ID: 1155236596

View in Genome Browser
Species Human (GRCh38)
Location 18:23826053-23826075
Sequence ACATATCTGCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 11, 3: 37, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155236596_1155236601 -7 Left 1155236596 18:23826053-23826075 CCCTCTTCCCTCTGCAGATATGT 0: 1
1: 0
2: 11
3: 37
4: 350
Right 1155236601 18:23826069-23826091 GATATGTGCTGCTGTCAGGACGG 0: 1
1: 0
2: 2
3: 17
4: 140
1155236596_1155236602 -2 Left 1155236596 18:23826053-23826075 CCCTCTTCCCTCTGCAGATATGT 0: 1
1: 0
2: 11
3: 37
4: 350
Right 1155236602 18:23826074-23826096 GTGCTGCTGTCAGGACGGCTAGG 0: 1
1: 0
2: 1
3: 18
4: 165
1155236596_1155236604 0 Left 1155236596 18:23826053-23826075 CCCTCTTCCCTCTGCAGATATGT 0: 1
1: 0
2: 11
3: 37
4: 350
Right 1155236604 18:23826076-23826098 GCTGCTGTCAGGACGGCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 102
1155236596_1155236603 -1 Left 1155236596 18:23826053-23826075 CCCTCTTCCCTCTGCAGATATGT 0: 1
1: 0
2: 11
3: 37
4: 350
Right 1155236603 18:23826075-23826097 TGCTGCTGTCAGGACGGCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155236596 Original CRISPR ACATATCTGCAGAGGGAAGA GGG (reversed) Intronic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
900931857 1:5742928-5742950 ACATCTCTCAAGAGGGGAGAGGG - Intergenic
902574927 1:17371832-17371854 AAATACCTGCAGAGGGCAGTTGG - Intergenic
903839784 1:26230362-26230384 AAATATATCCTGAGGGAAGAAGG + Intergenic
904349894 1:29898390-29898412 ACATCTCTGGAGAGGAAAGAAGG + Intergenic
904377972 1:30093755-30093777 GCATTTCTGCAGAGGGACGGTGG + Intergenic
905926621 1:41754608-41754630 ATATACCTTCAGAGGGAAAAAGG + Intronic
907275342 1:53313877-53313899 ACTCAGCTGCAGAGCGAAGATGG + Intronic
909602346 1:77473581-77473603 AGATTTCTCCAGAAGGAAGAAGG - Intronic
909772629 1:79442742-79442764 ACACAGACGCAGAGGGAAGATGG + Intergenic
911477913 1:98396566-98396588 AAATATCAGCACTGGGAAGAAGG - Intergenic
911860878 1:102946737-102946759 ACACATATGCAGAGAGAATACGG + Intronic
912166010 1:107043626-107043648 ACATATCTGCAGAGTCATGTAGG + Intergenic
913484505 1:119321684-119321706 AAATATCTACAGAGAGTAGATGG + Intergenic
914291395 1:146276956-146276978 ACATCTCTCCAAAGGGTAGAAGG + Intergenic
914552439 1:148727739-148727761 ACATCTCTCCAAAGGGTAGAAGG + Intergenic
915492107 1:156256472-156256494 TGATTTCTGCAGTGGGAAGAGGG - Intronic
916303823 1:163306280-163306302 GGATATCTTCAGAGGGAAAAAGG - Intronic
916963765 1:169914528-169914550 ACATATCTTCAGAATGAGGAAGG - Intergenic
917241855 1:172957029-172957051 ACATATCTGCATAACCAAGAAGG + Intergenic
918584025 1:186165021-186165043 GCATATCTTCCCAGGGAAGATGG + Intronic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
919292455 1:195650010-195650032 AGATATCTGCACAGGGAGCATGG + Intergenic
919354067 1:196499063-196499085 ACACATATGCAGAAGGAAGATGG + Intronic
919697276 1:200590690-200590712 ACATTTCTGGAGATGGATGATGG + Intronic
919880869 1:201899713-201899735 ACACATCTGTGGAGGCAAGACGG - Exonic
920251004 1:204622424-204622446 AAATAGCTGCAGAGGAAAGTGGG - Intronic
921148357 1:212380032-212380054 AGATTTCTGCAGAGAGAAAAAGG + Exonic
921882864 1:220274037-220274059 GCATTTCTTCAGATGGAAGAAGG - Intergenic
923251663 1:232184153-232184175 ACAGATAGACAGAGGGAAGAGGG + Intergenic
923540837 1:234886967-234886989 GCATTTCTGCAGAGGGGCGAGGG - Intergenic
923751251 1:236748114-236748136 AGAGATGTGCAAAGGGAAGATGG + Intronic
924703772 1:246481195-246481217 ACAGATCTGCAGAAGGAAGATGG - Intronic
1063095749 10:2907470-2907492 GCAGATCTGCAGAGGGGAGGGGG - Intergenic
1063263947 10:4424499-4424521 ACATATGTGCAGAGAGAAGGGGG - Intergenic
