ID: 1155236761

View in Genome Browser
Species Human (GRCh38)
Location 18:23827603-23827625
Sequence CTGAACTATCTGATTTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155236758_1155236761 14 Left 1155236758 18:23827566-23827588 CCTGGAAGAATTTCTCAGAGGTG 0: 1
1: 0
2: 0
3: 20
4: 184
Right 1155236761 18:23827603-23827625 CTGAACTATCTGATTTAGGGTGG 0: 1
1: 0
2: 1
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155236761 Original CRISPR CTGAACTATCTGATTTAGGG TGG Intronic
903375994 1:22866310-22866332 CTGATCTTTCTGATGTAGGGTGG + Intronic
904120746 1:28196159-28196181 CTGAAGATTCTGATTCAGGGTGG - Intergenic
911828698 1:102522784-102522806 CTGAGATAACTGATTTAGGAGGG + Intergenic
912262006 1:108120031-108120053 ATGAAATTTCTGATTTGGGGTGG - Intergenic
919839469 1:201598523-201598545 CGGAACTGCCTGAGTTAGGGTGG + Intergenic
1064947792 10:20811375-20811397 CTGATTTATCTCACTTAGGGTGG - Intronic
1066567064 10:36731955-36731977 CTGAATTATCATATTTAGGTGGG + Intergenic
1066987318 10:42479539-42479561 CTGAGCTTTCTGCTTTTGGGAGG - Intergenic
1069295566 10:66839944-66839966 TTGAAGTATCTGATTTGGGGTGG + Intronic
1071712650 10:88064793-88064815 CTGAACTCTCTGGTTTGGGAAGG - Intergenic
1072289587 10:93951922-93951944 ATGACCTATCTGATTAGGGGTGG + Intronic
1077943566 11:6870495-6870517 GTGAATTATTTGATTTAGGCCGG - Exonic
1078137259 11:8661799-8661821 TGGAACTTTCTGATTTAAGGGGG - Intronic
1084532059 11:69733160-69733182 CTGAAATATCTGCTTAAAGGAGG - Intergenic
1087938731 11:104066925-104066947 TTGAAATATATGACTTAGGGTGG - Intronic
1089833772 11:121351992-121352014 CTGTGCTATATGATTCAGGGTGG - Intergenic
1094475167 12:30835191-30835213 CTGAATTATCATTTTTAGGGAGG - Intergenic
1095543062 12:43333229-43333251 TTGAACAATTTTATTTAGGGTGG - Intergenic
1099484769 12:83215502-83215524 ATGATCTTTCTGATTTAGAGTGG - Intergenic
1100977831 12:100141110-100141132 TTGAACTATCTTATTTTGGAAGG - Intronic
1109084047 13:57947318-57947340 CTGAACTTTCTGATTTATCAGGG + Intergenic
1109367714 13:61378198-61378220 CTGAACAATCTGATAGATGGTGG + Intergenic
1110754631 13:79158004-79158026 CTGAACTTTCTTTTTTAAGGGGG - Intergenic
1114005092 14:18303599-18303621 CTGAATTATCATATTTAGGTGGG + Intergenic
1115139951 14:30159396-30159418 CTGAAATAACTGCTATAGGGAGG + Intronic
1121065391 14:90959132-90959154 CAGAAGTAACTGAATTAGGGGGG + Intronic
1121116872 14:91349968-91349990 CAGCACTTTCTGACTTAGGGTGG + Intronic
1121200301 14:92111327-92111349 CTGAACTATCAGCTTTTGAGGGG + Intergenic
1121200450 14:92112496-92112518 CTGAACTATCAGCTTTTGAGGGG - Intergenic
1123389550 15:19855835-19855857 CTGAATTATCATATTTAGGTGGG + Intergenic
1130797548 15:87226008-87226030 CTAATATATCTGATTTATGGGGG - Intergenic
1130943866 15:88535923-88535945 CTGAACTTCCTGAATTTGGGGGG - Intronic
