ID: 1155240125

View in Genome Browser
Species Human (GRCh38)
Location 18:23856857-23856879
Sequence AGGTATCCAGATGGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155240125 Original CRISPR AGGTATCCAGATGGGGAGGA GGG (reversed) Intronic
903451826 1:23458788-23458810 AGGTTTCAAGATGGGGATCAAGG - Intronic
904030790 1:27532323-27532345 AGGTCTTGAGAAGGGGAGGAAGG - Intergenic
904311808 1:29633978-29634000 AGGGAAGCAGATGGGGAGGGAGG + Intergenic
904557877 1:31377067-31377089 AGGCATCCAGATGGCAGGGAGGG - Intergenic
904594202 1:31632810-31632832 AGGTGTCCAGAGTAGGAGGACGG - Intronic
905387859 1:37616519-37616541 AAGTATCCAGGTGGGCAGGACGG + Exonic
906478450 1:46185307-46185329 AGGTAAGCAGATGAGGAGGCTGG + Exonic
907922065 1:58922975-58922997 AAGTGGCCAGATGGGGAGGAAGG - Intergenic
908129913 1:61064919-61064941 AGGTATCAAGATGAGGCTGAAGG - Intronic
908465916 1:64395014-64395036 AAATCTACAGATGGGGAGGAAGG + Intergenic
909445720 1:75745893-75745915 AGGAATTCAGATTGGGAGAAAGG + Exonic
910116745 1:83739735-83739757 AGCTATAGACATGGGGAGGAGGG - Intergenic
911037761 1:93568307-93568329 AGCAATGCAGATGGGGCGGATGG - Intronic
913575268 1:120166635-120166657 AGGTAGAGAGAAGGGGAGGATGG + Intronic
914505001 1:148281203-148281225 ACGTATGAAGATTGGGAGGAAGG + Intergenic
914507563 1:148302945-148302967 ACGTATGAAGATTGGGAGGAAGG - Intergenic
914557574 1:148782275-148782297 AGGTAGAGAGAAGGGGAGGATGG + Intergenic
914615260 1:149347955-149347977 AGGTAGAGAGAAGGGGAGGATGG - Intergenic
915008556 1:152663467-152663489 AGGTAGAGGGATGGGGAGGATGG + Intronic
915627060 1:157120521-157120543 AAGAATCCAGAGGGGTAGGAGGG - Intergenic
915932605 1:160069642-160069664 ACCTGTCCATATGGGGAGGAGGG + Intronic
915942128 1:160125123-160125145 AGTTATCCACCTGAGGAGGAAGG - Exonic
916202770 1:162287695-162287717 AGGTATGAAAATGGGGAGGGGGG - Intronic
916834611 1:168531000-168531022 GGGTATCCAGCTGAGGAGGCAGG + Intergenic
917506731 1:175634173-175634195 AGGGAGGAAGATGGGGAGGAGGG + Intronic
918118635 1:181518058-181518080 AAGGATGCAGATGGGGAGCAAGG + Intronic
920390956 1:205600705-205600727 AGATACCCAGATGGGAAGGAAGG + Exonic
920509639 1:206541395-206541417 AGGGAGGCAGCTGGGGAGGAAGG + Intronic
922816656 1:228453930-228453952 AGGTATAAAGAGGGGGAGCAGGG - Intergenic
922883643 1:229001628-229001650 AGGTAGCAAGGTGTGGAGGAAGG + Intergenic
923856345 1:237849215-237849237 AGGCATCCGGATGGAGAAGAAGG + Intergenic
924733137 1:246730538-246730560 AGGTATCCTGATGGGGTTGTGGG - Intronic
924740283 1:246790880-246790902 AGGTCTACAGCTGCGGAGGATGG + Intergenic
1062931577 10:1356361-1356383 AGGCAGCCAGCTGGGGTGGAAGG + Intronic
1063370612 10:5520101-5520123 AGGTATGCAGCTGGGGAAGGAGG - Intergenic
1063616176 10:7602266-7602288 AGGTATTCAGATGGAGAGCCTGG - Intronic
1071217726 10:83427502-83427524 AGGAAGCCAGATGATGAGGATGG - Intergenic
1072363120 10:94679921-94679943 AGTTATCTAGTCGGGGAGGAAGG + Intergenic
1073204868 10:101763451-101763473 AGAGATCCAGATGGGGAAGGGGG + Intergenic
