019764119 7:2837098-2837120 TCTTCCAGGCAGAGAATGGGAGG - Intronic
1022444669 7:30460395-30460417 TCTTCCAGGCAAAGAGAGGACGG + Intronic
1023132257 7:37014764-37014786 TCCTCAAGGCTCAGAATGGAAGG + Intronic
1023411791 7:39895131-39895153 ACTTCCAGGGAAAGAATGGAGGG - Intergenic
1025581460 7:62724092-62724114 ACGTCCATTCACAGAATGGATGG - Intergenic
1025960152 7:66213162-66213184 ACATTCAGTCACAGAATGAAAGG - Intronic
1028254722 7:88579970-88579992 GCTTCCAGGCTGAGAAGGGATGG - Intergenic
1028646277 7:93100333-93100355 ACTTCCAGGCCCATAATGTCTGG + Exonic
1028910684 7:96204332-96204354 ACTTGGGGGCACAGAATGAAAGG - Intronic
1030349236 7:108464651-108464673 CCTTCCAGGCACAGAATAAAAGG - Intergenic
1032056935 7:128691208-128691230 ACTTCCAGCCATGGAAGGGAAGG - Intergenic
1032907785 7:136391537-136391559 AATTCCAGGCACAGGAAGGCAGG + Intergenic
1033813906 7:145050117-145050139 CCTTTCAGGCACAGAATTCAAGG - Intergenic
1034083626 7:148303262-148303284 TCTTCCAGGTAGAGAATGCAAGG + Intronic
1036502848 8:9329262-9329284 ACAGCCAGGAACAGAATGCAGGG + Intergenic
1037559786 8:20062585-20062607 ACTGCCTGGCCCAGAATGGTTGG - Intergenic
1039510585 8:38088842-38088864 ACAACCAGGGACAGAATGGCTGG - Intergenic
1040410399 8:47148488-47148510 ACTACCAGACAGAGAACGGAGGG + Intergenic
1042123646 8:65514635-65514657 ATTTCCTGGCACAAAATTGAAGG - Intergenic
1044534847 8:93346564-93346586 TCTTACAGTCTCAGAATGGATGG - Intergenic
1048315997 8:133362594-133362616 GCATCCAGGCACAGAAGGCAGGG + Intergenic
1048932142 8:139323690-139323712 ACTGCCTGGCTGAGAATGGAAGG - Intergenic
1049661795 8:143822881-143822903 ACTTCCAGACACAGCCTTGAGGG + Intronic
1050416516 9:5423346-5423368 ACTTCCAGACACATACTGGGAGG - Intronic
1050765333 9:9125994-9126016 TGCTCCAGGTACAGAATGGAGGG + Intronic
1051671285 9:19513369-19513391 ACTTACAGACACAGAAATGAAGG + Exonic
1053196669 9:36125183-36125205 ACTTCCAAGCAGAGAATTCAGGG - Intergenic
1053264768 9:36703564-36703586 ACTTCCAGGAATAGAATAGTAGG + Intergenic
1053305303 9:36980592-36980614 AATTCCAGACACAGAAGGGTTGG + Intronic
1053525343 9:38824601-38824623 ACTTCCAGGGAAAGGTTGGATGG - Intergenic
1054197573 9:62049029-62049051 ACTTCCAGGGAAAGGTTGGATGG - Intergenic
1054640837 9:67539673-67539695 ACTTCCAGGGAAAGGTTGGATGG + Intergenic
1055844173 9:80541046-80541068 ATTTCCAGGCACAGAAATGAGGG - Intergenic
1056034004 9:82584567-82584589 ACTGCCAGGCACAGCCAGGAAGG + Intergenic
1060402772 9:123357924-123357946 ACCTGGAGGCACAGAGTGGATGG + Intronic
1061570148 9:131473093-131473115 ACTACCAGGAACAGACTGGCGGG - Intronic
1062400401 9:136370209-136370231 CCTTCCAGGCACGGAGTGGGCGG + Intronic
1187481059 X:19656085-19656107 ACTTCCCAGCACAGGATCGAGGG + Intronic
1188553233 X:31383648-31383670 TTTTACAGGCACAGGATGGAGGG - Intronic
1190036021 X:47024656-47024678 GATTTCAGGCACTGAATGGATGG - Intronic
1191663451 X:63673669-63673691 ACTTCCAGACACAGAATACGAGG - Intronic
1191737970 X:64407274-64407296 TCTTCCAGCCCCAGAATGGTTGG - Intergenic
1195563518 X:106314071-106314093 GCATCAAGGCATAGAATGGATGG + Intergenic
1196147744 X:112337944-112337966 ACTTCCTGTCTCAGAAAGGAAGG + Intergenic
1199027404 X:142956425-142956447 ACTCCCAGGGACACAATGGGAGG - Intergenic
1199865433 X:151844633-151844655 AATTCAAGACACAGAATGGCTGG + Intergenic
1202273858 Y:23096054-23096076 AGTACCTGGCACATAATGGAAGG - Intergenic
1202292168 Y:23324623-23324645 AGTACCTGGCACATAATGGAAGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202426854 Y:24729799-24729821 AGTACCTGGCACATAATGGAAGG - Intergenic
1202443937 Y:24940295-24940317 AGTACCTGGCACATAATGGAAGG + Intergenic