ID: 1155240870

View in Genome Browser
Species Human (GRCh38)
Location 18:23862548-23862570
Sequence TCTTCTGGGTGAAGGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155240865_1155240870 -4 Left 1155240865 18:23862529-23862551 CCTGAGGTCTCTAACTTTGTCTT No data
Right 1155240870 18:23862548-23862570 TCTTCTGGGTGAAGGACTGTGGG No data
1155240864_1155240870 5 Left 1155240864 18:23862520-23862542 CCTTGTTGGCCTGAGGTCTCTAA No data
Right 1155240870 18:23862548-23862570 TCTTCTGGGTGAAGGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155240870 Original CRISPR TCTTCTGGGTGAAGGACTGT GGG Intronic