ID: 1155244983

View in Genome Browser
Species Human (GRCh38)
Location 18:23899296-23899318
Sequence AAGCAGATCTCTGGGACAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 285}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155244976_1155244983 25 Left 1155244976 18:23899248-23899270 CCAGAATTCCCAGTCTAATAGAC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG 0: 1
1: 0
2: 0
3: 27
4: 285
1155244978_1155244983 16 Left 1155244978 18:23899257-23899279 CCAGTCTAATAGACCACTTGATG 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG 0: 1
1: 0
2: 0
3: 27
4: 285
1155244977_1155244983 17 Left 1155244977 18:23899256-23899278 CCCAGTCTAATAGACCACTTGAT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG 0: 1
1: 0
2: 0
3: 27
4: 285
1155244975_1155244983 26 Left 1155244975 18:23899247-23899269 CCCAGAATTCCCAGTCTAATAGA 0: 1
1: 0
2: 0
3: 26
4: 174
Right 1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG 0: 1
1: 0
2: 0
3: 27
4: 285
1155244980_1155244983 -10 Left 1155244980 18:23899283-23899305 CCTAGTTCTTTTAAAGCAGATCT 0: 1
1: 0
2: 4
3: 22
4: 272
Right 1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG 0: 1
1: 0
2: 0
3: 27
4: 285
1155244979_1155244983 3 Left 1155244979 18:23899270-23899292 CCACTTGATGTTTCCTAGTTCTT 0: 1
1: 0
2: 0
3: 20
4: 228
Right 1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG 0: 1
1: 0
2: 0
3: 27
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155244983 Original CRISPR AAGCAGATCTCTGGGACAGA TGG Exonic
900212573 1:1463307-1463329 AACCAGGTCTGTGGGGCAGAAGG + Intronic
901136257 1:6998463-6998485 AAGCAGATCTTGGTGGCAGAGGG - Intronic
901217933 1:7565174-7565196 CAGCCGATCACTGGGGCAGAAGG + Intronic
901811645 1:11770405-11770427 ATGCTTATCTCTGGGACAGTGGG + Intronic
905312397 1:37059007-37059029 AAGAAGACCCCTGGGACAGTGGG - Intergenic
905472701 1:38205725-38205747 ATGCAGAGATCTGGGAGAGAGGG - Intergenic
905879535 1:41454658-41454680 AAGCAGATCCCAGGGACATAGGG - Intergenic
907696364 1:56733974-56733996 AAACAGATCAATGAGACAGAAGG - Intronic
907979760 1:59470118-59470140 AATGAGATTTCTGGGTCAGATGG + Intronic
908196044 1:61746367-61746389 AAGAAATTCTCTGGGCCAGAAGG - Intronic
908937163 1:69389967-69389989 AATGAGATCTCTGGGTCAAATGG + Intergenic
910179549 1:84466590-84466612 AAGCTGAGCTCTGGGCCATATGG - Intergenic
910620267 1:89245710-89245732 AAACAGATCAATGAGACAGAAGG + Intergenic
911273296 1:95829787-95829809 CAGCATGTCTCTGGGACAGATGG - Intergenic
913407787 1:118515333-118515355 AGGCAGATCAATGAGACAGAAGG - Intergenic
916400366 1:164441159-164441181 AAGAAGAATTCTGGGAGAGAGGG - Intergenic
917764029 1:178198222-178198244 AATGGGATCTCTGGGTCAGATGG + Intronic
919111082 1:193219363-193219385 AATCAGATTGCTGGGTCAGATGG - Intronic
920082360 1:203384264-203384286 AAGGAGATCCTTGGGACAAATGG - Intergenic
922994149 1:229942815-229942837 ACACAGATTTCTGGGACAGGTGG - Intergenic
1064001501 10:11667302-11667324 GAGTAGCTCTCTAGGACAGATGG - Intergenic