1063879471 10:10516687-10516709 ATAGATCTGGAGAGAGAAGATGG + Intergenic
1065634324 10:27715242-27715264 ACATCTCTGTAGAGAGGAGAGGG - Intronic
1065872588 10:29968349-29968371 AAACATCTGAAGAGGCAAGATGG - Intergenic
1067155734 10:43779867-43779889 ACATACCTGGAGAGAAAAGAGGG - Intergenic
1068130304 10:52888393-52888415 ACATGTCTGAAGAGAGAGGAAGG - Intergenic
1068177631 10:53482321-53482343 ACACAGATGCACAGGGAAGAAGG + Intergenic
1068428504 10:56900091-56900113 TCATGTCAGCAGAGGAAAGATGG - Intergenic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1070917460 10:80164005-80164027 AGGGATCTGCAGAGGGCAGAGGG + Intronic
1072033454 10:91542712-91542734 ACATTGCTGCAAGGGGAAGATGG + Intergenic
1072190230 10:93072242-93072264 AAATATCTGCAGAGGTCGGAGGG - Intergenic
1072323675 10:94275211-94275233 GTACAGCTGCAGAGGGAAGAGGG - Intronic
1072583794 10:96763869-96763891 ACAGAGCTGCATAGGGATGAAGG - Intergenic
1072683113 10:97520950-97520972 AGATATCTGCTATGGGAAGAAGG - Intronic
1072808879 10:98444738-98444760 ACATAACAGCACAGTGAAGAAGG + Intronic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1074548748 10:114423664-114423686 ACACATCAGCAGAGGCACGAGGG - Intergenic
1076299386 10:129413293-129413315 TCATCTCAGAAGAGGGAAGACGG + Intergenic
1077140503 11:1022202-1022224 ACAGGGCTGCAGAGGGCAGAGGG - Intronic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1077621925 11:3733196-3733218 TCATAGTTGCAAAGGGAAGAGGG - Intronic
1078109744 11:8382767-8382789 AGATATATGGGGAGGGAAGAAGG - Intergenic
1078339299 11:10487510-10487532 GCATATGTGCAGAAGGAAGATGG + Intronic
1078889547 11:15542110-15542132 ACATATGCGCAGATGGAAGAAGG - Intergenic
1080657111 11:34266780-34266802 ACATGTCTACAGAGGGCACAGGG - Intronic
1081265869 11:41020519-41020541 ACAGACATGCAGAGGGAAGATGG + Intronic
1083060787 11:59868858-59868880 ACATATCTGTTGATGGATGAAGG - Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1084402011 11:68949958-68949980 ACATATATGCATAGAAAAGATGG + Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1085056409 11:73406739-73406761 CCAGATCTGCAGAGGGAAAGGGG + Exonic
1085558744 11:77450424-77450446 CCATATTTGCAAAGGGAAGTAGG + Intronic
1086319511 11:85629877-85629899 ACATTTCTGGAGAGGGCAGGGGG - Intronic
1086532583 11:87803285-87803307 ACACATACTCAGAGGGAAGATGG - Intergenic
1086776790 11:90845783-90845805 AAATCTATGCAGAGGAAAGAAGG + Intergenic
1087204060 11:95375486-95375508 ACATATCTCCAGAAGGAACATGG + Intergenic
1088470577 11:110184535-110184557 GGAAATCGGCAGAGGGAAGAAGG + Intronic
1089022079 11:115226649-115226671 ACTTGTCTGCAGAGAGAGGACGG + Intronic
1089528322 11:119111035-119111057 ACCTCTCTGCAGAGAGAAGAAGG - Exonic
1090873901 11:130771830-130771852 ACACATCCCCAGAGGGAAGGAGG + Intergenic
1090908336 11:131096659-131096681 ACATCTCTTCTGAGGGGAGAAGG + Intergenic
1091694579 12:2619268-2619290 TCATATCTACAGAGGAATGAAGG + Intronic
1092672924 12:10883532-10883554 ACATATTTACAGATGAAAGAGGG - Intronic
1092676804 12:10929936-10929958 ACATATTTACAGATGAAAGAGGG + Intronic
1094337312 12:29374500-29374522 ACATATCTGCAGAGAGATCTGGG - Intronic
1095449074 12:42310503-42310525 ACATATCTGCATATGGAAGGGGG - Intronic
1096660139 12:53119082-53119104 ACATAACTGGAGAGGGATGCTGG - Intronic
1096816364 12:54204239-54204261 AGAATTCTGAAGAGGGAAGAAGG + Intergenic
1097059866 12:56274838-56274860 ACACAGCTGCAGAAGGAAGTTGG - Exonic
1097394298 12:59054878-59054900 ACACATATGCACAGGGACGAAGG + Intergenic
1097442801 12:59632126-59632148 ACATGCTAGCAGAGGGAAGATGG + Intronic
1097892165 12:64788160-64788182 ACATAGCTAGAGAAGGAAGAAGG + Intronic
