ID: 1155236022

View in Genome Browser
Species Human (GRCh38)
Location 18:23820057-23820079
Sequence GTCTCAGGGAGCCCCCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155236014_1155236022 28 Left 1155236014 18:23820006-23820028 CCCGAAGAGAGCAGCTTCATGGC 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1155236022 18:23820057-23820079 GTCTCAGGGAGCCCCCTGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 168
1155236015_1155236022 27 Left 1155236015 18:23820007-23820029 CCGAAGAGAGCAGCTTCATGGCT 0: 1
1: 0
2: 0
3: 21
4: 167
Right 1155236022 18:23820057-23820079 GTCTCAGGGAGCCCCCTGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155236022 Original CRISPR GTCTCAGGGAGCCCCCTGAA AGG Intronic
900234103 1:1578475-1578497 GGCTCAGGGAGCCCCCAAAAAGG - Intergenic
900830449 1:4961588-4961610 GTCCCAGGGAGGCACCTGCAAGG + Intergenic
904629852 1:31832677-31832699 TTCTCTGAGAGGCCCCTGAAGGG - Intergenic
904849107 1:33443776-33443798 TTCCCAGGGAGGGCCCTGAAAGG + Intergenic
905179055 1:36155667-36155689 GTCACAAGGAGACCCCTGAAAGG - Intronic
905205937 1:36342876-36342898 ATCTTAGGGTGCCCCCTGGAGGG - Intronic
905335040 1:37239229-37239251 GTCTAGGGTAGCCCACTGAAGGG - Intergenic
905910132 1:41647883-41647905 GCCTCTGGGAGGCCCCTGACTGG + Intronic
906292086 1:44625953-44625975 GACTCTGGGATCCCCATGAAGGG - Intronic
906534806 1:46545515-46545537 GTTTCAGGAAGCCCACTGCAGGG + Intergenic
910368638 1:86492817-86492839 GTCACAGTGAGTCCCCTTAAGGG + Intronic
910425620 1:87117601-87117623 ATCGCAGGGGGCCCCATGAAAGG - Intronic
911194092 1:94976394-94976416 GTCTCAGATGGCCCCCAGAACGG + Exonic
912975695 1:114328414-114328436 GGCTCAGGTGGCCCTCTGAACGG - Intergenic
913659112 1:120991028-120991050 GTATCAGGTATCCCCCCGAAAGG - Intergenic
914010476 1:143774153-143774175 GTATCAGGTATCCCCCCGAAAGG - Intergenic
914167347 1:145186960-145186982 GTATCAGGTATCCCCCCGAAAGG + Intergenic
914649097 1:149682812-149682834 GTATCAGGTATCCCCCCGAAAGG - Intergenic
914834903 1:151198853-151198875 GTCTGAGGGAGGCCCCGGAGGGG + Exonic
918927641 1:190809062-190809084 GTGCCAGGCAGCCCCATGAAGGG - Intergenic
920264305 1:204710448-204710470 CGCCCAGGGAGCCCCTTGAAAGG - Intergenic
921424564 1:214986342-214986364 GTGTCAGTGAGACTCCTGAATGG - Intergenic
922464164 1:225835201-225835223 GTCTCATGAAGAACCCTGAAAGG - Intronic
923403552 1:233638623-233638645 GGCCCAGGGAGCCTCCTCAAGGG - Intronic
1066703125 10:38150676-38150698 GACTCACGGATCCCCCTCAAAGG - Intergenic
1066987730 10:42483013-42483035 GACTCACGGATCCCCCTCAAAGG + Intergenic
1068132483 10:52911985-52912007 CCCTCAGGGAGCTCCCTGACAGG + Intergenic
1069873317 10:71546477-71546499 GGCTCTGGGAGCCCACAGAAGGG + Intronic
1073311872 10:102548769-102548791 GTCTCAGGGAAGTCCCTGAAAGG - Intronic
