ID: 1155245461

View in Genome Browser
Species Human (GRCh38)
Location 18:23904486-23904508
Sequence TTTGGGGGGATGTCAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155245453_1155245461 30 Left 1155245453 18:23904433-23904455 CCATTTCTTAAAAAAAAAAAAGA 0: 9
1: 224
2: 3327
3: 32328
4: 145494
Right 1155245461 18:23904486-23904508 TTTGGGGGGATGTCAGCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155245461 Original CRISPR TTTGGGGGGATGTCAGCTGC TGG Intronic
900782517 1:4627271-4627293 TTTGTGGAATTGTCAGCTGCTGG + Intergenic
901437116 1:9254004-9254026 TGTGAGGTGATGTCAGTTGCTGG + Intronic
903565652 1:24263439-24263461 TTTGGGATGATGTAAGCTGTGGG + Intergenic
904499672 1:30906980-30907002 TCTAGGGGGCTGTCAGCTGGAGG - Intronic
906129111 1:43445478-43445500 TTGGGGGGGATGGCAGTTCCAGG - Intronic
908458361 1:64326064-64326086 TTCTGAGGGAAGTCAGCTGCTGG - Intergenic
915616523 1:157043723-157043745 TTTGGGACCATGTCAGCTACTGG + Intronic
915943721 1:160135274-160135296 TGTGGAGGGATGTCAGAGGCAGG + Exonic
920369858 1:205472012-205472034 TTTGGGGGGATGAAATGTGCTGG + Intergenic
922424977 1:225484209-225484231 TTTATGGGCATGTCAGCTGGCGG - Intergenic
924203518 1:241686253-241686275 ATTCTGTGGATGTCAGCTGCAGG - Intronic
1063730522 10:8691774-8691796 TTTGGGGCAATCACAGCTGCTGG + Intergenic
1068888216 10:62119901-62119923 TTTGGTGTGATGTTAGCTGAGGG + Intergenic
1069874966 10:71556231-71556253 TTTGGGGGGAAATGAGATGCTGG + Intronic
1070627650 10:78062569-78062591 CTTGGGGACATGTCTGCTGCTGG + Intergenic
1073148430 10:101295475-101295497 TTTGGGGGCAGGACAGGTGCTGG + Intergenic
1076206368 10:128607542-128607564 TTTGCTGGGAGATCAGCTGCTGG + Intergenic
1077071443 11:675928-675950 TGCTGGGGGATGTCAGGTGCTGG - Intronic
1077071497 11:676071-676093 CTGGGGGGGATGTCGGGTGCTGG - Intronic
1077071511 11:676107-676129 TGCTGGGGGATGTCAGATGCTGG - Intronic
1077071521 11:676140-676162 GCTGGGGGGATGTCAGGTGCTGG - Intronic
1077071546 11:676230-676252 GCTGGGGGGATGTCAGGTGCTGG - Intronic
1077071552 11:676248-676270 TGCTGGGGGATGTCAGGTGCTGG - Intronic
1077071569 11:676304-676326 GCTGGGGGGATGTCGGGTGCTGG - Intronic
1077071576 11:676322-676344 GCTGGGGGGATGTCGGGTGCTGG - Intronic
1079172043 11:18105804-18105826 TTTGTGGGGATGGCGGCTCCCGG + Intronic
1081003348 11:37702396-37702418 TTGGGGAGGAGTTCAGCTGCTGG + Intergenic
1081192807 11:40125177-40125199 TGTGAGGGGAAGTCAGCTGAGGG + Intronic
1082756599 11:57082974-57082996 TTTGGGGCGATTCCAGCTGCTGG - Intergenic
1083138734 11:60704073-60704095 TTTGAGGGGATGTCACCTTGCGG - Intronic
