ID: 1155241049

View in Genome Browser
Species Human (GRCh38)
Location 18:23863901-23863923
Sequence ATGTCCCACAAGCAGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155241049_1155241053 15 Left 1155241049 18:23863901-23863923 CCATCATGCTGCTTGTGGGACAT 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1155241053 18:23863939-23863961 CCTGCTGGAGTTGTCAGCCATGG 0: 1
1: 0
2: 0
3: 19
4: 301
1155241049_1155241051 0 Left 1155241049 18:23863901-23863923 CCATCATGCTGCTTGTGGGACAT 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1155241051 18:23863924-23863946 TGAGAGGTCTGTGCACCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155241049 Original CRISPR ATGTCCCACAAGCAGCATGA TGG (reversed) Intronic
900876937 1:5349543-5349565 ATGTGCAAGAAGCAGGATGAGGG + Intergenic
902055989 1:13600820-13600842 GTAGCCCACAAGCAGAATGAGGG + Intronic
909497751 1:76298401-76298423 AAATCCCAGAAGCAGCATGCAGG + Intronic
910844845 1:91595006-91595028 ACCTCCCCCAAGCAGCTTGAAGG + Intergenic
913322239 1:117596912-117596934 CAGCCCCACAAGCAGCGTGATGG - Intergenic
914383703 1:147146473-147146495 ATGGCCCACAAACAGCTTTAAGG + Intergenic
914901972 1:151715982-151716004 CTGCCCCACAAACAGCTTGATGG + Exonic
918388689 1:184036793-184036815 TTGTCCCACAAGGGGCATGGGGG - Intronic
918543690 1:185658919-185658941 ATGTTCCACTAGCTCCATGAAGG + Intergenic
921159255 1:212461653-212461675 ATGTCCCCCAAGCAGAGTGTTGG - Intergenic
923949515 1:238932352-238932374 GTGTCTCACAAGCAGAAGGAAGG - Intergenic
924015747 1:239719840-239719862 CTTTCCCACAGGCAGCAGGAAGG - Intronic
924710550 1:246527269-246527291 TTGTCACCCAAGCAGCAAGAAGG - Intergenic
1063973322 10:11396554-11396576 ATTTCCCACTTGCAGAATGAGGG + Intergenic
1064481004 10:15740669-15740691 ATGTCCCAAAATCATCATTATGG - Intergenic
1065309464 10:24400462-24400484 ATGTCACAGAAGCAGGATAAAGG + Intronic
1066156079 10:32679423-32679445 ATGTGCCACAATCAGGAGGATGG - Intronic
1067450546 10:46379582-46379604 ATCACCCACCAGCAGCAGGAAGG - Intronic
1067558047 10:47285883-47285905 AGGTCCCACAAGCAGGAGGGTGG + Intergenic
1067586697 10:47480169-47480191 ATCACCCACCAGCAGCAGGAAGG + Intronic
1068214546 10:53967136-53967158 TTGTCCCAAGAACAGCATGAGGG - Intronic
1069595275 10:69666143-69666165 ACGGCCCACAAACAGCCTGAAGG + Intergenic
1071540041 10:86474062-86474084 ATGTCCTAGAAACAGCAGGATGG + Intronic
1080423743 11:32137565-32137587 ATGTCCAACAGGCATCTTGAAGG - Intergenic
1080647730 11:34199012-34199034 GATTCCCAGAAGCAGCATGAAGG - Intronic
1086241693 11:84701511-84701533 ATGTCCCACAAGAAGTATCCAGG - Intronic
1091035226 11:132227083-132227105 CTATCCCACATGCAGCGTGAAGG + Intronic
1091323779 11:134669251-134669273 TTCTCCCACAACCAGCATTATGG - Intergenic
1092731307 12:11537808-11537830 AAGTCCCACAAGGAGCATCTGGG - Intergenic
1095590057 12:43893011-43893033 ATGTTCCAGAAACAGCAAGAAGG + Intronic
1099813444 12:87615706-87615728 CTGTCACACCAGCAGAATGAAGG - Intergenic
1104674582 12:130703955-130703977 ATGTCCCTAAAGTAGCAGGAAGG - Intronic
1104938973 12:132386076-132386098 ATGTCCCACAAGGAGAACAAAGG + Intergenic