1066564736 10:36709576-36709598 AAGCAGATCTGTGGGGCTGGAGG + Intergenic
1066642334 10:37567261-37567283 AAGAAAAGCTCTGGAACAGATGG - Intergenic
1067556899 10:47278972-47278994 CAGCAGAACCCTGGGAGAGAAGG - Intergenic
1067801921 10:49365280-49365302 AAGCAGCTCTCTGGTCCAGGAGG - Exonic
1068709507 10:60118126-60118148 AAGCAGAACTTGGGGACTGAAGG + Intronic
1070560627 10:77563936-77563958 TAACAGCTCTCTGGGACAGGTGG - Intronic
1071106544 10:82103932-82103954 TAGTAGATCGCTGGGAAAGAGGG - Intronic
1071263266 10:83940376-83940398 ATCCAGATCTCTAGGTCAGAGGG - Intergenic
1071814754 10:89221034-89221056 AAGCAGATCAGTGGGATTGAGGG + Intronic
1073119258 10:101111518-101111540 CTGCAGGTCTCTGGGACATAGGG - Intronic
1073566786 10:104541960-104541982 AAGCAGATCTCAGAGGCAGAGGG + Intergenic
1073593822 10:104780638-104780660 AACCAGATCTCTGGGTGGGATGG + Intronic
1074497656 10:113994030-113994052 CTCCAGATCTCTGGGACAGGAGG - Intergenic
1074921751 10:118021415-118021437 CAGCAGGTCTCTAGGAGAGAGGG - Intronic
1075272505 10:121064610-121064632 TGGCAGAATTCTGGGACAGATGG + Intergenic
1075421046 10:122300985-122301007 GAACAGAGTTCTGGGACAGAGGG + Intronic
1075450850 10:122551207-122551229 AACCAGCTCACTGGGACAGAGGG + Intergenic
1075875343 10:125801346-125801368 GAGGAGATATCTGGGAAAGAAGG + Intronic
1076345136 10:129774464-129774486 AAGCAGACCCTTGGGACAGAAGG + Intergenic
1077969094 11:7168883-7168905 AAGCAGAGCCCAGGGAAAGAGGG + Intergenic
1078738461 11:14043691-14043713 AACCAGAGATCTGGGCCAGAGGG - Intronic
1080738445 11:35040544-35040566 AAGCGGGTCTCTGAGGCAGAAGG + Intergenic
1081809239 11:45905978-45906000 GAGCAGGTCTCTGGCAGAGAAGG + Exonic
1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG + Intronic
1085244590 11:75089628-75089650 AAGAAGGTCTCTGGCAGAGAGGG + Exonic
1085291888 11:75406694-75406716 ATGCAAATCCCTTGGACAGAGGG - Intronic
1088356491 11:108949421-108949443 AACCAGATTTCTGGGTCAAATGG + Intergenic
1090955764 11:131511853-131511875 AAGCCAATCTCTGTGTCAGAGGG + Intronic
1091649770 12:2301266-2301288 GAGCTGACTTCTGGGACAGAGGG - Intronic
1092526996 12:9315447-9315469 AAGTAGTTCTCCGGGACACACGG + Intergenic
1092540276 12:9416331-9416353 AAGTAGTTCTCCGGGACACACGG - Intergenic
1092969311 12:13676695-13676717 GTGCATATCTCTGGGATAGAGGG - Intronic
1093794776 12:23298196-23298218 GAGAAGATCTCTGAGACATAAGG - Intergenic
1094512774 12:31106146-31106168 AAGTAGTTCTCTGGGACCCATGG + Intergenic
1095280678 12:40349173-40349195 CATCAGATCTATGGGACAAAAGG - Intronic
1095284361 12:40390335-40390357 AAGCACATCTGTGGAAGAGATGG + Intergenic
1096843485 12:54392599-54392621 ATGCAGATGTCTGGGGGAGATGG + Intergenic
1097419057 12:59351362-59351384 AATAAGATCTCTGGAACTGATGG + Intergenic
1097624382 12:61982237-61982259 AATCAGATCACTTGGACACAGGG + Intronic
1097920027 12:65062122-65062144 GATCAGAGCTCTGGGACAGCTGG - Intronic
1098049253 12:66436180-66436202 AAGCAGACCACTTGGAAAGAAGG - Intronic