1098994935 12:77108319-77108341 ACATATCAACTCAGGGAAGATGG + Intergenic
1099193735 12:79590042-79590064 ACATATTTTGAGATGGAAGAAGG + Exonic
1099831583 12:87850229-87850251 AAATACATGCAGAGGGATGAGGG + Intergenic
1100354758 12:93818624-93818646 AAATATCTGCAGAGGGGGCAAGG + Intronic
1100686762 12:96995029-96995051 ATATCTCTGCAGAGGGAGGAGGG - Intergenic
1102162946 12:110784055-110784077 ACCTATCTGCAGAGAGAAGAGGG - Intergenic
1103122813 12:118395115-118395137 AAATATCTGGAGAGGGAGAATGG + Intronic
1103214893 12:119194407-119194429 ACATCTGGGCAGAGGGCAGAAGG - Exonic
1104626456 12:130359759-130359781 AGAGATCTGCTGAGGGAACATGG + Intronic
1104729849 12:131098679-131098701 AGGTGACTGCAGAGGGAAGAGGG - Intronic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1107518718 13:41158525-41158547 ACATTCCTGGAGAGGGCAGAAGG + Intergenic
1108118427 13:47156497-47156519 ACTTACTTGCATAGGGAAGAAGG + Intergenic
1110694493 13:78472323-78472345 AGATGTCAGCAGAGGAAAGAGGG - Intergenic
1111155695 13:84321071-84321093 ACATCTCTGCAGAATGAATAGGG - Intergenic
1111580334 13:90214324-90214346 AGAAAACTGCAGAGGCAAGAAGG + Intergenic
1112179011 13:97058283-97058305 ACAAATCTGCAGATTGAAGCAGG - Intergenic
1112223286 13:97513360-97513382 AGATCTCTGCACAGGAAAGATGG + Intergenic
1112854161 13:103745841-103745863 TCATGTTTGCAAAGGGAAGAGGG + Intergenic
1112857940 13:103793606-103793628 ACATTTCTGGGGAGGGAAGTAGG - Intergenic
1114522307 14:23347207-23347229 TCAGATCTGCAGAAGCAAGAGGG + Exonic
1117246133 14:53888649-53888671 ACATATCTGCTGAGTGTAAATGG - Intergenic
1118062276 14:62152541-62152563 CCATGTCTGCAGGGGAAAGAAGG - Intergenic
1119118502 14:72050605-72050627 ATATATCTGAAGAGGACAGAGGG + Intronic
1120009731 14:79399971-79399993 ACACATATGCACAGGGAAGAAGG - Intronic
1121647331 14:95527885-95527907 GTCTATCTGGAGAGGGAAGAAGG + Intergenic
1122927760 14:104915663-104915685 ACATATCTGTTGGAGGAAGACGG + Intergenic
1202917314 14_GL000194v1_random:188231-188253 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1124592480 15:31065611-31065633 ACATATCTGGAGAGGGCTGCAGG - Intronic
1126306333 15:47262433-47262455 GCATATCTTCACAGGGAAGCAGG + Intronic
1126947260 15:53835496-53835518 ATATGTCTGAAAAGGGAAGAGGG + Intergenic
1129617688 15:77112739-77112761 AAATATGTGCCAAGGGAAGAAGG + Exonic
1131285625 15:91054552-91054574 ATATAACTGGAGAAGGAAGAGGG - Intergenic
1131642124 15:94303909-94303931 AGAAATCTGTAGAGAGAAGAAGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134046471 16:11104608-11104630 ACTTCTCTCCAGAGGGAGGAAGG + Intronic
1134274172 16:12760884-12760906 ACATGTCTGCAAATGGAAGCAGG - Intronic
1134893910 16:17866650-17866672 ATATAGCGGGAGAGGGAAGAAGG - Intergenic
1135039873 16:19110071-19110093 AGAAATATGCACAGGGAAGAAGG + Intergenic
1135049013 16:19177427-19177449 AGAAATCTGTAAAGGGAAGATGG + Intronic
1135054328 16:19218483-19218505 TTGTATCTGCAAAGGGAAGAAGG + Intronic
1135556455 16:23440985-23441007 ATATATATGGAGAGGGAAAAAGG + Intronic
1135615571 16:23908222-23908244 ACAGTGCTGCAGAGGGAAAAAGG + Intronic
1136317915 16:29465083-29465105 CCATATCTGGGGAGGGGAGAAGG + Exonic
1136432490 16:30204432-30204454 CCATATCTGGGGAGGGGAGAAGG + Exonic
1136579210 16:31141844-31141866 ATGAGTCTGCAGAGGGAAGAAGG + Exonic
1137381498 16:48003557-48003579 GCCTGTCTGCAGAGGGAAGGAGG + Intergenic
1137390545 16:48077646-48077668 AAATATCTGGAGACGGATGATGG + Intergenic
1138040241 16:53655989-53656011 ACATATCTGCAAAGAGCAGGTGG + Intronic
1138391048 16:56670072-56670094 ACATAGAGGCACAGGGAAGAGGG - Intronic
1139353845 16:66355224-66355246 ATAGAATTGCAGAGGGAAGAGGG + Intergenic