1084443204 11:69187780-69187802 TTGAGGCTGATGTCAGCTGCGGG - Intergenic
1084757863 11:71251051-71251073 TCTCGGGGGCTGGCAGCTGCTGG - Intronic
1088764529 11:112962748-112962770 GGTGGGGGGATGACAGCTGGAGG - Intronic
1089208961 11:116788065-116788087 TTTGGGGTGGTGGCAGCTGGCGG - Intergenic
1092282429 12:7108382-7108404 ACCCGGGGGATGTCAGCTGCTGG + Exonic
1100219941 12:92494018-92494040 TGTGGGCTGATGGCAGCTGCAGG - Intergenic
1101512219 12:105403554-105403576 TGAGGGGAGATGTCAGCTGGTGG - Intergenic
1104632854 12:130418962-130418984 TTTGGGGGGAAGACAGGTGTGGG + Intronic
1104911862 12:132243606-132243628 TTTGAGGGGATGACAGAGGCGGG - Intronic
1108695515 13:52899366-52899388 TTGTGGGGGAGGGCAGCTGCTGG + Intergenic
1108695692 13:52900588-52900610 TTGTGGGGGAGGGCAGCTGCTGG + Intergenic
1109273955 13:60283693-60283715 GTTGGGGGCATGTGTGCTGCCGG + Intergenic
1112434151 13:99378948-99378970 TTTGATGAGATGTCAGCTGGAGG + Intronic
1113848683 13:113405929-113405951 TGTGGGGCGATGGCAGCTGCAGG - Intergenic
1113856108 13:113446235-113446257 TCTGGGGGGTTTGCAGCTGCAGG - Intronic
1113957726 13:114108188-114108210 TGATGGGGGATGACAGCTGCGGG - Intronic
1115881779 14:37927432-37927454 TTTGGGGTGATTCCAGCTGTGGG + Intronic
1119263144 14:73250092-73250114 TCTGTGTGGATGGCAGCTGCCGG + Exonic
1119441471 14:74631389-74631411 CCAGGGGGGTTGTCAGCTGCAGG + Intergenic
1123169596 14:106359716-106359738 GCTGGGGGGAAATCAGCTGCAGG - Intergenic
1123173479 14:106396585-106396607 GGTGGGGGGAAATCAGCTGCAGG - Intergenic
1123701730 15:22918982-22919004 TTTTGGGGCAGGGCAGCTGCAGG - Intronic
1124830416 15:33143635-33143657 CTGGGTGGCATGTCAGCTGCAGG + Intronic
1124845306 15:33284204-33284226 TTAGTGGGGATGTAAGCAGCAGG + Intergenic
1124881080 15:33643295-33643317 TTTGGGAGGATGTGAGAGGCAGG - Intronic
1125755959 15:42065249-42065271 TGTGGGGGCCTGACAGCTGCTGG + Intergenic
1130285291 15:82549652-82549674 TTTGGGTGGTTTTCAGGTGCAGG - Exonic
1130625198 15:85507206-85507228 TTTGGGGGTGTGTGAACTGCTGG + Intronic
1132670113 16:1099056-1099078 TGTGGGTGGGTGGCAGCTGCAGG - Intergenic
1132832737 16:1937106-1937128 TTTGGGGCGATGCCAGCTGTGGG + Intergenic
1133947041 16:10357275-10357297 TTTGGGGGCATGTACGCGGCGGG - Intronic
1137709338 16:50555493-50555515 TGGGGGAGGAGGTCAGCTGCAGG + Intronic
1138581228 16:57941728-57941750 TTAGGTATGATGTCAGCTGCGGG - Intronic
1141578745 16:84982847-84982869 TTGGGGAGGCTGTGAGCTGCTGG + Intronic
1141715583 16:85725015-85725037 TTTCGGAGGATATCAGGTGCCGG + Intronic
1142953807 17:3506334-3506356 TTTGATGGGATGTAAGCTTCTGG - Intronic
1144579095 17:16447903-16447925 TGAGGTGGTATGTCAGCTGCCGG + Exonic