1103032315 12:117626766-117626788 AGGCAGATCAATGAGACAGAAGG - Intronic
1104086790 12:125482717-125482739 AATGAGATCACTGGGACAAATGG - Intronic
1107685508 13:42893695-42893717 AAGCACCTATCTGGGACTGAGGG - Intronic
1108205236 13:48082476-48082498 AAACAAATCTCTAGGAGAGATGG - Intronic
1109325253 13:60859533-60859555 AAGGACATGACTGGGACAGATGG - Intergenic
1110483667 13:76013625-76013647 ATGCAGAGCTCTGAGGCAGAGGG - Intergenic
1112219764 13:97475989-97476011 CAGCAGATCCCGGGAACAGAGGG + Intergenic
1112334374 13:98501920-98501942 CAGCAGCACTCTGGGTCAGAGGG - Intronic
1112443796 13:99445207-99445229 AAGCAGAGATCTGGGAGAGCTGG - Intergenic
1113043458 13:106128699-106128721 AAGCAGATTTATGTCACAGATGG - Intergenic
1113552982 13:111207490-111207512 ACGTAGATCTCTGTGGCAGATGG + Intronic
1114147038 14:19989546-19989568 AAGAAAATCTCTGGACCAGATGG + Intergenic
1115429168 14:33296613-33296635 AAGCAGATCTCTGTAATACAGGG - Intronic
1115638164 14:35310744-35310766 CAGCAGATCCCAGGTACAGAGGG + Exonic
1117444990 14:55795536-55795558 AAGAAGAGATCTGGGAGAGAAGG + Intergenic
1118551006 14:66950517-66950539 AAGCAGTTCTTTGAGATAGAAGG - Intronic
1120046979 14:79818985-79819007 AAGCACTGCTCTAGGACAGAGGG - Intronic
1120359976 14:83487001-83487023 AGTGAGATCTCTTGGACAGAGGG - Intergenic
1124878623 15:33620539-33620561 AACCAAAACTCTGAGACAGAGGG + Intronic
1125206105 15:37155189-37155211 AAGCAAGTCACTGGGACTGATGG - Intergenic
1126002777 15:44227326-44227348 AAGGAGATCACTTGGACACAGGG + Intergenic
1126539715 15:49808457-49808479 AACCAGCTCTCTGGGAGAGGGGG - Intergenic
1126588846 15:50319152-50319174 ATGGAGACCTCTGGGAAAGAGGG + Intronic
1127048771 15:55057478-55057500 AAGCAGGTCTGAGGGAGAGAAGG + Intergenic
1127168214 15:56270207-56270229 AGGCAGATCAATGAGACAGAAGG - Intronic
1129138287 15:73573860-73573882 AAGCAGGGCTCTGAGCCAGAAGG - Intronic
1129719757 15:77871661-77871683 AAGCAGGTCACAGGGACACAGGG + Intergenic
1130800424 15:87256959-87256981 AATCAGATCACTTGGACACAGGG - Intergenic
1131371823 15:91888230-91888252 AACCCCATCTCTGAGACAGAGGG - Intronic
1131583345 15:93666690-93666712 AAGAAGATACCTGGGACAAAGGG - Intergenic
1132474803 16:129247-129269 AAGCTGATCTGTGGCACAGGTGG + Intronic
1133075515 16:3277611-3277633 AAGCCGATTTCCAGGACAGATGG + Intronic
1135080070 16:19426585-19426607 ACGCCCGTCTCTGGGACAGATGG - Intronic
1136111658 16:28067298-28067320 AAGCAGACCTGTGGGGCACAGGG + Intergenic
1136713630 16:32259749-32259771 AAACAGATCTTTGGCTCAGATGG + Intergenic
1136754281 16:32669682-32669704 AAACAGATCTTTGGCTCAGATGG - Intergenic
1136813832 16:33200683-33200705 AAACAGATCTTTGGCTCAGATGG + Intronic
1136820308 16:33310763-33310785 AAACAGATCTTTGGCTCAGATGG + Intergenic
1136826871 16:33367302-33367324 AAACAGATCTTTGGCTCAGATGG + Intergenic
1136831937 16:33466073-33466095 AAACAGATCTTTGGCTCAGATGG + Intergenic
1137002988 16:35247449-35247471 AAGGAGATCTGTTGGAAAGAAGG + Intergenic
1137026353 16:35479357-35479379 AAGGAGATCTGTTGGAAAGAAGG + Intergenic
