ID: 1155237609

View in Genome Browser
Species Human (GRCh38)
Location 18:23836689-23836711
Sequence CCCTGGGGCCCTTTCTCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155237603_1155237609 19 Left 1155237603 18:23836647-23836669 CCCGAGAATGTTGGCTGTGTCTT 0: 1
1: 1
2: 5
3: 21
4: 211
Right 1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG 0: 1
1: 0
2: 1
3: 14
4: 202
1155237602_1155237609 20 Left 1155237602 18:23836646-23836668 CCCCGAGAATGTTGGCTGTGTCT 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG 0: 1
1: 0
2: 1
3: 14
4: 202
1155237604_1155237609 18 Left 1155237604 18:23836648-23836670 CCGAGAATGTTGGCTGTGTCTTA 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG 0: 1
1: 0
2: 1
3: 14
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155237609 Original CRISPR CCCTGGGGCCCTTTCTCTCG AGG Intronic
900389117 1:2426482-2426504 TCCTGGGGGCCTTTCCCTCCGGG + Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
900395936 1:2453265-2453287 CCCTGGGGCCCTTCCCCGTGTGG + Intronic
903742292 1:25565258-25565280 CCCTGCTGCCCTTTCTCCTGGGG + Intronic
904008799 1:27378351-27378373 CCCTGGGGCCCTTTCCCCCTTGG + Intergenic
904337647 1:29808583-29808605 CTCTGGAGCCCTTTCTCTAAGGG + Intergenic
904753246 1:32754104-32754126 CGCTGGGGGCCTTCCTCTTGTGG - Intronic
906701096 1:47858831-47858853 TCCTGAGGACCTTTCTCTAGAGG - Intronic
907987744 1:59549197-59549219 CTCTGGAGCCCTTCCTCTCCAGG + Intronic
914386184 1:147172287-147172309 CCCTGGAGCCCTCTCCCTCCTGG + Intronic
914674895 1:149900574-149900596 CCCTGGGCCCCATTCTGTTGGGG + Intronic
916542291 1:165768625-165768647 CCCCGGGGCCCTTCCTCCCGGGG + Intronic
920263103 1:204703093-204703115 ACCTGTGCCCCTTTCTCTGGAGG + Intergenic
921325042 1:213980821-213980843 CCCTGGGGTCCATTCACTAGGGG + Intergenic
922364923 1:224854561-224854583 CCCTGGGGGCCTTTCCAGCGTGG - Intergenic
924602523 1:245504156-245504178 CCCTGGGCCCTATTCTCTCTGGG + Intronic
1063240798 10:4167408-4167430 TCCTGAAGCCCTTTCCCTCGGGG - Intergenic
1071514899 10:86290934-86290956 CCCTGGGCCGCTTCCTCTCCAGG - Intronic
1071520912 10:86331024-86331046 CCCTGGTGGCCCTTCTCTCATGG - Intronic
1074634902 10:115304090-115304112 CCCTCTGACCCTTTCTCTCCAGG + Intronic
1077323569 11:1953551-1953573 CCCAGAGGCACTTTCTCTCTGGG + Intronic
1077464239 11:2726040-2726062 GCCTGGGGCCCCTTCTCTGCCGG - Intronic
1081848001 11:46254290-46254312 CTCTGCGGCCTTTGCTCTCGGGG - Intergenic
1082803662 11:57432656-57432678 CCCCGGGCACCTTTCTCTCTTGG + Intergenic
1083871219 11:65489632-65489654 CCCTGCTGCCCTTACTCTGGGGG - Intergenic
1084118716 11:67056721-67056743 GGCTGGGGCCCTTCCTCTCCAGG - Intergenic
1085273143 11:75282107-75282129 CCCTGGGGCCCTTGGTCTGATGG - Intronic
1086348587 11:85922543-85922565 CCCTGTGGCTCTCTCTCTAGTGG + Intergenic
1087762115 11:102111679-102111701 CCCTGGGCCCCTTTCCTTTGCGG + Intronic
1088065643 11:105715784-105715806 CCCAGGGTCCCTTCATCTCGTGG + Intronic
1089252917 11:117178383-117178405 CCCTGGGCCACTTTTTCTCCGGG - Intergenic
1090188288 11:124752105-124752127 TCCCGGGGCCCTTTCTCTGCGGG - Exonic
1090938683 11:131368625-131368647 CCCAGGGCCCCTTCCTCTCAAGG + Intergenic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1202806556 11_KI270721v1_random:8746-8768 CCCAGAGGCACTTTCTCTCTGGG + Intergenic