1073543929 10:104333627-104333649 AGGCATCCAGAGAGGAAGGAAGG - Exonic
1073668667 10:105562622-105562644 AGGCAACAAGATGAGGAGGAAGG + Intergenic
1075227393 10:120642027-120642049 AGGAATTCAGATGGGGGGCAGGG + Intergenic
1076141705 10:128084556-128084578 AGGCATGCAGCTGGTGAGGATGG - Exonic
1076439088 10:130467304-130467326 ATGTATAGAGATGGAGAGGAAGG + Intergenic
1076673275 10:132134727-132134749 AAGTATGCAGATGGAGAGGGCGG - Intronic
1076711857 10:132340485-132340507 AGGCCTCCAGATGCTGAGGAGGG - Intronic
1076723696 10:132403861-132403883 AGGTGGGCAGATGGGGATGAGGG + Intronic
1079433686 11:20422931-20422953 AGGTCTTCAAATGGGGTGGATGG - Intronic
1080467492 11:32511407-32511429 AGGATTCCAGAGAGGGAGGAGGG + Intergenic
1083619426 11:64041662-64041684 AGGAATCCTGATGGGCAGGCTGG - Intronic
1083898927 11:65634416-65634438 AGGAAACCAAATGGGGAGAAGGG - Intronic
1084476427 11:69392080-69392102 AGGAATCCAGCTGGGGCAGAGGG + Intergenic
1084877519 11:72144107-72144129 AGGTTTCTAGATGGGGAGGTTGG + Intergenic
1084907020 11:72356298-72356320 AGCCAGCCAGATGGGCAGGAAGG + Intronic
1085594385 11:77794882-77794904 AGGTATCCAAATTGGAAAGAAGG + Intronic
1086109726 11:83186937-83186959 CGGTATCCACATGGAGAAGAGGG + Exonic
1087508792 11:99062806-99062828 ATGTATCAAGAGTGGGAGGAGGG - Intronic
1088492058 11:110398030-110398052 AGGCAGCCAGATGGGGAAAAAGG + Intergenic
1088804773 11:113342085-113342107 AGGTAGACAGATGAGGAGCAAGG + Intronic
1089069596 11:115689193-115689215 AGGAAGCCACATGGGGAGGCAGG - Intergenic
1089751153 11:120652082-120652104 AGGTCTGCACGTGGGGAGGATGG + Intronic
1090712788 11:129402964-129402986 AGGTATTCAGATGAGGAGAATGG + Intronic
1090948714 11:131453782-131453804 AGGTATCTGCCTGGGGAGGACGG + Intronic
1091933720 12:4417811-4417833 AGGGATCCAGATGGGGGGAAGGG + Intergenic
1092071348 12:5633911-5633933 AGGCATGCATATAGGGAGGAGGG - Intronic
1092974340 12:13729807-13729829 AGGAAGCCATATGGGGAGGGGGG + Intronic
1093066185 12:14660930-14660952 CGGTATCCAGAGAGGCAGGAAGG - Intronic
1093137316 12:15467961-15467983 AAACATCCAGATGGTGAGGAGGG - Intronic
1096910266 12:54976507-54976529 AGGAATGCAGAAGGGCAGGAGGG + Intronic
1098139963 12:67441326-67441348 AGGTTTCCAGCAGGGGAAGAGGG + Intergenic
1101498482 12:105278668-105278690 AGGTAGCCAAATGGATAGGAGGG - Intronic
1102717527 12:114987023-114987045 AGGTATCCAGGTGAACAGGAAGG - Intergenic
1103102363 12:118189747-118189769 AGGCTGCCAGATGGGGAGGAGGG + Intronic
1104648859 12:130516737-130516759 AGGTAGCAAGATGGACAGGATGG + Intronic
1105421201 13:20253861-20253883 AAGAATCCTGTTGGGGAGGAAGG + Intergenic
1105751758 13:23427358-23427380 AGGTTCCAAGCTGGGGAGGAGGG - Intronic
1106302624 13:28483286-28483308 ATGTAAACAGATGGGGAGGCAGG - Intronic
1106368310 13:29105700-29105722 AGGGATACAGCTGGGGAGGTGGG + Intronic
1106518489 13:30475807-30475829 ACATTTCCACATGGGGAGGATGG + Intronic
1107263779 13:38526632-38526654 AGGTTTCCTGTTGGAGAGGAGGG + Intergenic
1112884318 13:104149602-104149624 AGGAATTGAGATGGGGAGGTAGG + Intergenic
1113449315 13:110395398-110395420 GGATTTCCTGATGGGGAGGATGG + Intronic