1137971361 16:52988171-52988193 AAGCAGAACTGAGAGACAGAAGG - Intergenic
1138027962 16:53537708-53537730 AAGGAGTTATCTGGTACAGAGGG - Intergenic
1138530813 16:57633467-57633489 AAGCAAAGGTCTGGGACAGCTGG - Intronic
1139285044 16:65805226-65805248 ACCCAAGTCTCTGGGACAGATGG + Intergenic
1139954677 16:70687362-70687384 AACCCGATCTCCAGGACAGAGGG + Intergenic
1140138349 16:72228717-72228739 AAGCAGATTACTGGGTCAAAAGG + Intergenic
1141798157 16:86288311-86288333 AAGGACATCTCTGGGTCAGCGGG + Intergenic
1202992408 16_KI270728v1_random:23657-23679 AAACAGATCTTTGGCTCAGATGG + Intergenic
1203056428 16_KI270728v1_random:930013-930035 AAACAGATCTTTGGCTCAGATGG - Intergenic
1143386628 17:6534842-6534864 CAGGAGCTCTCAGGGACAGAAGG + Intronic
1146987137 17:37230702-37230724 AAGCCTGTCTCTAGGACAGAGGG - Intronic
1148050214 17:44766468-44766490 AAGCAGATGTCTAGGAGAGTGGG + Intronic
1148180307 17:45600590-45600612 GAGCAGGTCTCTGGCAGAGAAGG - Intergenic
1148268593 17:46245304-46245326 GAGCAGGTCTCTGGCAGAGAAGG + Intergenic
1148530900 17:48390304-48390326 TAGCATAGCTCTGGGACAAAAGG + Intronic
1148950568 17:51307529-51307551 AAACAGATCAATGAGACAGAAGG + Intergenic
1149051855 17:52314347-52314369 AGACAGATCTCTGGGTCATATGG - Intergenic
1149296100 17:55264079-55264101 ACGCAGATCTCGGGGACCGTGGG + Intergenic
1150730372 17:67687761-67687783 TAGCAGATCCCTGGGACTTAGGG + Intronic
1152400932 17:80065692-80065714 CACCGGATCTCTGGGACAGAGGG + Intronic
1153005403 18:494199-494221 AAACAGACCTCAGGGATAGAAGG - Intronic
1154938105 18:21081885-21081907 AAGAAAATCCCTGGGCCAGATGG + Intronic
1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG + Exonic
1155689457 18:28600833-28600855 CATCAGTTCTCTGGGACAGTTGG - Intergenic
1155922291 18:31615393-31615415 AAGAAGATTTCTGGGACAAAAGG + Intergenic
1156535404 18:37859742-37859764 ACGCAGAGCTCTGGAACACAGGG + Intergenic
1157019735 18:43766264-43766286 AATGAGATTTCTGGGACAAATGG + Intergenic
1159276112 18:66223339-66223361 AGACAGAGCTCTGGTACAGACGG - Intergenic
1159659251 18:71073567-71073589 AAGAAGATCTCAGGGATAGAGGG - Intergenic
1159776993 18:72613947-72613969 AAACACATCTCTGGGCTAGAGGG - Intronic
1160613756 18:80109066-80109088 GGGCAGTTCCCTGGGACAGAAGG + Exonic
1164708807 19:30339890-30339912 ACACAGATATCTGGGGCAGAAGG - Intronic
1164858459 19:31543640-31543662 CAGCAATTCTCTGGGGCAGAGGG + Intergenic
1166251889 19:41576985-41577007 ATGCAGACCCCTGGGAAAGAGGG + Intronic
1167971964 19:53193326-53193348 AAGCAGATCTCTTGGAGTGAAGG - Exonic
925242402 2:2343222-2343244 AACCAGATCTAAGTGACAGAGGG + Intergenic
927502593 2:23592377-23592399 AAGCAGAGCTCAGAGACAGCAGG - Intronic
928112140 2:28519366-28519388 ATGCAGGACTGTGGGACAGAAGG + Intronic
929830435 2:45342731-45342753 AAGCTGATCTGTGGGAGACAAGG - Intergenic
930380951 2:50627693-50627715 AAGTAGATCTCTGAGTCAGCAGG + Intronic
931204409 2:60133756-60133778 AGGCAGATCAATGAGACAGAAGG - Intergenic