1107339582 13:39391790-39391812 ATGTCCCAGAAAAAGGATGAAGG - Intronic
1108179545 13:47827241-47827263 ATCTCCAACAAGCAGGAGGAAGG - Intergenic
1108468036 13:50738509-50738531 ATGTACCAAAAGCAGTAGGAGGG - Intronic
1109054800 13:57533783-57533805 CTGTCCAACAAGCTGCATGGGGG + Intergenic
1112397335 13:99045041-99045063 CAGTCCCACAAACAGCATGCAGG - Intronic
1112555641 13:100466189-100466211 ATGTCTCACCAGCAGGATTACGG - Intronic
1112591619 13:100768450-100768472 CAGTCCCACGAACAGCATGATGG - Intergenic
1113519054 13:110925402-110925424 CAGTCCCACCAGCACCATGACGG + Intergenic
1114214838 14:20649231-20649253 ATATCCCAGAGCCAGCATGATGG + Intergenic
1114675878 14:24440170-24440192 CTGGCCCTCCAGCAGCATGATGG + Exonic
1114921436 14:27335952-27335974 ATGTCCCACAATTACCAGGATGG - Intergenic
1115728549 14:36243357-36243379 ATGTCCCCAAAGCAGCAAGGAGG + Intergenic
1116751410 14:48890065-48890087 ATAGCCAACAAGCAGAATGAGGG - Intergenic
1120146924 14:80988767-80988789 ATGTTCGACAATCAGCATAAAGG - Intronic
1120716851 14:87849704-87849726 ATGTCCCTAAAGCAGCATTTAGG - Intronic
1122544132 14:102512983-102513005 AGGTCCCAGCAGGAGCATGATGG - Intergenic
1128338521 15:66803605-66803627 CTGCCCCACAAGGAGCCTGAAGG - Intergenic
1128515307 15:68338357-68338379 CTGGCCCAGAAGCAGCTTGAGGG + Intronic
1131516649 15:93082593-93082615 ATGCCCCACATGTAGAATGACGG + Intronic
1134396098 16:13864974-13864996 ATGCCCCAACAGCAGCATGGCGG + Intergenic
1135885230 16:26299985-26300007 AAGTCCCACAAGAAGAATGGAGG - Intergenic
1138411276 16:56842393-56842415 AGGTCCCACAGGCAGCAGAAAGG - Intronic
1142516010 17:429573-429595 CATTCCCACAAGCAGCATGCAGG - Intergenic
1143437308 17:6938902-6938924 ATCTCCCTCAAGCAGCCTGATGG - Intronic
1143471786 17:7179824-7179846 AAGTCCTCCAAGCAGCATGAGGG + Intergenic
1146845355 17:36178790-36178812 TTGTCACCCAAGCAGCAAGAAGG - Intronic
1146873570 17:36390633-36390655 TTGTCACCCAAGCAGCAAGAAGG - Intronic
1146880929 17:36441721-36441743 TTGTCACCCAAGCAGCAAGAAGG - Intergenic
1147065818 17:37922240-37922262 TTGTCACCCAAGCAGCAAGAAGG + Intergenic
1152465569 17:80464360-80464382 AGGTCCCATAAGCAGCAGCAGGG - Intergenic
1152621371 17:81366528-81366550 AAGTCCCACACACAGCATGGGGG - Intergenic
1155241049 18:23863901-23863923 ATGTCCCACAAGCAGCATGATGG - Intronic
1155341573 18:24819057-24819079 ATGTCCTGCAAGCAGAATAAGGG - Intergenic
1155685071 18:28538505-28538527 CTGTCACAAAAACAGCATGAAGG + Intergenic
1156252933 18:35369203-35369225 AAGTCCCATAAGTATCATGAGGG - Intronic
1161680765 19:5678637-5678659 CTTTCCCACAGGCATCATGACGG - Exonic
1165819261 19:38664227-38664249 AAGTTCCACAAGCAGCACTAAGG - Intronic
1167556760 19:50201457-50201479 TTGTCCTACAAACAGCATGCAGG - Intronic
925660171 2:6193972-6193994 AAGTGCTACAAGCAGCTTGAAGG - Intergenic
927732497 2:25486695-25486717 ATGTCTTACAAGAACCATGAAGG - Intronic
931842890 2:66173171-66173193 ATATCCCACAAGCAGCCTTAAGG + Intergenic
935176245 2:100651979-100652001 ATTTCCCACAAGAAGGCTGAAGG - Intergenic
936019579 2:108984514-108984536 ATGTCCCAGCACCAGCAGGAAGG - Intronic