1073634668 10:105185258-105185280 GTCACTGTGAGCCCCATGAAAGG - Intronic
1077165149 11:1131438-1131460 GCCTCAGGGATCCCCCAGTAAGG + Intergenic
1077173513 11:1178730-1178752 GACCCAAGGAGCCCCCAGAAGGG + Intronic
1077200191 11:1302901-1302923 GTCTGAGGAAGGCCCCGGAAGGG - Intronic
1077222951 11:1425504-1425526 GTCTCTGGGAGCCGCCTCAGTGG + Intronic
1079080143 11:17408279-17408301 GCCCCAGGAAGCCCCCTAAAGGG - Intronic
1081660019 11:44882321-44882343 GCCTCAGGGAGCCTCCTCAATGG - Intronic
1084288238 11:68145653-68145675 GGCTCAGGGTGCCCACTGACGGG - Intergenic
1084484138 11:69438231-69438253 GTCACAGTGAGGCCCCAGAAAGG + Intergenic
1084605656 11:70170181-70170203 GTCCCAGGGAGCCCCCATGATGG + Intronic
1085388545 11:76170755-76170777 GCCACAGGGCCCCCCCTGAATGG - Intergenic
1085957236 11:81414222-81414244 GCCACGGGAAGCCCCCTGAAAGG + Intergenic
1089524216 11:119086129-119086151 GCCACAGGGAGCCCACAGAAAGG - Intronic
1091777709 12:3195474-3195496 TGCTCAGAGAGCCCCCTGAAGGG + Intronic
1100532600 12:95474204-95474226 GCCTCCGGGAGCCACCTGAATGG + Exonic
1100831055 12:98516569-98516591 GTCTCAGAGCGCTCCCTGGAGGG + Intronic
1102207232 12:111098919-111098941 CCCTCAGGGAGCCCCCAGACAGG + Intronic
1102469046 12:113149323-113149345 TTCTCAGGGAGCCCCCAGCCTGG - Intergenic
1105951034 13:25229706-25229728 GTGTGAGGGAATCCCCTGAAAGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108590186 13:51906195-51906217 GCCTCAGGGAGTCCCCTTAGCGG - Intergenic
1113789444 13:113019831-113019853 GCCTCAAGGAGACCTCTGAATGG + Intronic
1115043138 14:28955776-28955798 GTCCCAGGGAGACACCTGACTGG - Intergenic
1115874565 14:37845708-37845730 GACTCAGGGAACCTGCTGAAGGG - Intronic
1121180635 14:91926125-91926147 GTCTCAGGAATCCCCCTGCCAGG + Intronic
1121470968 14:94154004-94154026 GTCCCAGTGAGGCACCTGAATGG - Intronic
1122605888 14:102947521-102947543 GTCTCGGGGAGCCTCCTGGCTGG - Intronic
1122745756 14:103896417-103896439 GTCTCACGGATCCTCCTGGAAGG - Intergenic
1123139625 14:106062387-106062409 GTCTCAGGGACCCCCCAGGCTGG + Intergenic
1123141937 14:106088360-106088382 GTCTCAGGGACCCCCCAGGCTGG + Intergenic
1123178367 14:106443367-106443389 GTCTCAGGGACCCCCCAGGCTGG + Intergenic
1123193416 14:106592911-106592933 GTCTCAGGGACCCCCCAGGCTGG + Intergenic
1123198962 14:106643368-106643390 GTCTCAGGGACCCCCCAGGCTGG + Intergenic
1123200404 14:106657961-106657983 GTCTCAGGGACCCCCCAGGCTGG + Intergenic
1123202048 14:106675250-106675272 GTCTCAGGGACCCCCCAGGCTGG + Intergenic
1123212646 14:106775401-106775423 GTCTCAGGGACCCCCCAGGCTGG + Intergenic
1123220976 14:106854903-106854925 ATGTCAGGAAGCCCCCTGAGGGG - Intergenic
1127451838 15:59124117-59124139 CCCTCAGGATGCCCCCTGAATGG - Intronic
1128363146 15:66976798-66976820 CACTCAGGATGCCCCCTGAAGGG + Intergenic
1128513150 15:68326019-68326041 GTCTCAGGGGGCCCCTTAACAGG + Intronic