931809172 2:65837846-65837868 AAGCAGTTCCCTGGGAAAGCAGG - Intergenic
932581558 2:72995559-72995581 AAGCAGGTCCTTGGGACAGAGGG - Intronic
933241452 2:79925721-79925743 AAACAGATCTGGGGGACAGAGGG - Intronic
933623172 2:84568195-84568217 AATGAGATTTCTGGGTCAGATGG - Intronic
934232842 2:90201265-90201287 ATGCAGATCCCATGGACAGAGGG - Intergenic
934587034 2:95509834-95509856 AAGCAGTTTTCAGAGACAGATGG + Intergenic
934617308 2:95781033-95781055 AGGCAGATCAATGAGACAGAAGG + Intergenic
934643585 2:96043526-96043548 AGGCAGATCAATGAGACAGAAGG - Intergenic
934836993 2:97599595-97599617 AGGCAGATCAATGAGACAGAAGG - Intergenic
934861781 2:97769761-97769783 AATCAGATCTCAGGCACTGAAGG - Intronic
935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG + Intergenic
937413497 2:121696631-121696653 AAGGAAATGGCTGGGACAGAGGG + Intergenic
938481493 2:131666063-131666085 AAGCAGAACTTTGGTAAAGAAGG - Intergenic
940449734 2:153822106-153822128 AAACAGAGCTCTGGACCAGATGG + Intergenic
943492086 2:188567253-188567275 AATGAGATCTCTGGGTCAAATGG - Intronic
943708346 2:191060241-191060263 AAGATGCTCTCTGGGACAAAAGG - Intronic
944263483 2:197699204-197699226 AAGGAGAACACTGGGACAGAGGG - Intronic
945685093 2:212959396-212959418 AGGAAGATCTCAGGGACACAAGG + Intergenic
945785349 2:214227952-214227974 AAGCAGCTCCCTGAGACAGATGG + Intronic
946412068 2:219520419-219520441 AAGGAGGTCGCTGGGACAGAAGG - Intronic
946867410 2:224054771-224054793 AAGAAGATCTATGGGACAGGAGG + Intergenic
947151108 2:227116360-227116382 AAGAACATCTCTGGGACTAATGG + Intronic
947244028 2:228027149-228027171 AAGCAAATCTGAGAGACAGAGGG + Intronic
947549019 2:231033310-231033332 ATGCAGATCTCTGTGCCAGCTGG - Intergenic
1169075744 20:2759018-2759040 AAGCACATCTCAGGGCCAGGTGG - Intronic
1169532807 20:6503817-6503839 AAGCAGAACACTGCAACAGAAGG + Intergenic
1169986901 20:11455366-11455388 AAACAGAGCTCTGGGGTAGAAGG - Intergenic
1170368255 20:15620090-15620112 AAGCAGTTCTCCAGGACAGAAGG + Intronic
1171039675 20:21749233-21749255 AGGCAGATCAATGAGACAGAAGG - Intergenic
1173496030 20:43518456-43518478 GAGAAGATCTATGAGACAGAAGG - Intronic
1173570772 20:44074640-44074662 AAGCAGAGCTCTAAGGCAGAAGG - Intergenic
1175819813 20:61902833-61902855 AATCAGCTCTCTGAGACAGGTGG - Intronic
1175978232 20:62724234-62724256 CAGCAGAGCCCTGGGACAGTGGG + Intronic
1177801922 21:25836229-25836251 AAGAAGATCCTTGGAACAGAGGG + Intergenic
1179936875 21:44611651-44611673 GAGCAGAACTCTGGGACAGGTGG + Intronic
1180864384 22:19107546-19107568 AGGCAGATGTTTGGGAAAGAAGG + Intronic
1181325729 22:22044387-22044409 AAAGAGAGCTCTGTGACAGAGGG - Intergenic
1181506361 22:23360894-23360916 AAGTAGTTCTCTGATACAGAAGG - Intergenic
1182862069 22:33568817-33568839 AAACACATATCTGGAACAGATGG + Intronic
1183472173 22:38015518-38015540 AAGCAGAAATCTGGGATTGAGGG - Intronic
949450264 3:4177119-4177141 AGACAGATCAGTGGGACAGAAGG + Intronic
951545533 3:23821341-23821363 CAGAAGACATCTGGGACAGAGGG + Intronic