936493624 2:112997830-112997852 AGGTCCCACAGGCAGAATGATGG - Intergenic
938546057 2:132332739-132332761 AAGTCTCACATGCAGCATGATGG - Intergenic
938814688 2:134888856-134888878 ATGACCAAGAAGGAGCATGAGGG + Intronic
939739285 2:145886030-145886052 ATGTGGCCCAAGCAGCAAGATGG + Intergenic
942191754 2:173477586-173477608 ATGTCCCAGAATCACCATGTTGG - Intergenic
944912523 2:204324368-204324390 GTGTGCCTCAAGCAGCATGGTGG + Intergenic
945377635 2:209097427-209097449 ATGTCCTGCAAGGAGGATGAGGG + Intergenic
946856277 2:223952957-223952979 ATGTCCTACAATCCTCATGATGG - Intergenic
947327735 2:228996317-228996339 ATGTCCCAAAAGTGGCAAGAAGG + Intronic
948784414 2:240344673-240344695 ATGGCCCCAAAGCAGCATGGTGG - Intergenic
1170480740 20:16762502-16762524 ATTTGCAACAAGCAGCATGAAGG - Intronic
1171874921 20:30565472-30565494 AAGTCTCACATGCAGCATGATGG - Intergenic
1174225785 20:48998728-48998750 ATATCCCACATGCAGGATGTAGG + Intronic
1174357104 20:50005819-50005841 ATTTCCCACACGCAGCCAGAGGG - Intergenic
1175313162 20:58025677-58025699 ATGTCCCATAAGCAGCAGTGGGG + Intergenic
1180847395 22:18991328-18991350 ATGTCCCACAAGCAGCTTTGGGG + Intergenic
1182143470 22:27982399-27982421 CTGTCCCTGCAGCAGCATGACGG - Exonic
1182959936 22:34462724-34462746 ATGTCCAACTAGCAGGGTGAAGG - Intergenic
1185136674 22:49077381-49077403 ATGCCCAAGAAGCAGCAGGAAGG - Intergenic
949169313 3:979766-979788 ATTTACCACATGCAGCTTGAGGG + Intergenic
949783696 3:7717678-7717700 ATGGCCCACCAGCAACAGGAAGG + Intronic
952229945 3:31419350-31419372 TTGACCCAGAAGCAGGATGAAGG + Intergenic
954370405 3:50167029-50167051 ATGTGCCCCAAGAAGTATGAAGG - Intronic
954449909 3:50566228-50566250 TTTTCCCCCAAGCAGGATGAGGG - Intronic
957636805 3:82796906-82796928 GAGTCCCACAAGCTGCAGGAAGG + Intergenic
961375105 3:126459811-126459833 ATGTCCCAGAAGCAGGCTTATGG - Intronic
962240183 3:133745750-133745772 GTGTCCCACAGGAAGCTTGAGGG + Intergenic
962393593 3:134994199-134994221 ATGTGTCAGACGCAGCATGATGG - Intronic
964642757 3:158927725-158927747 ATGTCCCACAAGGAAACTGAGGG - Intergenic
965433501 3:168618656-168618678 ATGTCCCTAAAGTAGCATCAGGG - Intergenic
965510036 3:169557835-169557857 TTGTCCTAGAAGCTGCATGATGG - Intronic
965585531 3:170314552-170314574 ATAGCACACAAGCAGCATGAAGG - Intergenic
968513747 4:1006941-1006963 CTGTCCCTCAAGCAGAAGGAAGG - Intergenic
969881995 4:10182236-10182258 CTCACCCACAAGCAGCATGAGGG - Intergenic
981036702 4:140176920-140176942 ATGTCCAAGAAGCTGAATGAAGG - Intergenic
985708902 5:1417212-1417234 ATCATCCACAAGCTGCATGATGG + Intronic
990177464 5:53123843-53123865 ATCTTACACAAGCAGCATGGTGG - Intergenic
991952727 5:71962493-71962515 ATGTCCAAGAAGCAGCAAGGAGG + Intergenic
994275839 5:97836386-97836408 ATGTCCACTAACCAGCATGAAGG + Intergenic
995723233 5:115158627-115158649 ATGTACCAAAAGAAGCATTAAGG - Intronic
996583513 5:125058322-125058344 ATGTCACATCAGCAGCATGATGG + Intergenic
997011437 5:129883247-129883269 ATGTGCCAGAAGCAGCAAGGAGG - Intergenic
1005127984 6:22470730-22470752 ATGTCCCAGAAGCAGGAGGAAGG + Intergenic