1139558510 16:67727625-67727647 CCAGGTCTGCAGAGGGAAGTGGG - Intronic
1139955481 16:70691140-70691162 ACAAGTTTGCAGAGGGAAGCTGG - Intronic
1140575313 16:76160757-76160779 AAATATCTGAAGGTGGAAGATGG + Intergenic
1140830782 16:78748715-78748737 AAATAACTGCAGAGGGAATGAGG - Intronic
1141393093 16:83680948-83680970 GCACATCTGTAGAGGGAAGAGGG + Intronic
1141514324 16:84533391-84533413 ACATATATGCAGCTGGAATACGG + Intronic
1141829883 16:86504319-86504341 ACCTATCTGCAGTGGGCAGAGGG - Intergenic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143639329 17:8186666-8186688 ACCTCTCAGCAGAGGGACGAGGG + Intergenic
1144766650 17:17736720-17736742 ACATTTCTGGAGATGGGAGAGGG + Intronic
1145058740 17:19719339-19719361 TCATGTCAGCAGATGGAAGAAGG + Intergenic
1146300653 17:31686422-31686444 ACATTCCTTCAGAGAGAAGAGGG + Intergenic
1146499379 17:33351470-33351492 ACACATCTGATGAGAGAAGATGG - Intronic
1147664516 17:42138183-42138205 GTATATCTGCAGAGGAAAGGGGG + Intronic
1149503385 17:57172372-57172394 ATTTAACTGCAGAGGGAAGAGGG + Intergenic
1151601744 17:75110178-75110200 ACCTGTCTGGAGAGGGAAGAGGG - Exonic
1151803960 17:76393993-76394015 TCAGCTCTGCTGAGGGAAGATGG - Intronic
1152333631 17:79687279-79687301 ACGCATTTGCAGAGGGAAAAGGG + Intergenic
1152384833 17:79966184-79966206 ACCCATATACAGAGGGAAGAAGG - Intronic
1155236596 18:23826053-23826075 ACATATCTGCAGAGGGAAGAGGG - Intronic
1155488822 18:26377446-26377468 TCATATATGCAGAGTTAAGAAGG - Intronic
1156600631 18:38601705-38601727 ACATATGTGCAGAGGCAAGTTGG + Intergenic
1157750987 18:50178138-50178160 ACATCTCTGCTGTGGGGAGAGGG + Intronic
1160064931 18:75565787-75565809 GCATCTCTGCAGAGGGAATTCGG - Intergenic
1160187257 18:76685496-76685518 ACAGATCTGGAGAGGGGATATGG - Intergenic
1161026481 19:2039585-2039607 ACCTATGTACAGAGGGGAGATGG + Exonic
1162327635 19:10008231-10008253 ACCTCTCTGCAGAGGAAAGAGGG + Intronic
1163345198 19:16736818-16736840 ACTGATCAGCAGAGGGAAGTAGG + Intronic
1163562970 19:18031565-18031587 ACACAGCTGCAGAAGGAAGTTGG + Intergenic
1164074140 19:21798253-21798275 AAATATCTGAAGAGAGAAAATGG + Intergenic
1164490749 19:28711766-28711788 AGATATCTGCGGAGGGAAGGGGG + Intergenic
1164493578 19:28736752-28736774 AGATATTTGCAGGCGGAAGAGGG - Intergenic
1164545422 19:29157693-29157715 AGAGATCTGCAGAGGCAAGACGG - Intergenic
1165133437 19:33647888-33647910 AGATAGCTGCTGAGGGAAGAGGG + Intronic
1165312191 19:35035133-35035155 GCAAATCTGCAGAGGTGAGATGG + Intronic
1166387196 19:42389034-42389056 ACATAGCTGCAGAGGTGGGAGGG + Exonic
1166654259 19:44598829-44598851 CCATCTCTACAGAAGGAAGAAGG - Intergenic
1167409539 19:49336915-49336937 CCAGATCTGCAGAGGCACGAAGG - Exonic
1167615649 19:50531431-50531453 ACCCAGCTGCAGAGGGAAGGGGG + Intronic
1168335520 19:55595223-55595245 ACAGATCTGAAGAAGGAACAGGG + Intronic
925298896 2:2795968-2795990 ACAGATCAGCAGAGGGAGGGAGG - Intergenic
925367543 2:3321046-3321068 ACATATCTGAACAGGGCAGGAGG + Intronic
928269046 2:29838816-29838838 ATATATCTCAATAGGGAAGAGGG + Intronic
928483369 2:31706095-31706117 AAATCTCTACAGAGGGAAGGAGG - Intergenic
928950760 2:36811179-36811201 TCATATCAGCAGATTGAAGACGG + Intronic
929986868 2:46743134-46743156 ACATATATGCAGTGGAAGGAGGG - Intronic
930207537 2:48603007-48603029 ACAGAACTGAAGAGGGTAGAAGG - Intronic
930238465 2:48910347-48910369 ACTTCCCTGCAGAGGGATGATGG + Intergenic
932659523 2:73640308-73640330 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932666087 2:73699979-73700001 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932925987 2:75975133-75975155 AATCATCAGCAGAGGGAAGAGGG + Intergenic