951780108 3:26353433-26353455 AAGGAGATCTCTGGGTCTGCAGG + Intergenic
952643985 3:35633983-35634005 AAGCAGATCCCTGGGAACCATGG - Intergenic
954444900 3:50541330-50541352 ATGCAGGGATCTGGGACAGAAGG - Intergenic
954776900 3:53027617-53027639 TAGCTGACCTCTGGGGCAGATGG - Intronic
955151778 3:56374705-56374727 AAGCGCTTCTGTGGGACAGAAGG + Intronic
959524678 3:107363425-107363447 AAGCACATCTATGGGTCAGAAGG - Intergenic
959926015 3:111922802-111922824 AAGATGATCTCTGAGCCAGAGGG - Intronic
960197351 3:114785499-114785521 AAGAAGATTTTAGGGACAGAGGG + Intronic
960784185 3:121354242-121354264 AGGCAGATCAATGAGACAGAAGG - Intronic
960947879 3:122979279-122979301 AAGGCGATCTCAGAGACAGAGGG - Intronic
961069024 3:123903906-123903928 CAGCAGTTCTCTTGGAGAGAAGG + Intronic
962227551 3:133627793-133627815 AAACAGATCTCTAGCACAAATGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964237679 3:154552481-154552503 AAGAAAATTTCTGAGACAGAAGG + Intergenic
964660991 3:159120308-159120330 AAGCAGAGCTCTGCAACAGCTGG - Intronic
969911730 4:10453892-10453914 AAGGAGGTCCCTGGGACAGCTGG + Intronic
970526480 4:16937644-16937666 AAGCAACTCTCTGAGACAGGTGG + Intergenic
971486414 4:27165088-27165110 AAGTATATCTCTAGGATAGATGG + Intergenic
971904317 4:32706726-32706748 AAGCAAATCTCTGAGGGAGAAGG - Intergenic
973577105 4:52301340-52301362 AATCAGAACACTGGGACACAGGG - Intergenic
973818817 4:54644305-54644327 AAGCAGCTATCTGGGTCAGTGGG - Intergenic
975044376 4:69783543-69783565 AACCAGATTGGTGGGACAGAGGG + Intronic
975165409 4:71173100-71173122 AAGCACATACCTGTGACAGAAGG + Intergenic
977153497 4:93544124-93544146 AAGCAAATCTCTGGGAGAGCTGG - Intronic
977854149 4:101867410-101867432 AAGAAGTTCTTTGGGAAAGAAGG + Intronic
978163894 4:105583489-105583511 ATGCAGATATCTGGGAGAGGTGG - Intronic
981155810 4:141433437-141433459 AAGCAGATCTCTGAGAAGGTTGG - Intergenic
981215882 4:142167014-142167036 AATGAGATCGCTGGGTCAGATGG - Intronic
981308940 4:143276893-143276915 ATACAGAGCTCTGGGACAAAGGG + Intergenic
981653797 4:147089225-147089247 AAGCAGACCTCTAGGAAACAAGG + Intergenic
981660267 4:147158327-147158349 AGGCACAGCTCTGGGGCAGAGGG - Intergenic
983948712 4:173615098-173615120 ACACAGATCAATGGGACAGAAGG - Intergenic
984898459 4:184563318-184563340 CAGCACATATCTGGGACAGGAGG - Intergenic
986260082 5:6136558-6136580 AAGGAAATCTATGGGACAAAAGG - Intergenic
986626635 5:9729031-9729053 AAGCACATCTGTGGCACAGCTGG - Intergenic
988745894 5:34136945-34136967 AAGGAGATCACTTGGACACAGGG + Intergenic
990885336 5:60585168-60585190 AAGCAAATCTCTGAAAGAGAGGG - Intergenic
991406526 5:66305712-66305734 AAGCTGAACTGAGGGACAGAGGG + Intergenic
992643532 5:78791189-78791211 AACCAAATTTCTGGGACAGCTGG - Intronic
993639553 5:90385264-90385286 AAGAATATGTCTGGGATAGAAGG + Intergenic
994011263 5:94905676-94905698 GAGCAGATGTGTGGGACTGAAGG + Intronic
995979021 5:118078853-118078875 CAGCAGATCTCGGAGCCAGAGGG - Intergenic
996895799 5:128481055-128481077 AAACAGATCTTTGGGAAATAGGG - Intronic