1114046513 14:18880791-18880813 AGATCCCCAGATGGCGAGGAAGG + Intergenic
1114117699 14:19638659-19638681 AGATCCCCAGATGGCGAGGAAGG - Intergenic
1114292205 14:21297504-21297526 AGGTAAACAGATGGGAAGAATGG + Intronic
1114298424 14:21351658-21351680 AGAGAACCAGAAGGGGAGGATGG + Exonic
1116420847 14:44730424-44730446 AGATATACAGATGGGCAAGAAGG + Intergenic
1119441023 14:74628945-74628967 AGAACTCCAGCTGGGGAGGAAGG + Intergenic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1120228509 14:81817945-81817967 AGGGATGGAGAGGGGGAGGACGG - Intergenic
1120982035 14:90298727-90298749 GGGTCTCCAGATGGGTAGGAAGG + Intronic
1122428188 14:101623750-101623772 AGGTGCTGAGATGGGGAGGATGG - Intergenic
1122781973 14:104147527-104147549 AGGTGCCCAGCTGGGCAGGAGGG + Intronic
1123836480 15:24199682-24199704 AGGAATCCAGATGTAGATGATGG - Intergenic
1123851829 15:24365309-24365331 AGGAATCTAGATGGAGAAGATGG - Intergenic
1123858776 15:24441164-24441186 ATGAATCCAGATGTAGAGGATGG - Intergenic
1123863417 15:24491591-24491613 ATGAATCCAGATGTAGAGGATGG - Intergenic
1123864758 15:24507442-24507464 AGGAATCCAGATGTAGATGATGG - Intergenic
1123872172 15:24587659-24587681 AGGAATCCAGATGTAGATGATGG - Intergenic
1124850040 15:33327725-33327747 AGAGATAGAGATGGGGAGGAAGG - Intronic
1125883639 15:43212952-43212974 AGGGATCCATCTGGGGATGAGGG + Intronic
1127397157 15:58552153-58552175 AGGTAACCGGGTGGAGAGGAGGG + Intronic
1129483775 15:75848562-75848584 AGGTATAAAAATGGGGATGAGGG - Intronic
1129680812 15:77657455-77657477 AGGGATCAAGATGGGGAGTTTGG - Intronic
1130093107 15:80837646-80837668 AGGAAGGCAGATGGGGAAGAAGG - Intronic
1131933854 15:97479295-97479317 AGATATCCAAATAGGGAGGGAGG - Intergenic
1132065250 15:98725646-98725668 AGGAATCCAGACGGGGAGTGGGG - Intronic
1132229358 15:100170192-100170214 AGGTAACTAAAAGGGGAGGACGG - Intronic
1132883654 16:2173021-2173043 GGGTAGCTGGATGGGGAGGAGGG + Intronic
1133449490 16:5891695-5891717 AGGGATCCACCTGGGGAGAAAGG + Intergenic
1134031003 16:10992262-10992284 AGGGATGCGGATGGGGAAGATGG - Intronic
1134452685 16:14373182-14373204 AGGTATGGAGTTGGGGAGCAGGG + Intergenic
1134542784 16:15082069-15082091 AAGCATCCAGATGGAAAGGAAGG - Intronic
1135360371 16:21808204-21808226 AAGCATCCAGATGGAAAGGAAGG - Intergenic
1135758114 16:25114851-25114873 AGGGCTCCAGTTGGGCAGGAAGG - Intronic
1135922495 16:26663637-26663659 AGGAATGAAGATGGGGAGGGAGG + Intergenic
1136262449 16:29088823-29088845 AAGCATCCAGATGGAAAGGAAGG + Intergenic
1137701738 16:50502589-50502611 AGGGAACCAGAAGGGGAGGTGGG - Intergenic
1139215218 16:65120937-65120959 AGCTGGCCAGATGGGGAGGACGG - Intronic
1139508238 16:67410302-67410324 AGGTAGCCAGGTGGGCAGCAAGG - Intronic
1140015435 16:71177753-71177775 AAGTAATCAGATGGGGAGGAAGG - Intronic
1140619114 16:76706310-76706332 AGGAATCCAGATGTAGATGATGG + Intergenic
1140822129 16:78672495-78672517 AGGTATCCTGATGGGTAGCCAGG + Intronic
1141093561 16:81147145-81147167 AGGTATACAGAGGGAGGGGATGG + Intergenic