933277757 2:80301976-80301998 ACAGATCTTCAAAGGGAGGAAGG + Exonic
933610986 2:84435079-84435101 ACAAGTCTGGAGAGGGAAGCTGG - Intronic
933991721 2:87638818-87638840 AGAAAGCTGCAGATGGAAGATGG - Intergenic
934474591 2:94586042-94586064 AAAAATCTGCAGAGGGAAGAGGG + Intergenic
934604804 2:95686655-95686677 AAATATTTGCAGAGGGAGTATGG - Intergenic
934901769 2:98165526-98165548 ACAGAGGTGCAGAGGGCAGAGGG + Intronic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
936302124 2:111312000-111312022 AGAAAGCTGCAGATGGAAGATGG + Intergenic
936517767 2:113193031-113193053 TCATTGCTGCAGAGGGAAAAGGG - Exonic
938191195 2:129282317-129282339 ACATATTTGATGAGGGAGGAGGG + Intergenic
939563300 2:143756793-143756815 ATATATCTGCACAGATAAGAAGG - Intronic
940033568 2:149289855-149289877 AAAAATATGCAAAGGGAAGAGGG + Intergenic
940276941 2:151949503-151949525 ACACATATGCAAAGGCAAGAAGG + Intronic
941694573 2:168537272-168537294 AATTATCTGCAGAGGGAAAATGG - Intronic
941694728 2:168538772-168538794 AATTATCTGCAGAGGGAAAATGG - Intronic
941918606 2:170828317-170828339 AGATGACAGCAGAGGGAAGAGGG - Intronic
942468772 2:176237917-176237939 ACATGTCTGCAAAGGGAGAAAGG + Intergenic
943070604 2:183136535-183136557 CTATATCTGAAGATGGAAGATGG - Intronic
943819068 2:192295702-192295724 TCATATCTGCAGAAGGAATAGGG + Intergenic
944646723 2:201787568-201787590 ACATAACTGCAAAGGCAAGGAGG + Intergenic
944696950 2:202210230-202210252 ATATCTCTATAGAGGGAAGATGG + Intronic
945225361 2:207528125-207528147 ACATAAGACCAGAGGGAAGAGGG + Intergenic
947139523 2:227008375-227008397 ACGTATCTGCAAAGGCCAGATGG - Intronic
947393636 2:229665757-229665779 CCATCTTTGCATAGGGAAGAAGG + Intronic
947743013 2:232493498-232493520 ACAGCTCTGCAGAGGGCAGCAGG + Intergenic
947978154 2:234385483-234385505 AGATGCGTGCAGAGGGAAGATGG - Intergenic
948703436 2:239775045-239775067 ACATAGAAGCAGAGGGAAGGGGG + Intronic
1169241956 20:3989602-3989624 ACATGTGTGCAGAAGGAAGATGG - Intronic
1169413189 20:5392260-5392282 TCAACTATGCAGAGGGAAGAGGG - Intergenic
1169539280 20:6581613-6581635 AGATATCTTCAGTGGGAAGAAGG - Intergenic
1170446444 20:16432654-16432676 AAATATCTGCAGAGGCCTGAGGG - Intronic
1170522186 20:17198283-17198305 ACATATTTTCGGAGGGAAGCAGG - Intergenic
1170615802 20:17949576-17949598 ACATAAGTGCAGAGTGAAAATGG + Intronic
1170926707 20:20731245-20731267 ACACATATGCAGAGGGACGTGGG + Intergenic
1171288131 20:23959779-23959801 ACGTATTTGCATAGGGCAGAAGG + Intergenic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1173644720 20:44626258-44626280 ACATAACGGCAAAGGGAGGATGG + Intronic
1173788346 20:45811574-45811596 ACAAATGGGCAAAGGGAAGACGG - Intergenic
1174273577 20:49387108-49387130 TGATCCCTGCAGAGGGAAGAGGG + Intronic
1175275037 20:57762586-57762608 GCAAATCTCCAGAGGGAGGAAGG - Intergenic
1175296820 20:57914202-57914224 TCACCTCTGCAGAGGGATGATGG - Intergenic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1176074586 20:63242753-63242775 ACATGACAGCAGAGGGAACATGG + Intronic
1176254434 20:64143601-64143623 CCAGCTCTGCAGAGGGAACATGG - Intergenic
1176636762 21:9252333-9252355 TCATACCTTCAGAGGGTAGAGGG + Intergenic
1178548982 21:33519206-33519228 ACACATGTGCAGATGCAAGATGG + Intronic
1178890864 21:36520183-36520205 ACAGACCCACAGAGGGAAGACGG - Intronic
1179472335 21:41620066-41620088 ACTTGTCTCCAGAGGGAAGGAGG + Intergenic
1183013924 22:34970487-34970509 ACACAGCTGCACAGGAAAGAAGG + Intergenic
1183196978 22:36360299-36360321 AGCAATTTGCAGAGGGAAGAGGG + Intronic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1184355945 22:43979660-43979682 ACACATCTGCAGTGTGGAGAAGG - Intronic
1184438826 22:44496708-44496730 ACACGTCTGGAGAGGCAAGAAGG + Exonic