997778530 5:136633724-136633746 AAGCACATGTCTGGAGCAGAAGG + Intergenic
997834007 5:137177808-137177830 AAGGAGATCTCTAGGGGAGAGGG + Intronic
1000256568 5:159544542-159544564 AAGCAGTTCTCAGGGAGGGAGGG + Intergenic
1000274104 5:159717472-159717494 AAGCAGATATCAGTGACAAAGGG - Intergenic
1000315902 5:160090906-160090928 AATCAAATCTTAGGGACAGATGG + Intronic
1001975156 5:175992814-175992836 TAGCAGATCTCTGGGCCGGTGGG - Intronic
1002242277 5:177850961-177850983 TAGCAGATCTCTGGGCCGGTGGG + Intergenic
1003391988 6:5722436-5722458 AAGCAGTGCGCTGTGACAGAGGG + Intronic
1004634549 6:17454222-17454244 AAGCAGATCCCTGGGATGCATGG + Intronic
1005544051 6:26845166-26845188 AAGGAGATCACTTGGACACAGGG + Intergenic
1006308195 6:33237879-33237901 AAGAAGATCTCAGTGACAAACGG + Intergenic
1007718508 6:43870931-43870953 AGGCAGATTTCTGGGAGAGGGGG - Intergenic
1008059693 6:46984426-46984448 AAGCTCATCTCTGGGAGAGATGG - Intergenic
1009014834 6:57886839-57886861 AAGGAGATCACTTGGACACAGGG + Intergenic
1009679174 6:66869970-66869992 AATCAGATCACTTGGACACAGGG - Intergenic
1012318105 6:97805788-97805810 AAGCAAAGCTGTGTGACAGATGG - Intergenic
1012484701 6:99707907-99707929 AAGGAGATCACTTGGACACAGGG + Intergenic
1013646302 6:112145114-112145136 AGGCAGACATCTGGGCCAGACGG + Intronic
1014336390 6:120142095-120142117 GAGCTGCTCTCTGGGTCAGAGGG - Intergenic
1015708410 6:136112811-136112833 AAGCACATGTTTGGGGCAGAGGG + Intronic
1017125475 6:151060485-151060507 GAGCTGACGTCTGGGACAGAGGG + Intronic
1017869423 6:158474279-158474301 AGGCAGATTCCTGGGACAGTCGG - Intronic
1017910453 6:158787748-158787770 AGGCAGACTTCTGGGACGGAAGG + Intronic
1018056032 6:160053218-160053240 AAGGAGATCACTTGGACACACGG + Intronic
1019278608 7:188796-188818 ATGCAAAGCCCTGGGACAGACGG - Intergenic
1021960054 7:25861922-25861944 ATGCAAAGATCTGGGACAGATGG - Intergenic
1022040207 7:26573908-26573930 AAGCACATCTCTGACACTGAAGG + Intergenic
1022826368 7:34018411-34018433 AAGCAGATATCTAGCACTGAAGG + Intronic
1024562411 7:50655697-50655719 AAGGAGGTCTCTGGCAGAGAGGG - Intronic
1026253590 7:68691556-68691578 AAGCAAATGGCTGGCACAGAAGG + Intergenic
1026538366 7:71259226-71259248 CTGCAGATCTCTGAGTCAGAGGG + Intronic
1027442982 7:78240176-78240198 AAGGAGATCACTTGGACACAGGG - Intronic
1027691404 7:81351000-81351022 AAGCAGAACTGTGGCTCAGAAGG - Intergenic
1028486495 7:91363948-91363970 ATTCAGATCTATGGGAAAGAAGG + Intergenic
1028516352 7:91681604-91681626 CCACAGATCTCTAGGACAGAGGG + Intergenic
1028927907 7:96380225-96380247 AAGCAGTTCTCTGGGAGGTAGGG + Intergenic
1029331978 7:99865119-99865141 AAGCAGGTCTCTGGCACACATGG + Intronic
1030773210 7:113500320-113500342 AAGCAGATATAGGGGACAGCTGG - Intergenic
1031939459 7:127772385-127772407 AAGCATCTCTCTAGGACTGAAGG - Intronic
1032439241 7:131929253-131929275 GATCGGATTTCTGGGACAGAGGG + Intergenic
1033754354 7:144385764-144385786 AAACAGATCTTTGGGAGAAATGG + Intergenic