1141688896 16:85585551-85585573 GGGTCTCCATGTGGGGAGGAGGG + Intergenic
1144028968 17:11302854-11302876 AGTCATCCAGGTGGAGAGGAGGG + Intronic
1144638919 17:16927068-16927090 GGGTCACCAGATGGGAAGGAGGG - Intergenic
1145785052 17:27588198-27588220 ATGTTTCCAGATGAGGAAGAAGG - Intronic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1146569755 17:33942120-33942142 AGGTCGCCAGTTGGGGAAGAAGG + Intronic
1147266257 17:39236705-39236727 TGGAATCCAAGTGGGGAGGATGG - Intergenic
1147439084 17:40436513-40436535 AGGCATGCAGCTGGGGAGTAAGG + Intergenic
1147562285 17:41516569-41516591 AGGTGTCCTCATGGAGAGGAAGG - Intronic
1147616609 17:41832481-41832503 GGATATCCAAATGGGGAGAAAGG + Intronic
1147986966 17:44312369-44312391 AGGGTGGCAGATGGGGAGGAAGG - Intronic
1148334713 17:46833475-46833497 AGGTGACCAGATGGGGAGTCGGG - Intronic
1149693578 17:58598732-58598754 AGGTAACCTGAGTGGGAGGAAGG - Intronic
1151969228 17:77449402-77449424 AGGAATCCAGAGGCAGAGGAGGG + Intronic
1152667266 17:81578343-81578365 AGGTGTCCTGTTGGGGAGCAGGG - Intronic
1152703665 17:81832376-81832398 TGGGATCAGGATGGGGAGGAGGG - Intronic
1153733112 18:8035389-8035411 TGGTGTCCTGGTGGGGAGGAGGG - Intronic
1154031402 18:10756863-10756885 AGGGATGGAGATGAGGAGGAAGG + Intronic
1154323018 18:13369511-13369533 GGGTCTCCAGTTGGGGTGGAGGG + Intronic
1155240125 18:23856857-23856879 AGGTATCCAGATGGGGAGGAGGG - Intronic
1155565202 18:27126799-27126821 AGGTCACGGGATGGGGAGGAAGG + Intronic
1156089120 18:33443356-33443378 AGGGAGACAGATGGAGAGGAAGG - Intergenic
1157622944 18:49026631-49026653 GGGTAGCCAGGTGGGGAGGTGGG + Intergenic
1158691220 18:59662702-59662724 AGTTAGCCAGGTGGAGAGGAGGG + Intronic
1160109794 18:76015620-76015642 GGGGAACCAGTTGGGGAGGAGGG - Intergenic
1160963874 19:1737093-1737115 AGGGCTCGAGATGGGGAGGGGGG - Intergenic
1161859086 19:6784333-6784355 AGGAATTCAGCTGGGGATGAGGG + Intronic
1162950568 19:14069839-14069861 AGGAAGCCAGAGGGGAAGGAAGG + Intergenic
1163469424 19:17487862-17487884 AAGTAGACAGATGGAGAGGACGG - Intronic
1163758902 19:19122390-19122412 AGGAATCTAGAGGGGGATGAAGG + Intronic
1164161345 19:22627390-22627412 ATGAATCCTCATGGGGAGGAAGG + Intergenic
1164800234 19:31069749-31069771 AGGTATGCAGAAGAGAAGGAAGG + Intergenic
1165089366 19:33374612-33374634 AGGTGACCAGATGCGAAGGATGG + Intronic
1166754959 19:45184970-45184992 AAGTACCTAGATGGGGAAGATGG + Intronic
1166995460 19:46717631-46717653 AGGCCTCCAGATGGGTAGGAAGG + Intergenic
1167334371 19:48875546-48875568 GGGAATCCGGATGGGGAGGGCGG - Intronic
1167622348 19:50567155-50567177 AGGTTTCCAGGAGGGGAGGGCGG + Intronic
1168313691 19:55474369-55474391 AGGGACCCAGATGGGGAGGTGGG - Intergenic
1168587352 19:57604171-57604193 AGGTGGGGAGATGGGGAGGAGGG + Intronic
925123848 2:1439781-1439803 CGCCACCCAGATGGGGAGGATGG - Intronic
925637366 2:5953000-5953022 ACATATCCAGATGTGGAAGAAGG - Intergenic
925641972 2:5994034-5994056 AGGGCTACAGATGGGGAAGAAGG - Intergenic
925751268 2:7091926-7091948 GGGTATCCACATGGGTAGGGTGG - Intergenic