1144947565 17:18977706-18977728 TATGGGGGGCACTCAGCTGCCGG + Exonic
1147482728 17:40782327-40782349 TTTGGGGGCAGCTCATCTGCAGG - Exonic
1148851310 17:50556776-50556798 TTGTGGGGGATGTCAGCAGTGGG + Intergenic
1150197660 17:63317634-63317656 TTTGGGGGCTTGGCAGCTGTTGG - Intronic
1150867636 17:68870395-68870417 TTTGGGGTGATTCCGGCTGCAGG + Intronic
1152912462 17:83013217-83013239 TTTGGGGGTGTGTCAGGTCCTGG - Intronic
1153621655 18:6984537-6984559 TTTGGGGGGAAGGCAGCTAAAGG + Intronic
1153776821 18:8461799-8461821 TGAGGGGCTATGTCAGCTGCAGG + Intergenic
1155245461 18:23904486-23904508 TTTGGGGGGATGTCAGCTGCTGG + Intronic
1155750618 18:29418604-29418626 TTTAGGAGGATGTCAGTTGAAGG - Intergenic
1157585996 18:48801540-48801562 TGTGGGTGGATGTGAGCTTCAGG + Intronic
1159173339 18:64801857-64801879 TTAGGGGTGATGTTAGCTGTAGG - Intergenic
1159506929 18:69350783-69350805 TTAGGGGGAATATCAGCTTCAGG - Intergenic
1161540424 19:4847625-4847647 TCTGGGTGGGTGTCTGCTGCGGG + Intronic
1162471214 19:10872622-10872644 TTTTGGGGGATGTGAGAAGCTGG + Intronic
1165069318 19:33246785-33246807 TTTGGGGTGAGATCAGCTGGGGG + Intergenic
1167735785 19:51293884-51293906 TCTGGTGGGGTGTCAGCTTCAGG - Intergenic
1167767272 19:51491789-51491811 TGTGGGGGGCTGTCATCTGCCGG + Exonic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
926934193 2:18070882-18070904 TGTGGGGTGATGTCATCTCCAGG + Intronic
930236100 2:48890167-48890189 CTTGGGAGGCTGGCAGCTGCAGG + Intergenic
930547038 2:52781393-52781415 TTTTGTGGGATCTCAGCAGCTGG - Intergenic
932121708 2:69106778-69106800 TTTAGGGGGTTGTTTGCTGCAGG - Intronic
932135704 2:69226781-69226803 TTTGGGGGGATTTCAGCACCTGG - Intronic
932465779 2:71923191-71923213 TGTGGGGTGGTGTCAGCTACTGG + Intergenic
933528875 2:83479881-83479903 TTAGGGGGCATGTCAGTTGCAGG + Intergenic
934851863 2:97706919-97706941 GCTGGGGGGAGGGCAGCTGCGGG + Intergenic
936255244 2:110905302-110905324 TTAGGGGTGGGGTCAGCTGCAGG + Intronic
938173261 2:129101776-129101798 TCTGGGAGGATGTGAGCAGCAGG + Intergenic
940761461 2:157743175-157743197 CTTGGGAGGATGTGAGGTGCAGG - Intronic
944985197 2:205168195-205168217 TATGGGGGGATGCCAGAAGCGGG + Intronic
1169730251 20:8778275-8778297 CTTGGGGAGATTTGAGCTGCAGG + Intronic
1170030101 20:11935656-11935678 CTTGGGGGGTTTTCAGCTGCTGG + Intergenic
1171288927 20:23968901-23968923 TTTGGGGTGATGCCAGCTCTGGG - Intergenic
1171388065 20:24783522-24783544 GATGGCGGGAAGTCAGCTGCTGG - Intergenic
1172130668 20:32652734-32652756 TTTGGGGGGCTTCCTGCTGCTGG + Intergenic
1173300812 20:41800861-41800883 CATGTGGGGATTTCAGCTGCAGG + Intergenic