1135458137 16:22616769-22616791 GTGAAATTTCTGATTTAGGTTGG + Intergenic
1135591619 16:23709080-23709102 CTTAAGTATATGATTTAGGAAGG - Intronic
1139595217 16:67953953-67953975 CTGAATCTTCTGATTTGGGGGGG - Intronic
1153568890 18:6448212-6448234 AAGAACCATCTGATTCAGGGTGG - Intergenic
1154532332 18:15360263-15360285 CTGAATTATCATATTTAGGTGGG - Intergenic
1155108574 18:22691017-22691039 CAGAACTCTCCTATTTAGGGTGG - Intergenic
1155236761 18:23827603-23827625 CTGAACTATCTGATTTAGGGTGG + Intronic
1157612439 18:48966247-48966269 CTGAACTATATGCTTTAAGATGG + Intergenic
1159154655 18:64568071-64568093 CTTAATTATCTCATTTTGGGGGG + Intergenic
1159818429 18:73107578-73107600 CTTAAATATCTCATTTTGGGTGG + Intergenic
1162841866 19:13362665-13362687 CTGAATTTTCATATTTAGGGGGG + Intronic
926993205 2:18702627-18702649 CTCAAAAATTTGATTTAGGGTGG - Intergenic
928828654 2:35451488-35451510 CTGGATTATCTTATGTAGGGGGG - Intergenic
929337285 2:40764298-40764320 CTGAAGTTGCTGATTTTGGGGGG + Intergenic
930348644 2:50220274-50220296 CTGAATTCTCTGAACTAGGGTGG + Intronic
930720595 2:54633892-54633914 CTGAACTATATGTTCTAGGGTGG + Intronic
932163696 2:69486359-69486381 GTAAACTGCCTGATTTAGGGGGG + Intronic
938531430 2:132191491-132191513 CTGAATTATCATATTTAGGTGGG - Intronic
938589913 2:132726578-132726600 TGGAACTATCTGGCTTAGGGAGG - Intronic
942901185 2:181121141-181121163 CTAAACTATTTGATTAAGTGTGG + Intergenic
945418861 2:209609374-209609396 CTGAACTATTTAATTTAAAGGGG - Intronic
946849851 2:223895194-223895216 TTGAAATATCTGATTAAGGCAGG - Intronic
948369440 2:237478789-237478811 CTCAACTATCAGAGGTAGGGTGG - Intergenic
1173122879 20:40309793-40309815 CTGGACTCTCTGATGGAGGGCGG + Intergenic
1175060570 20:56238545-56238567 CTGACCTATCTGCTTCAGGAAGG + Intergenic
1175475071 20:59266671-59266693 CTGAACTATATGCTTAAGAGTGG - Intergenic
1176765028 21:13007938-13007960 CTGAATTATCATATTTAGGTGGG + Intergenic
1180429605 22:15234391-15234413 CTGAATTATCATATTTAGGTGGG + Intergenic
1180512216 22:16102732-16102754 CTGAATTATCATATTTAGGTGGG + Intergenic
1181435514 22:22908184-22908206 CTGAACCACATGATTGAGGGAGG - Intergenic
955790372 3:62582873-62582895 CTGAACTACCTGATTTGGATTGG - Intronic
956792209 3:72688781-72688803 CTGACCTTTCTGATTTAGGGGGG - Intergenic
958533572 3:95366243-95366265 CCTAACAATGTGATTTAGGGTGG + Intergenic
959177890 3:102940119-102940141 CTGTACTATCTGATTTGGTGTGG + Intergenic
959512449 3:107229387-107229409 CTGATCATTCTCATTTAGGGTGG - Intergenic
963626301 3:147678331-147678353 GTCACCTCTCTGATTTAGGGAGG - Intergenic
963785931 3:149534444-149534466 CTGAACTGTCTGAGGTAGAGGGG - Intronic
963798637 3:149656525-149656547 CTGGACTATCTGACTTAGAGTGG + Intronic
963861490 3:150314984-150315006 CTGAACTCTGTGATTGAGAGGGG + Intergenic
964083285 3:152786062-152786084 CTGAATTATTGGCTTTAGGGTGG - Intergenic