1092457659 12:8658587-8658609 TCCTGGTTCCCTTTCTCTAGAGG + Intronic
1095827658 12:46546951-46546973 CACTGGGTCCCTTTCTCTGTTGG - Intergenic
1097147876 12:56954122-56954144 CTCTGGGGCTCTTCCTCTCTAGG - Intronic
1100827820 12:98491255-98491277 CCCTGAGTCCCTTTGTCTCAAGG - Intronic
1101903853 12:108811097-108811119 CCCTCGTGCCCTCTCACTCGAGG + Intronic
1102559757 12:113753822-113753844 CCCTGGACCCCTTGCTCTCTGGG - Intergenic
1103724463 12:122990851-122990873 CTCTGGGCCCCTTCCTCTCACGG - Intronic
1103896749 12:124278183-124278205 CCCTGGGGCCCTGAGTCTAGGGG - Intronic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1104811347 12:131622067-131622089 CCCCTGGGCCCTTTGCCTCGGGG - Intergenic
1105014421 12:132777448-132777470 TGCTGGGGCGCTTTCTCTCTTGG + Intronic
1105345188 13:19564977-19564999 CCCTGGGGCCGTGTCCCCCGGGG - Intergenic
1105704946 13:22962859-22962881 CCCTGGCTCCCTCTCTCTCCAGG - Intergenic
1106821399 13:33468464-33468486 CCATGGGGACATTTCTCTCATGG + Intergenic
1111919559 13:94396121-94396143 CCCTGGGGCCCCCTCTCCTGTGG + Intronic
1113464467 13:110503954-110503976 CCCTGGGGCCCCATCTCCCCCGG - Exonic
1118982010 14:70724764-70724786 CCCTGGGGCCCTCGCTCCCCAGG + Intronic
1119806438 14:77485308-77485330 CCCTGGGGGCCTTTCTCCTCTGG - Intronic
1120959978 14:90115537-90115559 CCCAGGGGCCCTTTCTGTAAAGG + Intronic
1121201460 14:92121666-92121688 CCCTGTTGCCCTTGGTCTCGGGG - Exonic
1121565880 14:94908752-94908774 CCCTGGGTCCCTTCCTCACAAGG + Intergenic
1122082159 14:99273652-99273674 CCCTCGGGGCCTTTTCCTCGGGG + Intergenic
1127961812 15:63895827-63895849 TCCTGGGGCCCTCTCTCCCCAGG + Intergenic
1128055662 15:64698121-64698143 CCCAGGGGCCCTTTCTCAGATGG - Intronic
1128671284 15:69576383-69576405 TCCTCTGGCCCTTTCTCTCTTGG + Intergenic
1130332209 15:82931266-82931288 CCCAGGGGGCCTGTCTCTCAAGG - Intronic
1132615934 16:841096-841118 CCCTGAGCCCCTTTCTCAGGTGG + Intergenic
1133035705 16:3032981-3033003 CCCTGGAGCCCGTTCTCTAAGGG - Intronic
1134237278 16:12476935-12476957 CCTTGGGGACTTTTCTCTCTGGG + Intronic
1135747277 16:25027868-25027890 CCCTGTGGTCCTCTTTCTCGTGG - Intergenic
1136497264 16:30651883-30651905 CCCGGGGGCCCCTTCTCCCCTGG + Exonic
1138009418 16:53363502-53363524 CCCTTGGGCCCTCTGTCTCCAGG + Intergenic
1138317383 16:56081695-56081717 CCCTGGTGCCCTTACACTCTGGG + Intergenic
1140140980 16:72257293-72257315 CCCTAGGACCCTTTCTGTAGAGG + Intergenic
1140346417 16:74217892-74217914 CCCTTTGGCCCTGTCTCTCTAGG - Intergenic
1140478211 16:75249468-75249490 CCCTGCAGCCCTTTATCTGGGGG + Intronic
1140478751 16:75251495-75251517 GCCTGGGGCCCCGGCTCTCGCGG + Intronic
1140899931 16:79358117-79358139 CCCTGCTGCCCTTCCTCTGGGGG - Intergenic
1141427356 16:83952970-83952992 CCCTGGGGCTCAGTCTCTGGAGG - Intronic
1141841910 16:86579054-86579076 CCCGGCCGCCCTTTCTCGCGGGG - Exonic
1142053393 16:87975394-87975416 CCCTGTGACACTTTGTCTCGAGG + Intronic
1142107691 16:88315163-88315185 CCCTGGAGCCCTGGCCCTCGGGG - Intergenic
1142266703 16:89067230-89067252 CCCTGTGTCGTTTTCTCTCGAGG + Intergenic
1142861717 17:2766191-2766213 CCCTGGGGCCCATTCTACCACGG + Intergenic
1142979020 17:3660860-3660882 CCATGGGGCTCTTTCTCTGAAGG + Exonic