1131139187 15:89963396-89963418 CTCTCAGGGAACCCCGTGAAGGG - Intergenic
1132222765 15:100117192-100117214 GTTTAAGTGAGCCCTCTGAAAGG + Intronic
1133324869 16:4936526-4936548 GCCTCAGGGCGCCCCCTGGACGG + Intronic
1135468818 16:22711403-22711425 GTCTTTGGGAGACCCCTGTATGG + Intergenic
1136466804 16:30449936-30449958 GTGACAGGGCGCCCCCTGGAGGG - Intergenic
1136680988 16:31962123-31962145 GTCTCAGGGACCCCCCAGGCTGG - Intergenic
1136781306 16:32903636-32903658 GTCTCAGGGACCCCCCAGGCTGG - Intergenic
1136888491 16:33950204-33950226 GTCTCAGGGACCCCCCAGGCTGG + Intergenic
1140802352 16:78499948-78499970 GTCTCAGTGAGGCCTCAGAACGG - Intronic
1141676001 16:85517763-85517785 TTCTAAGGGAGCCCCGTGCACGG + Intergenic
1142000737 16:87662817-87662839 GTCCCAGGCTGCCCCCTGGAAGG - Intronic
1203083962 16_KI270728v1_random:1167618-1167640 GTCTCAGGGACCCCCCAGGCTGG - Intergenic
1143875885 17:9990467-9990489 GTCTCAGGGACCACCCAGGAGGG + Intronic
1146815140 17:35936485-35936507 GTCTCACTGAGCCCACTCAAGGG - Intronic
1147946561 17:44083672-44083694 GTTTCAGTGTGCCCCCTGCAGGG + Intronic
1150453232 17:65286980-65287002 TTCCCATGGAGCCCCCTGATGGG - Intergenic
1150481657 17:65515949-65515971 GTCTTTGGGAACCCGCTGAATGG + Intergenic
1155236022 18:23820057-23820079 GTCTCAGGGAGCCCCCTGAAAGG + Intronic
1155602738 18:27568483-27568505 GTCTCAGGCAGCTGCGTGAATGG - Intergenic
1155901982 18:31402992-31403014 GACTCAGTGAGCATCCTGAATGG + Intronic
1157438575 18:47692193-47692215 ATCTCTGGGAGCTCCCTCAAAGG + Intergenic
1157791110 18:50531996-50532018 GTTTCAGGCAGGACCCTGAAAGG - Intergenic
1160169944 18:76544733-76544755 CTCTCAGGGAGCCCCCAGGAGGG - Intergenic
1160568303 18:79800063-79800085 GTCTCAGGCAGGCACCTGGAGGG + Intergenic
1161495920 19:4585544-4585566 GTCTCAGGGATCCCCCTAATCGG + Intergenic
1164679352 19:30123476-30123498 GTCTCCGTGAGCCCCCAGAAAGG - Intergenic
1166294205 19:41881068-41881090 GACTAAGGAAGCCCCCAGAAGGG - Exonic
1167523800 19:49971784-49971806 GGCTCAGGGACCCGCCTGCATGG - Intergenic
933791635 2:85888432-85888454 GGCTTAGGGAACCCCCTGCAAGG - Intronic
937225281 2:120365300-120365322 GTCTCAGGGACCCCCAAGGACGG - Intergenic
937340264 2:121086693-121086715 GCCTGAGGCAGCCCCCAGAATGG + Intergenic
938080058 2:128365092-128365114 GTCACTGCGAGCCCCCTGACGGG + Intergenic
938851508 2:135265658-135265680 GTTACAGGGAGCACACTGAACGG - Exonic
939350397 2:141029652-141029674 GTCTCAGGGAGCGACATGATAGG - Intronic
942218742 2:173748289-173748311 GTCTCAGGGAGTGGCCTGAGGGG + Intergenic
947810974 2:233003773-233003795 GACTCAGGGCGCCTCCTGGATGG - Intronic
947864219 2:233384903-233384925 GTCTCAGGCAGCTCCCTTATGGG + Intronic
948988362 2:241539795-241539817 CTGTGAGGGAGCCCCCTGGAAGG - Intergenic