927255683 2:21038704-21038726 GGGTGTCCGTATGGGGAGGATGG - Intronic
927617786 2:24617107-24617129 TGGTATGAAGTTGGGGAGGATGG + Intronic
928003938 2:27546398-27546420 AGATATCTATATGGGGAGGAGGG - Intronic
929252812 2:39778469-39778491 AGGTATCTTGATGGGGTGTATGG - Intronic
929597723 2:43186782-43186804 AGGTCTCGAGCTGGGGAGGCTGG + Intergenic
931919553 2:66998858-66998880 AGGCATCCAAATGGGAAGGGAGG - Intergenic
932949471 2:76276067-76276089 AGTTATCCAGTTAGGGAGTAGGG - Intergenic
934970734 2:98762078-98762100 AGTTATGCTGATGGGGAGCAAGG + Intergenic
935076347 2:99748239-99748261 AGGTATCTGGATGGGGTGGCAGG - Intronic
935393662 2:102581892-102581914 AGGAATCCCGGTGGGGAAGAGGG - Intergenic
935953959 2:108356137-108356159 AGATATCCAGATTGGAAGGGAGG - Intergenic
936520727 2:113210515-113210537 GGCTATCAAGATGGGAAGGAGGG + Intergenic
937927227 2:127176633-127176655 AGATGTGTAGATGGGGAGGAGGG + Intergenic
938302668 2:130228210-130228232 AGGTTCCCAGAGGAGGAGGAGGG - Intergenic
939771407 2:146324354-146324376 AGGTATCCATTTGGGCAGGAAGG - Intergenic
941799982 2:169648558-169648580 AGGTATGCAGATGGCTAGCAAGG + Intronic
942068925 2:172297839-172297861 AGGTAAGCAGAGGGGGAGGAGGG - Intergenic
945148481 2:206763556-206763578 AGGTTTTTAGAAGGGGAGGAGGG - Intronic
946453128 2:219798362-219798384 AGGTAATCAGATGGTGATGAGGG + Intergenic
946662317 2:222014799-222014821 AGGTATACAGATGGGGACCTAGG + Intergenic
946688595 2:222294684-222294706 ATGCATTCAGGTGGGGAGGAAGG - Intronic
947488764 2:230575949-230575971 AGACATCCAGATGGCAAGGAAGG - Intergenic
948699373 2:239750681-239750703 AGGTGTCCAGGTGGGGAGGTGGG - Intergenic
948785802 2:240352084-240352106 GGGTCTCCAGATGGGGTGGGCGG + Intergenic
1168996200 20:2135045-2135067 AAGTCTCCAGAGGGGGAGTAGGG + Intronic
1169333195 20:4732607-4732629 AGGCATCCAGGTGGAGAAGATGG + Exonic
1169388645 20:5171729-5171751 AGGAATCCCCATGGGAAGGAGGG + Intronic
1169481845 20:5989732-5989754 AGGTATGCAGATGGGTAGAAGGG + Intronic
1169497233 20:6127035-6127057 ATCCATCCAGTTGGGGAGGAGGG - Intergenic
1169791855 20:9419124-9419146 AGGCATCCAGATTGGAAAGAAGG - Intronic
1170171223 20:13415233-13415255 AGGAAACCAGAGGGAGAGGAAGG + Intronic
1170438481 20:16353802-16353824 AGGTATCCATATGGGGTGGAAGG + Intronic
1170491960 20:16886365-16886387 AGGTATGCAAAGAGGGAGGAAGG + Intergenic
1170882374 20:20308420-20308442 AGGTGTACAGATGGGGAAGGGGG + Intronic
1171721542 20:28568687-28568709 ATTTATCAAGATGGGGAGGCTGG + Intergenic
1171868541 20:30508351-30508373 AGGCAGCCTGATGGGAAGGAGGG + Intergenic
1172948770 20:38708471-38708493 AGACATCCAGATGGGCAGGCTGG + Intergenic
1173397029 20:42689386-42689408 GGGGAGCCAGAAGGGGAGGATGG - Intronic
1179394483 21:41025365-41025387 AAGTATCCAGATGAGAAGGGAGG - Intergenic
1179508930 21:41859503-41859525 GGGTCTGCAGACGGGGAGGAAGG - Intronic
1179639390 21:42737146-42737168 AGCTAGCCAGATGGGGAAGGCGG + Intronic
1179916269 21:44480276-44480298 AGGTGGCCAGACGGGGAGAAGGG - Intergenic
1180051038 21:45331076-45331098 GGGTCTCAAGATGGGGAGGGAGG + Intergenic