1174507229 20:51024229-51024251 TTTGGAGGGATCTGTGCTGCTGG + Intergenic
1175306427 20:57978901-57978923 TTTGGGGGGATGTGTGCTTGTGG - Intergenic
1176233168 20:64042188-64042210 GGTGGGGGGATGTCAGGTGCTGG + Intronic
1180065619 21:45410774-45410796 TTTGGGGTGACGTGAGCTGATGG + Intronic
1180215171 21:46318930-46318952 ATGTGGGGGATGTCAGCAGCAGG + Intronic
1181050810 22:20237464-20237486 TTTGGGGTCAGGCCAGCTGCTGG + Intergenic
1181647749 22:24242965-24242987 TTTGAGGGGATGCCAGCAGAGGG + Intronic
1182583527 22:31329264-31329286 TTTGAGTGGATGTCTCCTGCAGG + Intronic
1184256174 22:43288409-43288431 TTTGGGTGGAGGGCAGCTGTGGG - Intronic
949147635 3:721926-721948 TTTGGCTGGCTGTCAGCTGAGGG - Intergenic
949524425 3:4889114-4889136 TTTGGGGGGAGGTGGGGTGCAGG + Intergenic
950672825 3:14537424-14537446 TTTACTGGGATGTCAGCTCCAGG + Intronic
953465235 3:43114100-43114122 TTTGGGGGCATTGCAGCTACAGG - Intergenic
953750971 3:45608045-45608067 ATTGGGGGCAGCTCAGCTGCTGG + Intronic
954361629 3:50125450-50125472 TTTGGGGGGTTGGGAGCTGAGGG + Intergenic
955520423 3:59770431-59770453 TTTGCGTGCATGGCAGCTGCTGG - Intronic
956887014 3:73570478-73570500 TCTGGGGATATGTCAGGTGCAGG - Intronic
957440037 3:80233654-80233676 TTTGTGGGGAGGAAAGCTGCTGG + Intergenic
957787868 3:84905080-84905102 TTTGCGGGGATGGGAGGTGCAGG + Intergenic
961645921 3:128392758-128392780 TGTGGGGGGATGACAGAGGCTGG + Intronic
962644665 3:137424832-137424854 TTTGGGATGATGTTAGCTGTGGG - Intergenic
966150178 3:176859238-176859260 TTTGGGGACATGTCAGCAGTGGG - Intergenic
967041705 3:185699325-185699347 TTTGGGGTCAGGTCAGTTGCAGG - Intronic
968585673 4:1414897-1414919 TCTGGGGGGAGGGCAGCTGCGGG - Intergenic
971266869 4:25103472-25103494 CTCTGGGGGATGTCAGCTCCTGG + Intergenic
981911955 4:149992301-149992323 TTTAGCTGGCTGTCAGCTGCAGG - Intergenic
982357466 4:154486728-154486750 TTAGGGGGTAAGTCAGCTGTGGG + Intronic
984000283 4:174233077-174233099 TTTGGGGTAATGGCAACTGCTGG + Intergenic
985630734 5:1012730-1012752 TCTGGGGGAAGGCCAGCTGCAGG - Intronic
985999508 5:3619548-3619570 TCTGGGCTGATGCCAGCTGCGGG - Intergenic
988979314 5:36550107-36550129 TTAGGGATGATGTCAGCTGTAGG - Intergenic
991160955 5:63501992-63502014 TTTAGTGTGATGTCAGCTGTCGG + Intergenic
991313341 5:65270837-65270859 TTTGGAGGTATGTCAGAAGCTGG + Intronic
993569056 5:89513287-89513309 TTAAGAGGAATGTCAGCTGCAGG + Intergenic
993945329 5:94111476-94111498 TTTGCGGGGATGTGAGCTCCGGG - Intronic
995581572 5:113607891-113607913 TTTGCTGGCATGTCAGCTTCTGG - Intergenic
997096264 5:130916292-130916314 TTTGGCATGATGTCAGCTGTGGG - Intergenic