1168893975 20:1311214-1311236 GTCTCTGGGAGCCCTTGGAAGGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172520286 20:35561489-35561511 CTCTCAGGGAGCCCTCTGCAGGG - Intergenic
1177983326 21:27943047-27943069 CTCTCCTGGAGCCCCCTTAATGG + Intergenic
1178508467 21:33182116-33182138 TTCTCAGGGAGCCCCATCCAAGG + Intergenic
1179010304 21:37551308-37551330 GTCTCAGGGACCCCCCCACAGGG - Intergenic
1179524270 21:41965588-41965610 GCCTAAGGGAGACCCCTGCATGG - Intergenic
1179805260 21:43833154-43833176 GTCACAGGGAGGCCCCGGGAAGG - Intergenic
1180038730 21:45264872-45264894 GCCTCAGGGAGCCCCGTGGAGGG - Exonic
1181393284 22:22599482-22599504 GGCTCAGGGAACCTCCTGCAGGG - Intergenic
1183288245 22:36981498-36981520 GTCAGGGGGAGCACCCTGAATGG - Intergenic
1184549194 22:45195469-45195491 GCCTCAGGGAGCCCCGAGCATGG - Intronic
949855728 3:8459323-8459345 GGCTCAGGATGCCCCCTTAAGGG + Intergenic
954136526 3:48584542-48584564 TTGTCCGGGAGCCCCCTGTAAGG + Exonic
954276800 3:49547478-49547500 GTCTCAGGCAGACTCCTGACTGG + Intergenic
955463154 3:59207889-59207911 GTCTAAGGGAGACCTGTGAAAGG - Intergenic
955647734 3:61158343-61158365 GTTTCAGGAAGCCCTCTGAAAGG - Intronic
956627798 3:71283523-71283545 GTGACAGGGAGACTCCTGAAGGG + Intronic
961017338 3:123478487-123478509 GGCTAAGGGAGCCCCCTAAGTGG + Intergenic
961825781 3:129598347-129598369 CTCTCCAGGAGCCCCCAGAATGG - Intronic
963908888 3:150798165-150798187 GTCTAAGGGAGTCCCCAGGAGGG - Intergenic
965701954 3:171467236-171467258 GTCCCCGGGAGCCTCCAGAAAGG + Intergenic
965830484 3:172781410-172781432 ATCTCAGGGATCCCACTGAAAGG + Intronic
966535641 3:181030668-181030690 CTCTCAGGGAGCCACCAGACAGG + Intergenic
967443297 3:189534581-189534603 ATCTGAGCGAGCCCCGTGAAGGG - Intergenic
967864060 3:194175811-194175833 CTCCCAGGGAGCCCCCAGCATGG - Intergenic
968758119 4:2427254-2427276 GTGACAGGGAGGCCCCTGAGTGG - Intronic
968789378 4:2648918-2648940 GTCCCAGGGAGAACCCTGCACGG + Intronic
969406113 4:6993203-6993225 CTCTCAGGAATGCCCCTGAAGGG - Intronic
969832670 4:9810417-9810439 GCCTCAGGGAGACCCTTTAAGGG + Intronic
973162157 4:47032270-47032292 TTCCCAGGCAGTCCCCTGAAAGG + Intronic
976083274 4:81380090-81380112 ATCTCAGGGAGCTCAGTGAAAGG - Intergenic
976207865 4:82639499-82639521 GCCTCAGGGAGCCCCTGGGAGGG + Intronic
977464553 4:97367546-97367568 ATGTCAGAGAGCCACCTGAAAGG + Intronic
979217470 4:118182633-118182655 GTGTCAGGCAGCCAGCTGAATGG - Intronic
981781553 4:148436340-148436362 GACTCTGGGAGCTCCGTGAATGG - Exonic
986004617 5:3657544-3657566 GTGTCAGGGAGAGCCCTGCAGGG + Intergenic
986054536 5:4122836-4122858 GACTCAGGGATCCCCAGGAATGG - Intergenic
986571232 5:9168233-9168255 GTCTCAGGGATGCACCTGGAAGG - Intronic
988114238 5:26863702-26863724 GTCTCTGAGAGGCTCCTGAATGG - Intergenic
995352599 5:111197811-111197833 GTCTCAGGAAGGCCACTGAGGGG - Intergenic
995738089 5:115324903-115324925 CTCCCATGGAGGCCCCTGAAGGG + Intergenic