1180295088 22:10927346-10927368 ATTTATCAAGATGGGGAGGCTGG + Intergenic
1180465049 22:15603427-15603449 AGATCCCCAGATGGCGAGGAAGG + Intergenic
1180579224 22:16813614-16813636 ATGTTTCCAGATGTGGAGGTGGG - Intronic
1182854058 22:33501676-33501698 TGGCATCCAGATGGGGCGGCAGG + Intronic
1182863097 22:33578157-33578179 AGGCAACCAGATTGTGAGGATGG + Intronic
1183180503 22:36256983-36257005 AGAAATAGAGATGGGGAGGAAGG - Intronic
1183271564 22:36865595-36865617 TAGGATCCAGCTGGGGAGGAAGG - Intronic
1183594161 22:38799919-38799941 AGGAAGCCAAATGCGGAGGATGG + Intergenic
1183614152 22:38932468-38932490 AGGTATACAGATCAGGAGCAAGG - Intergenic
949483381 3:4514489-4514511 AGGTATCCAGGTGGCGGTGATGG + Intronic
949553643 3:5133408-5133430 AGGGAGACAGTTGGGGAGGAGGG + Intronic
952262762 3:31756344-31756366 TGGTTTCCAGATGGTGAGAATGG - Intronic
952821181 3:37487303-37487325 AGGGATTCTGAGGGGGAGGAAGG + Intronic
952849270 3:37714285-37714307 AGGAACCCAGAGGAGGAGGAAGG - Intronic
953445405 3:42960607-42960629 AGGTAACAAGTTGGGGAGAAAGG + Intronic
955911284 3:63862803-63862825 AGGTATCTGGTTAGGGAGGAAGG - Intronic
957218784 3:77355220-77355242 GGGTATGCAGATGGGAAGAAGGG - Intronic
960051841 3:113246803-113246825 AGGTATCCAGAGAGGGAGAAAGG - Intronic
962102681 3:132359141-132359163 AGTTATCCAGATTTGGAGTAGGG + Intronic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
963016327 3:140827752-140827774 AGGTAGCCAGACAGAGAGGAGGG - Intergenic
963631206 3:147732394-147732416 AGAGATGCAGGTGGGGAGGAAGG - Intergenic
964519630 3:157550467-157550489 AAGTGTCAAAATGGGGAGGAGGG - Intronic
964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG + Intronic
966439233 3:179925293-179925315 AGCTAGGCAGATGGGGAGTAGGG - Intronic
966997137 3:185293764-185293786 AGGAATCCAAATGTGTAGGAAGG - Intronic
968040097 3:195581549-195581571 AGGTGTACAGATGGGGAAGCTGG + Intronic
968584005 4:1407564-1407586 ATTTATCCAGATGTGGAGAAGGG - Intergenic
968896591 4:3407581-3407603 AGGTACGCAGATGGGGACAAGGG - Intronic
969435536 4:7187072-7187094 GTGTATCCACATGTGGAGGAAGG - Intergenic
977539332 4:98297670-98297692 AGGAATAGAGATGGGGAGTAGGG - Intronic
977573141 4:98650349-98650371 AGGTATCCATATGGGGATGGGGG + Intronic
978838944 4:113186531-113186553 AGATATCCAGGAGGGGAGGGAGG - Intronic
984270999 4:177548590-177548612 GGGTATGCTGATGGGAAGGAGGG + Intergenic
985790219 5:1922731-1922753 TGGTTTCCAGAATGGGAGGAGGG - Intergenic
988089684 5:26520519-26520541 AGGGATTCCAATGGGGAGGAGGG + Intergenic
989299138 5:39868194-39868216 TGGAATCCAGATGGTGATGATGG + Intergenic
992533637 5:77675792-77675814 AGGTATACAGATTGGGAAGGAGG + Intergenic
993058192 5:83007223-83007245 AGATGTGCAGATGGGGAAGACGG - Intergenic
994878704 5:105459367-105459389 AGGAAACCAGATGGGTAGGAAGG - Intergenic
995253938 5:110024173-110024195 AGTTATCCAAATGGGAAGGGAGG + Intergenic
997054087 5:130419796-130419818 AGGTATTCAGATAGGAAGAAAGG + Intergenic
997693371 5:135843043-135843065 AGGGAGCAAGATGGGGAGAAAGG - Intronic