949618918 3:5788036-5788058 AAATAACTGCAGAGGGAGGGAGG - Intergenic
950720712 3:14880725-14880747 ACGTATCTGCAGAGGGAAAGAGG - Exonic
952120083 3:30231934-30231956 ACATCTGTGGAGAGGAAAGATGG - Intergenic
953274633 3:41482763-41482785 ACTTGTCTGCAGAGAGAGGAAGG - Intronic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954578168 3:51688239-51688261 GCAAACCTGCAGAGGGGAGATGG + Intronic
954750513 3:52810910-52810932 ACATCTATGCAGTGGGGAGAAGG + Intergenic
955877195 3:63504434-63504456 ACAAACCTGCAGAGTGAAGAAGG - Intronic
955914536 3:63893498-63893520 ACATATTTGGAGAGAGCAGAGGG + Intronic
956193586 3:66630470-66630492 ACATTTCTGCTGAGGGTTGATGG + Intergenic
957103998 3:75862932-75862954 TCATACCTTCAGAGGGTAGAGGG - Intergenic
957935840 3:86941106-86941128 ACATATATTTAAAGGGAAGATGG - Exonic
958814303 3:98899911-98899933 ACATCTCTACAGTGGAAAGAAGG + Intronic
958984178 3:100761352-100761374 ACATATGTGCACAGGGAAGGGGG - Intronic
959241894 3:103807864-103807886 ACAGATCTTCAGAGGGAAAGTGG + Intergenic
959489039 3:106965157-106965179 ATACATGTGCAGAGGTAAGAAGG + Intergenic
959576778 3:107942937-107942959 ACATATCTGCAGAAGAAAAAAGG - Intergenic
960356812 3:116663814-116663836 ATAGAAATGCAGAGGGAAGAAGG + Intronic
960554042 3:119007904-119007926 ATATATTTTCTGAGGGAAGAAGG - Intronic
961736977 3:129008445-129008467 ACATATTTGTAGATGGAAGAGGG + Intronic
963541675 3:146598773-146598795 TCCTTTCTGCAGATGGAAGATGG + Intronic
964487209 3:157198317-157198339 AAAAACCTTCAGAGGGAAGAGGG - Intergenic
964883995 3:161459254-161459276 AGATATCTGCATCAGGAAGAGGG + Intergenic
965259992 3:166469707-166469729 AACTATCTGAGGAGGGAAGAGGG - Intergenic
967290416 3:187914428-187914450 ACATATCTGGTGAGGGAAGAAGG + Intergenic
968289226 3:197525864-197525886 ACAGACCTGCAGAGGGAGCACGG - Intronic
1202750133 3_GL000221v1_random:152686-152708 TCATACCTTCAGAGGGTAGAGGG - Intergenic
968662005 4:1802543-1802565 ACATCTGTTCAGAGAGAAGACGG + Intronic
968869714 4:3235548-3235570 ACACATCTGCACAGGGAGAAAGG - Exonic
969610574 4:8225683-8225705 ACAGAGCTGTAGAGGGGAGATGG - Intronic
971413531 4:26400896-26400918 ATAAATCTTCAGTGGGAAGATGG + Intronic
971454413 4:26830543-26830565 AGATAACTGCAGAGGTCAGACGG - Intergenic
972604139 4:40598777-40598799 ACATATGAGCAGAGGACAGATGG - Intronic
972613504 4:40676640-40676662 ACTTAACAGCAGACGGAAGATGG - Intergenic
972632168 4:40851827-40851849 ACAATTCTGCAGCTGGAAGAAGG + Intronic
973297061 4:48536064-48536086 ACAGATCTTCAGACTGAAGAAGG - Intronic
974117539 4:57598610-57598632 ATAATACTGCAGAGGGAAGATGG - Intergenic
974554948 4:63434307-63434329 ACTTGTATGCAGATGGAAGATGG + Intergenic
975428127 4:74254242-74254264 TCAAATCTGCAGAGGGAAATGGG + Intronic
975686818 4:76924397-76924419 CCATATCTGGGGAGGGGAGAGGG + Intergenic
976047019 4:80962319-80962341 ACATATCTGTATAGGGAATAAGG + Intronic
976486016 4:85606014-85606036 AAATAACTCCAGTGGGAAGAAGG - Intronic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
977494789 4:97761339-97761361 ACAAACGTACAGAGGGAAGATGG + Intronic
977498185 4:97803195-97803217 ATATATATGGAGGGGGAAGAGGG + Intronic
979073667 4:116242961-116242983 ATATACCTGCAGATGGTAGAGGG + Intergenic
979092961 4:116510220-116510242 ACATATCTGTAGATGGAAACAGG + Intergenic
979561484 4:122106863-122106885 AAATATCTGCAGAGGCCACAAGG - Intergenic
981010747 4:139922401-139922423 ACATACAGGCAGAGAGAAGAAGG + Intronic
981901479 4:149870204-149870226 GCAGATGTACAGAGGGAAGACGG - Intergenic
982079980 4:151779704-151779726 AGATCTCTACAGAGGAAAGAAGG + Intergenic
982992834 4:162300974-162300996 AAAAATCTGCAGATTGAAGAGGG + Intergenic