1144233085 17:13228718-13228740 CTCTGGCGCCCTTTCCCACGCGG + Intergenic
1144572115 17:16406980-16407002 CCTTGGGACGCTTTCTTTCGAGG - Intergenic
1145786172 17:27595261-27595283 CCCTGGAGCCCTCTCTCTGTTGG + Intronic
1147184138 17:38704783-38704805 CCCTCGGGCCCTTTCCTCCGAGG - Intergenic
1148444803 17:47731057-47731079 CCCTGGGGCCATGCCTCTGGAGG - Intergenic
1149864268 17:60141785-60141807 CCCTGGGGAGCTTTCCCTCACGG + Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1155455259 18:26005110-26005132 TCCTGGCGCCCTTTCCCTCGTGG - Intergenic
1156451280 18:37267733-37267755 CCCAGGTGCCCTTTTTCTAGTGG - Intronic
1158939273 18:62392216-62392238 CCTAGGGGCCCATTCTCCCGTGG + Intergenic
1161815704 19:6498600-6498622 CCCTGGGGCCTTTGCACTAGTGG + Intronic
1163755999 19:19106417-19106439 CCCGGGGGCTCTGTGTCTCGGGG + Intronic
1164575013 19:29400838-29400860 CACTGTGGCCCTTTCTCCCAAGG - Intergenic
1165493795 19:36140582-36140604 CCCTGGGGCCCTTTAGGCCGTGG + Intronic
1165776387 19:38406858-38406880 CCCTGGAGCCCTTCCCCACGTGG - Intronic
1165813658 19:38627782-38627804 CTCTGGGTCCCTTGCTCTCTTGG + Intronic
1166384792 19:42374970-42374992 CCCTGGGGCCTTTGCACTGGCGG - Intronic
1167426436 19:49432148-49432170 CCCTAGGACCCTGTCTCTCCAGG + Intronic
1168357839 19:55713547-55713569 GCCAGGGGCACTTTCTCTCCTGG - Intronic
1168644964 19:58053877-58053899 CCCGGGGGCCCTTGCTCCGGGGG - Exonic
928358333 2:30641223-30641245 ACCTGTGCCCTTTTCTCTCGTGG + Exonic
931356135 2:61538697-61538719 CCCTGCGGCCCTCTCCCTCCCGG + Intergenic
932298042 2:70643073-70643095 CCCTGGAGGGCTTTCTCTCCTGG - Intronic
933159869 2:79011718-79011740 CCCTGGGGCCATTACTTTTGCGG - Intergenic
937993860 2:127679044-127679066 CCCTGGAGCTCTTTCCCTCCGGG - Intronic
938370014 2:130762906-130762928 CCCTGGGAACCTTGCTCTCCAGG - Exonic
938537284 2:132256918-132256940 CCCAGGTGCCCTTGCCCTCGCGG - Intronic
946292116 2:218753355-218753377 CCCTGGGTACCTTTCTTTCAAGG + Intronic
947721774 2:232374101-232374123 CCCTGTGGCCCTTGGTCTTGGGG - Intergenic
1169150275 20:3284013-3284035 GCCTGGGGCCTTCTCTCTTGAGG - Intronic
1169771693 20:9208161-9208183 CCCTGGGACCCTTCCTCTTAAGG - Intronic
1170427939 20:16254189-16254211 CACTGGTGCCCTTTCTCTAAGGG - Intergenic
1171567343 20:26208127-26208149 CCCAGGTGCCCTTGCCCTCGCGG - Intergenic
1174152190 20:48493502-48493524 CCCAGGGGCCGTTTCTCTGTGGG + Intergenic
1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG + Intergenic
1176413544 21:6461734-6461756 CCCTGGAGCCCCTTATCTCAAGG + Intergenic
1176414317 21:6466387-6466409 CCCTGGAGCCCTCTCTCGCAAGG + Intergenic
1176430913 21:6575124-6575146 CCCTTCTGCCCTTTCTCTCAAGG + Intergenic
1176547503 21:8208153-8208175 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1176555412 21:8252362-8252384 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1176566454 21:8391200-8391222 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1176574330 21:8435387-8435409 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1178741661 21:35207157-35207179 CCCTGGGGCCCGGGCTCTCTGGG + Intronic
1179689041 21:43070057-43070079 CCCTGGAGCCCCTTATCTCAAGG + Intronic
1179689815 21:43074709-43074731 CCCTGGAGCCCTCTCTCGCAAGG + Intronic