1034349512 7:150407045-150407067 AACCAGATCTCAAGGACAGGGGG - Intronic
1035305504 7:157928905-157928927 AGGCAGAGGGCTGGGACAGAAGG + Intronic
1035326046 7:158066821-158066843 GAGCACATCCCTGGGACATATGG + Intronic
1035416182 7:158688962-158688984 AGGCACATCTCTGAGGCAGAAGG - Intronic
1035582040 8:746515-746537 GAGAAGATCTGTGGGATAGAGGG + Intergenic
1036112637 8:5920938-5920960 ATGCAGATGGCTGGGGCAGAGGG + Intergenic
1036611895 8:10357648-10357670 AAGCAGATTTCTTGGAGAAATGG - Intronic
1036622072 8:10430810-10430832 ATGCAGAGGTCTGGGAAAGAAGG + Intergenic
1037787587 8:21911957-21911979 AAGGAGCTCTCGGGGCCAGAGGG - Exonic
1039374577 8:37020457-37020479 CAGCAGATGTCAGGGGCAGAAGG + Intergenic
1039842236 8:41302513-41302535 AATCCGATCTCAGGGACACAAGG + Intronic
1041143091 8:54843541-54843563 AATCAGATCTCAGGAACAGATGG - Intergenic
1042023735 8:64400374-64400396 AATGGGATCTCTGGGACAAATGG + Intergenic
1042308471 8:67356499-67356521 AGACAGATCAATGGGACAGAAGG - Intergenic
1045795292 8:106036864-106036886 TAGGAGATGTCTGGGAAAGAAGG - Intergenic
1049114917 8:140677998-140678020 AAGGAGATGGCTGGGATAGAAGG + Intronic
1049375603 8:142287717-142287739 AGCCAGATCTCAGGGACAGTGGG + Intronic
1049375637 8:142287825-142287847 AGCCAGATCTCAGGGACAGTGGG + Intronic
1051232757 9:14969527-14969549 AGACAGATCACTGAGACAGAAGG + Intergenic
1052201294 9:25784319-25784341 AAGCAGATATCAGGGATTGAGGG + Intergenic
1052498825 9:29262107-29262129 AAGAAGAACTGTTGGACAGAGGG + Intergenic
1055427724 9:76213454-76213476 CATCAGATCTCAGGGACAGATGG - Intronic
1055661218 9:78505932-78505954 AAGCCAATTTCTGAGACAGAAGG + Intergenic
1055707566 9:79022928-79022950 AAGCAGACCCCTGGAAGAGAGGG - Intergenic
1059403984 9:114088821-114088843 AGGCAGAGCCCAGGGACAGAAGG - Intronic
1061168136 9:128936433-128936455 GTGCAGAGCTATGGGACAGAAGG - Exonic
1061906337 9:133701258-133701280 AACCAGCTCTCTGGGGCAGAGGG - Intronic
1185992053 X:4902174-4902196 AAGCAGATGTCTATGACAGGTGG + Intergenic
1188600363 X:31956188-31956210 TGGCAGATCTGTGAGACAGAAGG + Intronic
1188842735 X:35036647-35036669 AAGGAGATCTCCTGGACTGAGGG - Intergenic
1189017442 X:37299005-37299027 AGACAGATCAATGGGACAGAAGG - Intergenic
1192162987 X:68802595-68802617 TAGCAGCTCTCTCTGACAGATGG - Intergenic
1192523563 X:71823079-71823101 AAGGAGATCTCTGGGACTCGTGG - Intergenic
1192528927 X:71870116-71870138 GAGAAGATCTCTGGGACTCATGG + Intergenic
1192721569 X:73703988-73704010 AGACAGATCAATGGGACAGAAGG + Intergenic
1196862330 X:120040026-120040048 AAGCAGTTCCCTGGGGCTGACGG - Intergenic
1196880772 X:120196318-120196340 AAGCAGTTCCCTGGGGCTGACGG + Intergenic
1198244920 X:134821153-134821175 AAACAAATCACTGTGACAGAGGG + Intronic
1198691916 X:139293744-139293766 AAGCTCATCTCTGTCACAGATGG - Intergenic
1200071512 X:153531594-153531616 AAGCAGAACTCAGGGGCAGAGGG - Intronic
1201373140 Y:13286895-13286917 CAGCAGATCCCAGGTACAGAGGG + Intronic
1202015608 Y:20403042-20403064 AATGAGATCTCTGGGTCAAATGG + Intergenic