998105660 5:139467592-139467614 AGGCATCCACATGGTGGGGAAGG - Intergenic
999181802 5:149675038-149675060 AGGCATCCAAATGGAGAGGTAGG - Intergenic
999869177 5:155731348-155731370 GGGAAGTCAGATGGGGAGGAGGG + Intergenic
1001205589 5:169759819-169759841 AGGGATTCAGAGTGGGAGGAGGG + Intronic
1002040327 5:176508850-176508872 TGAATTCCAGATGGGGAGGAAGG - Exonic
1002548917 5:179972581-179972603 AGGTATCCAGATGAGGGTGGGGG + Intronic
1003318665 6:5033566-5033588 ATGTATCCAGGTGAGGATGAGGG - Intergenic
1003582845 6:7358160-7358182 AGGAAGGCAGATGGGCAGGAGGG - Intronic
1005571627 6:27151066-27151088 AGGTATGAAGATGAGGGGGAAGG - Intergenic
1006190493 6:32204658-32204680 AGGTATTTAGCAGGGGAGGAAGG - Intronic
1006315333 6:33288215-33288237 AGGTTTCTGGAAGGGGAGGATGG - Exonic
1009501734 6:64421943-64421965 ATGTTTCTTGATGGGGAGGATGG - Intronic
1009871239 6:69454300-69454322 AGGTATCCAAATAAGAAGGAAGG - Intergenic
1010409082 6:75540079-75540101 AGGAAGCCAGGTGAGGAGGATGG - Intergenic
1010921889 6:81692347-81692369 AGGTGTTGAGATGGGGAGAAAGG - Intronic
1012837689 6:104291251-104291273 AGGTTAAAAGATGGGGAGGAAGG - Intergenic
1013100320 6:106980993-106981015 AGGGCTCCTGATGAGGAGGAGGG - Intergenic
1013727494 6:113117265-113117287 AGGCATCCAGATGGGAAGAGAGG + Intergenic
1014784622 6:125604068-125604090 AGGTATACTGATAGGGAAGATGG + Intergenic
1014993476 6:128111665-128111687 AGTTAGCCAGATGGGGTGGTTGG - Intronic
1016244377 6:141965382-141965404 AGGTATGCAGGTGTGGAGCAGGG - Intergenic
1016802655 6:148182385-148182407 AGGTAGCGAGGAGGGGAGGAAGG + Intergenic
1016906810 6:149158993-149159015 AGGTATCTAGATGGGTGGAAGGG - Intergenic
1021852387 7:24821419-24821441 AGATAAACAGGTGGGGAGGAAGG + Intronic
1022987423 7:35671104-35671126 AGATAACCAAATGGGGAGAAAGG + Intronic
1023347431 7:39285845-39285867 AGATATGAGGATGGGGAGGAAGG - Intronic
1025855053 7:65269326-65269348 AGGCACGCAGTTGGGGAGGAGGG + Intergenic
1026904389 7:74054542-74054564 GGGTATACAGATGGGCAGGTGGG + Intronic
1028567322 7:92246752-92246774 ATGCATCCAGATGGGGAGGATGG - Intronic
1028674697 7:93445199-93445221 AGGTAATCAGATGGCGGGGAGGG - Intronic
1028746280 7:94330352-94330374 AAGTATATAGTTGGGGAGGAAGG - Intergenic
1029594505 7:101530073-101530095 AGGTGGACAGATGGGGAGCAGGG + Intronic
1029690519 7:102178286-102178308 AGCTAACCACAGGGGGAGGAAGG + Intronic
1029940707 7:104477876-104477898 AATTAGCCAGATGGGGAGGGAGG + Intronic
1031382927 7:121110857-121110879 AGGGGTCCAGATGAGGAGCATGG + Intronic
1031993611 7:128213563-128213585 ACGTATCCAGATGAGGGAGATGG + Intergenic
1032109992 7:129067922-129067944 TGGAATCCAGATGTAGAGGAGGG + Intergenic
1032305807 7:130732324-130732346 AGGAATCCAAATGGGGAGAAGGG + Exonic
1032794740 7:135268640-135268662 GGGTCACCAGGTGGGGAGGAGGG - Intergenic
1033373125 7:140730150-140730172 AGATTTCCAGATGGGCAAGAAGG - Intronic
1033797258 7:144861470-144861492 ATGGATCCACATGGGGAGTATGG + Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035412418 7:158655727-158655749 AGCCAGGCAGATGGGGAGGACGG - Intronic