1179706307 21:43182586-43182608 CCCTTCTGCCCTTTCTCTCAAGG + Intergenic
1179747605 21:43451589-43451611 CCTTGGGGCTCCTGCTCTCGGGG - Intergenic
1179894715 21:44355074-44355096 CCCTGGGACTCTCTCTCTTGGGG - Intronic
1179899246 21:44380415-44380437 CCCTGGAGCCCTCTCTCTGCTGG + Intronic
1180147681 21:45930350-45930372 CCCTGGAGGCTTTTCTCTCCAGG + Intronic
1181420229 22:22792585-22792607 CCCTGTGACCCTTTCCCTGGAGG - Intronic
1181424271 22:22822873-22822895 CCCTGTGGCCCCTTCCCTGGAGG - Intronic
1181491308 22:23262474-23262496 CCCTGGGGCTCTTTCCCCCATGG + Intronic
1183322855 22:37175792-37175814 CCCTGGGGCCATTTCTTCCCTGG - Intergenic
1184089181 22:42283508-42283530 CCCTCGGGCCCCTCCTCTCCCGG + Intronic
1184554877 22:45227715-45227737 CAGTGGGGCCCGTTCTCTCCCGG - Intronic
1185002745 22:48256251-48256273 CCCTGGGACCGTTTGTCTCTGGG - Intergenic
1185215760 22:49599181-49599203 CCCGGTGACCCTTTCTCTCCTGG - Intronic
1203252376 22_KI270733v1_random:124438-124460 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1203260433 22_KI270733v1_random:169524-169546 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
950507440 3:13403969-13403991 CCCTGGGGCCTGCTCTCTCTGGG + Intronic
952120061 3:30231720-30231742 CCCTGGGGCCCTGTCTTTAAAGG + Intergenic
952874881 3:37936253-37936275 CCCTGGGGACATTTATCTCATGG + Intronic
954286781 3:49625075-49625097 CCCTGTGCCCTTGTCTCTCGGGG - Exonic
961332950 3:126153725-126153747 CCCTGAGGCCCTTTCTCCTGGGG + Intronic
961470152 3:127106319-127106341 CCCAGGGGCCCTCTCTCTCTTGG + Intergenic
963672048 3:148263131-148263153 CCCTGAGGCTCTTTCTTTTGTGG + Intergenic
964590876 3:158361017-158361039 CCCTGTGGCCCTGGCTCTCAGGG + Intronic
964644758 3:158947288-158947310 TCCTGGAGGCCTTTCTCTGGGGG + Intergenic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
968768131 4:2485455-2485477 ACCTTGGGCCCTTTCTCCCTGGG + Intronic
968844586 4:3033305-3033327 CCCTGGGGCCCCTTTTCTAATGG + Intronic
968984714 4:3868876-3868898 CCCTTGGGCCCTGCCTCTAGGGG - Intergenic
972264028 4:37441402-37441424 CCCTAGGGCCCTTTTCCTTGTGG + Intronic
983948811 4:173616489-173616511 ACCTGGGCCCTTTTCTTTCGAGG + Intergenic
989643142 5:43602981-43603003 CCCAGGGGCCCTTCCACTCTCGG - Intronic
989777993 5:45232363-45232385 CCCTGGGTCCCTTCCACACGTGG + Intergenic
990470743 5:56113007-56113029 CCCTGGGGCTCTCTCTCTGGTGG - Intronic
990967527 5:61465043-61465065 CCCTGCAGCCCTTCCTCTCTAGG - Intronic
991130501 5:63117542-63117564 CCATGGGCCCCTTACTCTCAAGG - Intergenic
992646416 5:78815905-78815927 TCCTGGGGCCCCTTCTTTCTTGG + Intronic
999231765 5:150065884-150065906 CCCTGCGGCCCTTTCTGCCTTGG - Intronic
999264401 5:150256941-150256963 CCCTGGGGCCCCTCCTTTTGTGG - Intronic
1001641261 5:173245800-173245822 GACTGGGGCCCTTCCGCTCGGGG + Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002687007 5:181020656-181020678 CACTCTGGCCCTTTCTCACGGGG + Intergenic
1006387461 6:33739303-33739325 AACTGAGGCCCTTTCTCTTGGGG + Intronic
1006613855 6:35311797-35311819 CCCTGGGGATCTTTCCCTTGTGG - Intronic
1011545903 6:88481040-88481062 GCCTGCAGCCCTTTCTCTCAAGG + Intergenic
1012170843 6:96015695-96015717 TCCTTGGGCTCTTCCTCTCGTGG - Intergenic
1016871327 6:148819985-148820007 CCATGGGGGCCTCTCTCTCCGGG + Intronic