1005905951 6:30261428-30261450 ATGTGCCATGTGCAGCATGAGGG + Intergenic
1006432370 6:34005449-34005471 GTTTCCCAACAGCAGCATGATGG - Intergenic
1007006961 6:38373287-38373309 ATGTCCCAAAAGCAGCAGACTGG - Intronic
1007588990 6:43010160-43010182 ATGGCCTCCCAGCAGCATGATGG - Intronic
1008390328 6:50943442-50943464 TTGTCCAACACGCAGCCTGAGGG - Intergenic
1009525839 6:64744996-64745018 AACTCTCATAAGCAGCATGAGGG + Intronic
1010092238 6:71996775-71996797 ATGCTCCTCCAGCAGCATGATGG - Intronic
1011993961 6:93561260-93561282 CTATCACACAAGCAGCATGGCGG - Intergenic
1012526549 6:100184688-100184710 ATGTCCCACAATGATGATGATGG + Intergenic
1012861516 6:104565767-104565789 AATTCCCAGAAGCACCATGATGG - Intergenic
1018859128 6:167698428-167698450 ATGTCACTCAACCACCATGATGG + Intergenic
1018870158 6:167776635-167776657 TTGGCCCACAAACAGCATGAGGG + Intergenic
1019947385 7:4340831-4340853 ATCTGCCAGCAGCAGCATGAAGG + Intergenic
1024045700 7:45584283-45584305 GTGTGCCACACGCAGCAGGACGG - Intronic
1024500643 7:50101735-50101757 TTGTGCCACAAGCAACAGGATGG - Intronic
1024973132 7:55088667-55088689 AGGTCCCATTAGCAGCACGATGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028002121 7:85512308-85512330 GTGTCCCACAAGCAAATTGAAGG + Intergenic
1028772505 7:94642405-94642427 ATGTTCCAAAAGCAACATGCTGG + Intronic
1030311071 7:108069716-108069738 ATGTCTGCCAAGCTGCATGATGG - Exonic
1030495703 7:110297020-110297042 ATGTCACAAGAGCAACATGAAGG + Intergenic
1035022475 7:155807701-155807723 ATGTCCCACCAGCAGCAGCAGGG - Intronic
1035060918 7:156068982-156069004 AAATCCCACACTCAGCATGAAGG - Intergenic
1036384356 8:8265706-8265728 ATATCACAAAAACAGCATGAAGG + Intergenic
1037694267 8:21209739-21209761 TTGTCCCTCAAGCAGGATAAAGG + Intergenic
1041040263 8:53839625-53839647 TTGTTCTACTAGCAGCATGAAGG - Intronic
1041229213 8:55731905-55731927 TTGTCCCACCAGCACCATGACGG - Intronic
1045550434 8:103166559-103166581 TTGTCCCACAGTCAGCATGCTGG + Intronic
1046490887 8:114952176-114952198 TTGTCTCAAAAGCAGCATTAGGG + Intergenic
1048787251 8:138063425-138063447 GTGTCCCACACACAGCATCAAGG + Intergenic
1050454045 9:5815552-5815574 ATGACCTACAGGCAGAATGATGG + Intronic
1051838875 9:21371851-21371873 ATACCCAACAAGCAGAATGAGGG + Intergenic
1051844371 9:21434985-21435007 ATACCCAACAAGCAGAATGAGGG - Intronic
1051868900 9:21714323-21714345 AGGTTCCACAGGAAGCATGATGG + Intergenic
1052318442 9:27141050-27141072 ATGTTCCACAAGCATCATCTTGG + Intronic
1055876689 9:80951923-80951945 GTGTCCAACAAACAGCATGGAGG + Intergenic
1056623100 9:88231483-88231505 AGATCCCACAATCAGCATCAGGG + Intergenic
1059918958 9:119136403-119136425 ATGTCTCACAAGCAGGAACAAGG - Intergenic
1059943340 9:119379822-119379844 ATTTCACACAAGCAGCAGCAGGG - Intergenic
1192099980 X:68254177-68254199 AAGTGGTACAAGCAGCATGAAGG + Intronic
1195714762 X:107808043-107808065 TTGTCCCACAAGTATCATGGAGG - Intergenic
1197526974 X:127575998-127576020 AGCTCCTGCAAGCAGCATGAAGG - Intergenic
1199613529 X:149637229-149637251 ATATCCCAAGAACAGCATGACGG - Intergenic
1199852653 X:151736636-151736658 GTTTCCAGCAAGCAGCATGAGGG + Intergenic