983372479 4:166879111-166879133 ATATATATGCAGAGTGTAGATGG + Intronic
983491802 4:168398134-168398156 CCAAACCTGCAGAGGGAAGGGGG - Intronic
984315299 4:178122065-178122087 CTATATCTCCAGAAGGAAGAGGG + Intergenic
985289049 4:188368375-188368397 ATATTTCTGCAAATGGAAGATGG + Intergenic
1202751650 4_GL000008v2_random:10775-10797 TCATACCTTCAGAGGGTAGAGGG + Intergenic
987019986 5:13860290-13860312 ACATTACTGCAAAGGGAAGCTGG - Intronic
987127350 5:14826882-14826904 ACCTAACTGCAGAGGGACGTGGG - Intronic
987207214 5:15640218-15640240 ACAGATCCTCAAAGGGAAGACGG - Intronic
988352141 5:30122631-30122653 ACATATATGCAGAGAGAGCAAGG - Intergenic
989081777 5:37630418-37630440 ACATGTCTTGGGAGGGAAGAGGG + Intronic
993989972 5:94644161-94644183 ACAGAAGTGCAGAGGAAAGATGG - Intronic
996318887 5:122191862-122191884 ACCTCACTGCAGAGGGAAGTTGG + Intergenic
996480307 5:123968570-123968592 ACATGTATGGAGAGGGAAGAAGG - Intergenic
997608594 5:135194235-135194257 ATTTATCTGGAGAGGAAAGAAGG + Intronic
997620849 5:135292717-135292739 CAATATCTGCAGAAGGCAGATGG + Intronic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
999116120 5:149164716-149164738 TCATATTTGGAGAGGGAGGAGGG + Intronic
999644341 5:153703125-153703147 TCATATCTAGAGAGGGAAGGTGG - Intronic
1001278994 5:170372453-170372475 CAACCTCTGCAGAGGGAAGAGGG - Intronic
1003337132 6:5184838-5184860 AGATATCAGCAGAGAAAAGAGGG + Intronic
1003605401 6:7555534-7555556 ACATCTATGGAGAGGGGAGAAGG + Intronic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1004782122 6:18920851-18920873 ACACCTCAGCAGAGGCAAGAAGG - Intergenic
1005395897 6:25381846-25381868 CCATTTCTGGGGAGGGAAGAAGG - Intronic
1006698064 6:35948709-35948731 ACATATCAGTAGGGGAAAGAAGG + Intronic
1007762081 6:44139097-44139119 AAATATCTGAGGAGGGAGGAAGG - Intronic
1009934126 6:70213221-70213243 ACATAGCTGGAGAGAGAACAAGG - Intergenic
1010290680 6:74133195-74133217 ACATATCTCATGAAGGAAGATGG - Intergenic
1010311411 6:74390055-74390077 ACCTATCTGCAAAAAGAAGACGG - Intergenic
1010389620 6:75321842-75321864 ACATATCTAAAGAGAGAAAAAGG + Intronic
1010748055 6:79586795-79586817 TCATATTTGCAGTGTGAAGAAGG - Intergenic
1010753769 6:79643764-79643786 ACATATCTATAGGAGGAAGACGG - Intronic
1010939091 6:81894930-81894952 ACAGAACTGGAGAGGAAAGACGG + Intergenic
1011057175 6:83217913-83217935 ACATTTAGGCAGAGGTAAGATGG + Intronic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1013508865 6:110826639-110826661 ACACAAATACAGAGGGAAGACGG - Intronic
1013724489 6:113076848-113076870 AGGTATCTACAGAGGGATGAAGG + Intergenic
1013889982 6:115014671-115014693 ACTTATCTTTAAAGGGAAGAGGG + Intergenic
1014600973 6:123411698-123411720 AGATACCTGCAGATGGTAGAGGG - Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1024038061 7:45525490-45525512 ACACATGTGCAAAGGGAAAAAGG + Intergenic
1024397870 7:48889886-48889908 ACCTACCTGCACTGGGAAGATGG + Intergenic
1024544810 7:50508326-50508348 ACATTTGTGCAGGGGGAAGGAGG + Intronic
1027997488 7:85443599-85443621 ACATATAAACACAGGGAAGAAGG + Intergenic
1029054868 7:97731823-97731845 TCAGATCTGCAGACGGAAGCAGG + Intergenic
1029413474 7:100429560-100429582 ACATAGCTGCGCAGGGAAGTAGG + Intronic
1030789685 7:113708283-113708305 GCATATCTGCAGAGTGCAGTTGG - Intergenic
1033008695 7:137595694-137595716 ACATATCTGCTGAGTAAAGAAGG + Intronic
1033321968 7:140347887-140347909 ACATATCTGCTGAGGATAAAGGG - Intronic
1034099955 7:148442557-148442579 ATATATCTGCAGGCGGAAGGAGG + Intergenic
1034167891 7:149039634-149039656 ACAGACATACAGAGGGAAGATGG + Intergenic
1035094932 7:156346409-156346431 ACACATCAGCAGAAGGAAGCAGG + Intergenic