967781063 3:193440070-193440092 ATGATTTTTCTGATTTAGGGTGG + Intronic
968732659 4:2277121-2277143 CTGAACTGTGTGATTTAGAAAGG + Intronic
968846929 4:3048520-3048542 CTGATCTATTTGATTTGGGGTGG - Intergenic
969967689 4:11014054-11014076 TTGAAATTTCTGATTTTGGGGGG + Intergenic
970397476 4:15683384-15683406 ATGAACTGTCTGATTTAGGAGGG + Intronic
971705139 4:30031875-30031897 CAATACTATCTTATTTAGGGTGG + Intergenic
974122854 4:57660920-57660942 CTGATCTTTCTGATTTTGTGTGG + Intergenic
976151268 4:82094666-82094688 CTTAAGTATCTGATTTAGAGAGG + Intergenic
978908725 4:114040742-114040764 CTGAAGTTTCTGTTTCAGGGTGG - Intergenic
982338223 4:154264757-154264779 TTGAACTATCTCCTTTAGTGAGG - Intronic
983203343 4:164885990-164886012 TTAAACTAACTGAATTAGGGTGG - Intronic
983391462 4:167136138-167136160 CTGAACCTCCTGATTTGGGGTGG - Intronic
987012243 5:13779446-13779468 CTGACCTGTCTCATTGAGGGAGG - Intronic
992367367 5:76106310-76106332 CTGAACTACCTGAATTACTGAGG + Intronic
996992199 5:129648926-129648948 CTGAAGTATATGCTTTGGGGAGG - Exonic
997456111 5:134018708-134018730 ACGAACAATGTGATTTAGGGTGG + Intergenic
1000753091 5:165121340-165121362 GTGAATTATCTGGTTTATGGGGG - Intergenic
1003217970 6:4132394-4132416 CTTAACGATGTGATTTAGGGTGG - Intronic
1014667414 6:124256524-124256546 CAGAACTATCAGATTTAGGATGG - Intronic
1015525165 6:134168765-134168787 CTCAACTAACTGCTTTAGGTCGG + Intergenic
1016442076 6:144094851-144094873 GTGAACTTTCTGTGTTAGGGTGG - Intergenic
1017618940 6:156275050-156275072 GTGAAGTATGTGATTCAGGGAGG + Intergenic
1019953977 7:4398386-4398408 CTCAAAAATCTGATTTAGTGAGG - Intergenic
1023771890 7:43564827-43564849 CCGAACTATATAATTTAAGGTGG - Exonic
1032207316 7:129878930-129878952 CAGATCTATCTGATTGAAGGTGG - Intronic
1032612827 7:133434204-133434226 CTGAAACCTCTGCTTTAGGGAGG - Intronic
1032640971 7:133767725-133767747 CAGAACTATCTGATTTTGCAGGG - Intronic
1041703955 8:60825333-60825355 CTGAATTATCCTATTTAGGGTGG + Intronic
1045547209 8:103140224-103140246 CTGTCGTATCTGATTTGGGGAGG - Intronic
1052788279 9:32850266-32850288 CTAAACCCTCTGATTTAGGCTGG - Intergenic
1054419943 9:64918782-64918804 CTGAATTATCATATTTAGGTGGG - Intergenic
1056631143 9:88294059-88294081 CTGAACCCTGTCATTTAGGGAGG + Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1186252768 X:7686804-7686826 CTGAAATATTTGATTTAATGTGG - Intergenic
1186760282 X:12716014-12716036 CTGTACTGTCTGGTTTTGGGTGG - Intronic
1189959884 X:46314374-46314396 TTTAACAATGTGATTTAGGGTGG - Intergenic
1193543574 X:82800312-82800334 CTAAACTATCTGATATGGGCTGG + Intergenic
1197702116 X:129607348-129607370 CTTAACTATCTGTTTTCAGGTGG + Intergenic
1199290309 X:146097871-146097893 CTAATCTAACTGATTTTGGGAGG + Intergenic
1199792465 X:151168175-151168197 ATGAACTATCTGTTTCAGAGAGG + Intergenic