997909368 5:137854807-137854829 TTTGGGGGGACGTCAGCATTTGG - Intergenic
998650221 5:144110925-144110947 TTTAGTATGATGTCAGCTGCAGG - Intergenic
999822069 5:155238326-155238348 TTTGCAGGGATGTCAGCAGTAGG + Intergenic
999891597 5:155983891-155983913 ATTAGGGGGATGTCAGCAGAGGG - Intronic
1005005036 6:21279493-21279515 TTTGGGGGGATGACAGAGGGAGG - Intergenic
1008412729 6:51199430-51199452 TTTATGGGGATGACAGCTGTGGG + Intergenic
1009848552 6:69165390-69165412 TTGGGGGGGATGGCTGCCGCGGG - Intronic
1010320978 6:74509717-74509739 TTTGGTGTGATGTTAGCTGTGGG - Intergenic
1011573651 6:88769155-88769177 TTTGGGGGGAGGTGTGCGGCGGG + Intronic
1013111006 6:107065046-107065068 TTCCGGGGGATTTCAGCTTCTGG - Intergenic
1019524682 7:1475622-1475644 TTTGGGGCAGTGACAGCTGCTGG - Intronic
1020798231 7:12701575-12701597 TTTGTTGGGAGGTCAGCTGTTGG + Intergenic
1023141331 7:37105343-37105365 TTGGTGGGGAAGTCAGCTGGGGG - Intronic
1024358169 7:48439291-48439313 TTTGGCTGGCTGTCAGCTGGGGG + Intronic
1026445688 7:70482614-70482636 TTTGGGGGGAGGGCCTCTGCAGG + Intronic
1032252094 7:130266815-130266837 TTTGTAGGGATGGCAGCTGAGGG - Exonic
1035358039 7:158290557-158290579 TATGGGGGCATGTCTGGTGCTGG + Intronic
1035560197 8:598521-598543 TTTTGAGGAATGGCAGCTGCAGG - Intergenic
1036477193 8:9104080-9104102 TCTTGGGGGCTGTCAGCAGCAGG + Intronic
1037371239 8:18181689-18181711 TTTGGTATGATGTTAGCTGCGGG + Intronic
1039944194 8:42116060-42116082 TTTGGGGAGCTGGAAGCTGCTGG + Intergenic
1041255972 8:55979969-55979991 TCTGGAGGGCTGTCAGCTGCAGG - Intronic
1044392898 8:91673302-91673324 CTTGGGGTGATGTCAGTTGGTGG - Intergenic
1045438237 8:102185815-102185837 TTTGGGGGGAATTCTCCTGCAGG + Intergenic
1047821007 8:128520630-128520652 TATGGGATGATGTCAGCTGCAGG + Intergenic
1051684384 9:19642119-19642141 TTTGGGGAGGTGAAAGCTGCAGG + Intronic
1052437007 9:28443314-28443336 GTTGTGGGGATGCCAGCTGCAGG + Intronic
1057371482 9:94478739-94478761 GTTGGGGCGCTATCAGCTGCAGG - Intergenic
1058802908 9:108562155-108562177 CTTCTGGGGATTTCAGCTGCTGG - Intergenic
1059352526 9:113675848-113675870 GTTGGCGAGTTGTCAGCTGCTGG + Intergenic
1062206513 9:135340552-135340574 TTTGGGGGCAGTGCAGCTGCGGG - Intergenic
1062442684 9:136578233-136578255 TTTGTGGGGATTTCAGCAGGAGG - Intergenic
1186937872 X:14471056-14471078 TTTGGGGGGGTCTCAGCTGATGG - Intergenic
1187257226 X:17654398-17654420 CTTGGAGGGCTGCCAGCTGCTGG - Intronic
1197620578 X:128743233-128743255 TTGGTGGGGATGGCAGCTGGAGG + Intergenic
1199327535 X:146516633-146516655 TTCAGTGGGATGTCAGCTGTGGG + Intergenic
1199872317 X:151911207-151911229 TTTGGGGCGGTGTCAGTTGGAGG + Intergenic