1016914549 6:149232842-149232864 CTCTGGGGCACTTTCTCTGGAGG - Intronic
1017652884 6:156599272-156599294 GCCTGGGGCCCTTTCTGGCCAGG - Intergenic
1018852113 6:167648272-167648294 CCCTGGGCCTCTTTCTCCTGGGG + Intergenic
1019212746 6:170419639-170419661 CCCAGGGCCCCTTTCACTCTTGG - Intergenic
1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG + Intergenic
1019847437 7:3520143-3520165 CTCTGGAGCCCTTCCTCTGGGGG + Intronic
1020066766 7:5194244-5194266 CCCTGGTGCCCTCTCTTTCAGGG - Intronic
1024086397 7:45895037-45895059 TACTGGGGCCCTTTCTCAAGGGG + Intergenic
1024744834 7:52394045-52394067 TCCTGGTGGCCTTTCTCTGGAGG + Intergenic
1026204650 7:68246326-68246348 CCCTGGGGCTCTTTCAGTCTGGG - Intergenic
1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG + Intronic
1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG + Intergenic
1027108184 7:75418630-75418652 CCCTGGGGCCCTTTCCCTTCTGG - Exonic
1029426058 7:100494502-100494524 CCCTGGGCCCCTTCTTCTCTCGG - Exonic
1033227480 7:139573070-139573092 CCCGGGGGCCCATGCTCACGGGG + Exonic
1034455051 7:151165566-151165588 CCCTGGGCCCTTTTATCTTGTGG + Intronic
1035079212 7:156202333-156202355 CCTTGGGGCCATCTCTCTCCTGG - Intergenic
1042944898 8:74144970-74144992 CCCTGGGTTCCTTTCTCTTCTGG + Intergenic
1044971574 8:97625035-97625057 CCCAGGGCCCCTTCCTCTCTCGG + Intergenic
1048006004 8:130419744-130419766 CCCTGGGGCTCCCTCTCTAGGGG + Intronic
1049062636 8:140287677-140287699 CCCTGCGGCGCTTTCTCTTCCGG - Exonic
1049680183 8:143914721-143914743 GCCTGTGGCCCCTTCTCTGGAGG + Intergenic
1053428975 9:38029261-38029283 CTATGGGGCCATTTCTCTCCAGG + Intronic
1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG + Intronic
1057301924 9:93891503-93891525 CTCTGGGGCCCTTGCACTCTGGG - Intergenic
1057353564 9:94318715-94318737 CCCTGGGGTCCTCTCCCTCCTGG + Exonic
1057654187 9:96938877-96938899 CCCTGGGGTCCTCTCCCTCCTGG - Exonic
1059344201 9:113617025-113617047 CCCTGGGGCCCTTCACCTTGTGG - Intergenic
1060186611 9:121567681-121567703 CACTGGGGCCCTGTCACACGGGG - Intronic
1060995421 9:127872879-127872901 TCCTGGGACCCTGTGTCTCGGGG - Intronic
1061087863 9:128409631-128409653 CCCTAGGGCCTTCTCTCTCGAGG - Intergenic
1061188849 9:129070418-129070440 CCCAGGGGCCCATTCTCTCGGGG - Exonic
1061888078 9:133603033-133603055 CCCAGGTGCCCTTTCTCCCTGGG - Intergenic
1062697060 9:137880867-137880889 CCCTGGTTCCCTGCCTCTCGGGG + Intronic
1203468781 Un_GL000220v1:107589-107611 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1203476602 Un_GL000220v1:151561-151583 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1203361388 Un_KI270442v1:221050-221072 CCCGGGTGCCCTTGCCCTCGGGG - Intergenic
1187225590 X:17373347-17373369 CCCTTGAACCCTTTCTCTCCTGG + Intergenic
1190376794 X:49796191-49796213 CCTTGGGGGCCTTTCTCTCAGGG + Intergenic
1191877385 X:65810198-65810220 CACTGGGGCTCTCTCTCTCAAGG - Intergenic
1193358897 X:80556621-80556643 ACCTGAGGCCCTTTGTCTCCTGG - Intergenic
1194288290 X:92038214-92038236 CCCTGGACCCCTTTGTCTTGGGG - Intronic
1198310635 X:135424105-135424127 CCCTGGGCCCCTCTCTCCCTTGG - Intergenic
1199915210 X:152332317-152332339 CCCTGGGTTCCTTTTTCTGGTGG + Intronic
1200605813 Y:5262779-5262801 CCCTGGACCCCTTTGTCTTGGGG - Intronic