1038073300 8:24042429-24042451 ACATATTTCCAGAAGGCAGAAGG - Intergenic
1038389433 8:27181182-27181204 ATATATCTGCAGGCTGAAGATGG - Intergenic
1039263082 8:35794206-35794228 ACACATTTACAGAGGGCAGAGGG - Intronic
1041600977 8:59717105-59717127 ATATATCTGCATATGTAAGAGGG - Intergenic
1043781027 8:84335284-84335306 AAACATCAGCAGAGAGAAGATGG - Intronic
1044910158 8:97049263-97049285 AAATATCTGCTGAAGGAAGGAGG - Intronic
1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG + Intergenic
1046393089 8:113602486-113602508 CCATATATGCAGAGAGCAGAAGG - Intronic
1047663326 8:127062375-127062397 AGACATGTACAGAGGGAAGATGG - Intergenic
1050064192 9:1741640-1741662 AAATTTCTGGAGAGGGAAGGAGG + Intergenic
1050119238 9:2291282-2291304 ATATATCCACAGAGGGAAAAGGG - Intergenic
1050295182 9:4197231-4197253 GCATCTCTGCATAGGGAAGGTGG - Intronic
1050679376 9:8092222-8092244 ACATATATGTAGACAGAAGATGG - Intergenic
1050909079 9:11043635-11043657 ACATATCTGAAGAGGGTGGACGG - Intergenic
1051589036 9:18757514-18757536 ACAGATGCGCAGAGGGATGAAGG - Intronic
1052014172 9:23445708-23445730 ACATGACTTCAAAGGGAAGAGGG - Intergenic
1052926371 9:34020231-34020253 ACAGATGTGGAGATGGAAGACGG - Intronic
1053683477 9:40500059-40500081 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1053933457 9:43128374-43128396 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054280238 9:63124869-63124891 AAAAATCTGCAGAGGGAAGAGGG + Intergenic
1054296581 9:63335557-63335579 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054394598 9:64640062-64640084 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054429247 9:65145261-65145283 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054501137 9:65876274-65876296 AAAAATCTGCAGAGGGAAGAGGG + Intergenic
1055394631 9:75861032-75861054 ACATGTCCACAGAGAGAAGAGGG - Intergenic
1057280522 9:93708077-93708099 CCATGACTGCAGGGGGAAGAAGG + Intergenic
1058538580 9:105989214-105989236 GCATATCAGCAGAGGGACTATGG - Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1061484148 9:130911883-130911905 AAACACCTGCAAAGGGAAGATGG + Exonic
1061723250 9:132566777-132566799 ACAGATCCGCAGAGGCCAGAGGG - Intronic
1062003235 9:134227166-134227188 ACATAGCTGCAGTGGGCAGGGGG + Intergenic
1203718775 Un_KI270742v1:182776-182798 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1203653003 Un_KI270751v1:146450-146472 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1186792703 X:13014429-13014451 ACTTATCTGCAGAAGGATAAGGG - Intergenic
1186816258 X:13240872-13240894 CCATCTCTGTAGAGGGAAGTGGG + Intergenic
1186977142 X:14919655-14919677 ACTGAGCTGAAGAGGGAAGAGGG - Exonic
1188004962 X:25010873-25010895 ACATACCTGCAGAGGGTAATGGG - Intronic
1188998076 X:36910492-36910514 AAATCTCTGGACAGGGAAGATGG - Intergenic
1189345533 X:40238373-40238395 ACATATGTGCAGAAAGAAAATGG - Intergenic
1192334174 X:70203793-70203815 ACATAAAGACAGAGGGAAGAAGG + Intronic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1193031802 X:76906858-76906880 AAATATTTGCACAGGAAAGATGG - Intergenic
1198063351 X:133070173-133070195 ACAAATATGAAGAGGGTAGAAGG + Intronic
1198130451 X:133689066-133689088 ACATATTTTCAGAGAGAATAAGG - Intronic
1198442694 X:136679346-136679368 ACATATTTGCAGATGGACAATGG + Intronic
1199155799 X:144547649-144547671 ACACGACTGCACAGGGAAGAGGG + Intergenic
1202174121 Y:22081840-22081862 AGGTTTCTGCAGAGGAAAGAAGG + Intronic
1202217239 Y:22504542-22504564 AGGTTTCTGCAGAGGAAAGAAGG - Intronic
1202325947 Y:23691517-23691539 AGGTTTCTGCAGAGGAAAGAAGG + Intergenic
1202544824 Y:25978537-25978559 AGGTTTCTGCAGAGGAAAGAAGG - Intergenic