997515935 5:134489987-134490009 GTTTCAGAGAGTCCCGTGAAAGG - Intergenic
998892244 5:146758578-146758600 GTCTCATGGAGCCAACTTAATGG - Intronic
1001221340 5:169903458-169903480 GGCTAAGGGAGCCTCCTCAAGGG + Intronic
1001894300 5:175365334-175365356 GTCTCATGGAGCCCCAGGACAGG + Intergenic
1002607225 5:180390502-180390524 GCCTCAGGGACCTCCCTGGATGG - Intergenic
1004830478 6:19472262-19472284 GACTCATAGACCCCCCTGAAGGG - Intergenic
1007352456 6:41283807-41283829 GTCTCAGGGAGGACTCTGATTGG - Intronic
1011800902 6:91015303-91015325 GTCTCAGGGAGCTACCTGGAGGG - Intergenic
1016581024 6:145629492-145629514 GTCTCAGGGAGAGCACTGCATGG + Intronic
1020007894 7:4792077-4792099 GCCCCAGGGAGCCACCTGAGTGG + Intronic
1026114837 7:67487427-67487449 GTTTCAGGGAGGCTCCTAAAAGG - Intergenic
1028497024 7:91473272-91473294 GTTTCAGGGAGCCACTTGATAGG - Intergenic
1030206023 7:106953363-106953385 CTCTCAGGGAGCTCCCTTAGGGG + Intergenic
1033114171 7:138610759-138610781 TTCTCAGGGAGGCCCTTCAAGGG - Intronic
1033770094 7:144540962-144540984 GCATCAGGGAACCCTCTGAAGGG - Intronic
1034459145 7:151188288-151188310 GTCTAAGGGAGCCCCCTGAGGGG - Intergenic
1034947960 7:155276119-155276141 CTCTCAGGGAGCTCACTTAAAGG - Intergenic
1035259493 7:157652594-157652616 GTCTCAGGGACCCCCGGGGAAGG - Intronic
1036778736 8:11631310-11631332 GTAGCAGTGAGCTCCCTGAATGG + Intergenic
1039904359 8:41775253-41775275 GTCTCAGGGTACCCCCTGGTCGG - Intronic
1042122233 8:65500611-65500633 GGCTCAGGGAGGCCCCAGCAGGG + Intergenic
1047978379 8:130154172-130154194 GTCTCTGGAAGACCCCTAAAGGG - Intronic
1049197743 8:141324819-141324841 GTGTCCTGGAGCCACCTGAATGG - Intergenic
1049584454 8:143426423-143426445 GGCTCACGGAGCCCCCAAAATGG + Intronic
1052155121 9:25177743-25177765 ATCTCAGGGAGTGCTCTGAAAGG - Intergenic
1054156128 9:61641682-61641704 GTCTGAGGGATTGCCCTGAAGGG + Intergenic
1056203733 9:84300661-84300683 TGCTCAGGGGGCCACCTGAAGGG + Intronic
1057140206 9:92722199-92722221 GTCTCAGAGGGACCCCTGACAGG - Intronic
1060012189 9:120053508-120053530 CTCTCCTGGAGCCCCCAGAAAGG - Intergenic
1062309773 9:135929470-135929492 GTCTGAGGGAGCCCCCTGTGGGG - Intergenic
1062711816 9:137978896-137978918 GTCTCAGAGAGCACCCTGGATGG - Intronic
1185449769 X:275936-275958 GTCTCCCGGAGCCCCCAGGACGG - Intergenic
1187838938 X:23465471-23465493 TTTTCTGGAAGCCCCCTGAAAGG - Intergenic
1187943865 X:24407783-24407805 GTGACAAGTAGCCCCCTGAAGGG + Intergenic
1189994953 X:46629300-46629322 GTCTCAGGAACCTCCCTGGATGG - Intronic
1190165787 X:48071813-48071835 GTATGTGTGAGCCCCCTGAAAGG - Intergenic
1193709062 X:84857197-84857219 GCCTCAGGGAGCCCCACCAAGGG - Intergenic
1193710477 X:84873233-84873255 GCCTCAGGGAGCCCCACCAAGGG + Intergenic
1201952423 Y:19580088-19580110 TTCTCAGGGAACCCTCAGAAAGG + Intergenic