1035420487 7:158725565-158725587 AGAGTTCCAGAAGGGGAGGAGGG - Intergenic
1035642474 8:1194440-1194462 CGGCCTCCAGGTGGGGAGGACGG + Intergenic
1036119966 8:6005328-6005350 TATTATCCAGATGGGGATGAGGG + Intergenic
1036979612 8:13455545-13455567 AGTTTTCCAGATGGGGGTGAAGG - Intronic
1038841616 8:31189404-31189426 CGGCATCAAGATGGAGAGGAGGG + Intergenic
1039917129 8:41868330-41868352 AGGTATCATAATTGGGAGGAAGG - Intronic
1041420364 8:57661118-57661140 AGGAAGACAGAGGGGGAGGAGGG + Intergenic
1042218519 8:66450784-66450806 AGGTGTCCACATGGGGAAGTTGG - Intronic
1042744220 8:72088398-72088420 AGGATTTCAGATGGGAAGGAGGG + Intronic
1042791273 8:72608641-72608663 AGGTATCCAGCAGGGGGAGAGGG + Intronic
1044145204 8:88704545-88704567 AGTTATCCAGCTGGGGATGGTGG + Intergenic
1044370501 8:91404652-91404674 TGGTATCCAGATGAGGTGGCTGG + Intergenic
1045347395 8:101305305-101305327 AGGAAGCCAGATGTGGAAGAAGG + Intergenic
1045853366 8:106731274-106731296 AGGAATACAGATAGGAAGGAAGG - Intronic
1045958037 8:107932683-107932705 AGATATACAGATGGGCAGAAAGG + Intronic
1046751843 8:117934559-117934581 GGTTATCCAGATGAGAAGGAAGG - Intronic
1047304782 8:123643838-123643860 GGAGAGCCAGATGGGGAGGAAGG + Intergenic
1049352475 8:142171560-142171582 TGGGCTTCAGATGGGGAGGAAGG - Intergenic
1050037895 9:1456717-1456739 AGGTAACCAGATTGAGATGATGG + Intergenic
1050725187 9:8641325-8641347 AGGTATAAAGATGGGGAGAAAGG + Intronic
1050816974 9:9827102-9827124 TGGTAGCTTGATGGGGAGGATGG - Intronic
1051796130 9:20872537-20872559 AGGCATGCAGAAGAGGAGGAGGG - Intronic
1057083165 9:92187906-92187928 AGGGACCCAGAGGGAGAGGAAGG - Intergenic
1057571015 9:96204275-96204297 TGGGATCCAGATGGGATGGAGGG + Intergenic
1057952347 9:99379566-99379588 AGTTGCCTAGATGGGGAGGAAGG + Intergenic
1059700983 9:116775464-116775486 AGGGAGGCAGATGGGGAAGAAGG + Intronic
1060551305 9:124486647-124486669 AGGTCTCCAGATGAGGAGGAAGG - Intronic
1061915997 9:133754444-133754466 AGGAATCCAGACGGGGGGGCTGG - Intergenic
1062245357 9:135563252-135563274 ATGTATACAGGTGGGCAGGAGGG + Intronic
1062264560 9:135681111-135681133 AGGTCTCCAGGTAGGGAGGGAGG - Intergenic
1062322211 9:135995848-135995870 AGGAAGCCAGAGGGAGAGGATGG + Intergenic
1062646364 9:137550599-137550621 GGGGATGCAGCTGGGGAGGAGGG + Intergenic
1203785643 EBV:126080-126102 AGGGAGCCAGTTGGGGAGGAGGG - Intergenic
1188470771 X:30536780-30536802 AGGCATCCAAATAGGAAGGAAGG + Intergenic
1190401056 X:50035372-50035394 AGTATTCCAGTTGGGGAGGAAGG - Intronic
1191184484 X:57594058-57594080 AGGTATCCAGACTTTGAGGAGGG - Exonic
1191212905 X:57908401-57908423 AGGTATCCAGACTTTGAGGAGGG + Exonic
1196190796 X:112792209-112792231 AGGTATAGAGATAGGGAAGAAGG - Intronic
1196745461 X:119067941-119067963 AGGTATCCAGCTGAGGTGTAGGG - Intergenic
1196802385 X:119555376-119555398 ATGAAATCAGATGGGGAGGAAGG + Intronic
1198677424 X:139145695-139145717 ATTTATCCAGTTGGAGAGGAGGG - Intronic
1200338328 X:155375628-155375650 GGATATCCAGATGGAGATGAAGG - Intergenic
1200348141 X:155465064-155465086 GGATATCCAGATGGAGATGAAGG + Intergenic