ID: 1155247033

View in Genome Browser
Species Human (GRCh38)
Location 18:23920377-23920399
Sequence TACACCTGGATTGGAGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155247023_1155247033 23 Left 1155247023 18:23920331-23920353 CCTGAAGACAGGTCTAGGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1155247033 18:23920377-23920399 TACACCTGGATTGGAGCTACAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1155247021_1155247033 24 Left 1155247021 18:23920330-23920352 CCCTGAAGACAGGTCTAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1155247033 18:23920377-23920399 TACACCTGGATTGGAGCTACAGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155247033 Original CRISPR TACACCTGGATTGGAGCTAC AGG Intronic
903680290 1:25091971-25091993 GACACCTGGACTGGGGCTACAGG - Intergenic
904013611 1:27404368-27404390 GAGACCAGGCTTGGAGCTACAGG + Exonic
904824031 1:33263209-33263231 TACACCTGGCCTGGATCTACTGG + Intronic
904926130 1:34049592-34049614 TACACTTGGATTGGATCTTAGGG - Intronic
907652446 1:56308574-56308596 TACAGCTGTATTGGAGCCCCTGG - Intergenic
920132637 1:203744633-203744655 TGCACCTGGATGAGAGCTGCAGG - Intergenic
1064322663 10:14320245-14320267 GGCATCTGGATTGGAGCTGCAGG - Intronic
1067950914 10:50738211-50738233 AAGATCTGGATTGGAGGTACTGG + Intergenic
1068798275 10:61108885-61108907 AAGACCTGGATTGGAGTAACTGG + Intergenic
1070281710 10:75053801-75053823 GACACCTTGCTTGGAGCTGCGGG - Intronic
1078336570 11:10468021-10468043 TAAACCTGGAAGGGAGCAACCGG + Intronic
1080926774 11:36765655-36765677 TACACCTGGATTAGAAATATAGG - Intergenic
1083541166 11:63512318-63512340 TCTAACTGGATTGGAGCCACAGG - Intronic
1084031589 11:66484463-66484485 TACTCCTGGAGGGGAGCTCCAGG + Intronic
1091393035 12:137468-137490 TACAGCTGGATGATAGCTACGGG - Intronic
1104524941 12:129512234-129512256 TGCACCTGAATTGCAGCAACAGG + Intronic
1113054767 13:106256326-106256348 TACCCCTGGATTAGAGCCAGGGG - Intergenic
1113844217 13:113376737-113376759 TACACCTGGAATAGCGTTACTGG + Intergenic
1114714885 14:24814562-24814584 TGCATCTGGAATGGAGCTAAGGG + Intronic
1116036835 14:39637667-39637689 TACACATGGAAAGGAGCAACTGG - Intergenic
1126270822 15:46815052-46815074 TACATCTGCCTTGCAGCTACAGG + Intergenic
1131641771 15:94300897-94300919 TCTACCTGGATTGGAGGCACTGG + Intronic
1135965281 16:27030187-27030209 GACACCTTGATTGCAGCTTCAGG + Intergenic
1148804015 17:50254960-50254982 TACACCTGGATTGGAATTGGAGG - Intergenic
1150039350 17:61842329-61842351 TACAGCTAGATTGGAGAAACAGG + Intronic
1151769542 17:76151069-76151091 TAGGCCTGGACTGGAGCTGCTGG - Intronic
1155247033 18:23920377-23920399 TACACCTGGATTGGAGCTACAGG + Intronic
1158075172 18:53519784-53519806 TAGATCTAGATTGTAGCTACAGG - Intronic
1159576407 18:70183673-70183695 CACACCTGGAGTGGTGCTGCTGG - Intronic
1164391728 19:27828812-27828834 TACACCTGTAATGGAGTTGCTGG + Intergenic
929907435 2:46058490-46058512 TAAACCTGGCTTGGAGAAACAGG + Intronic
931780630 2:65576602-65576624 TACAACTGGATGGGTGCTCCTGG + Intergenic
932622611 2:73274082-73274104 TACAGATGGAATGGAGCTGCGGG - Intronic
933157778 2:78993665-78993687 TACAGCAGGATTGGGGCTCCCGG - Intergenic
933222318 2:79705047-79705069 TACATCTGGGTGGGTGCTACAGG + Intronic
935320870 2:101887822-101887844 TACAGATGGAATGGAGCTTCTGG + Exonic
937530389 2:122820522-122820544 TACACCAGGATGGGAGATGCTGG + Intergenic
943818430 2:192286274-192286296 CACAACTGGAGTGGTGCTACTGG + Intergenic
947333784 2:229058426-229058448 TACACCTAGAGTGGAGACACAGG + Intronic
1179831289 21:43998287-43998309 TCCACCTGGATTGAATCTGCTGG - Intergenic
950575922 3:13832017-13832039 CACACCAGGATAGGTGCTACAGG + Intronic
952104374 3:30052117-30052139 TACACCTGGAAAGGAACAACTGG + Intergenic
953516141 3:43593613-43593635 TAAACATGGATTGGAACAACCGG + Intronic
953820626 3:46204814-46204836 CACAGCTGGGTTGGAGCTCCAGG - Intronic
955093123 3:55771898-55771920 TACAACTGGATAGGAGCAAAAGG - Intronic
960949575 3:122990471-122990493 TACACCTGGTTGAGAACTACTGG - Intronic
961759244 3:129153459-129153481 TACAACTGGAAGGGTGCTACTGG - Intronic
964556124 3:157940745-157940767 TACACCTGGGTTGGGGGTACTGG - Intergenic
968074138 3:195807028-195807050 TACACGGGGAGTGGAGCTGCGGG + Intronic
968907751 4:3462532-3462554 GACAGCTGGACTGGAGCCACAGG + Intergenic
969714938 4:8863817-8863839 TCCACAGGGATCGGAGCTACTGG - Intronic
970601294 4:17642752-17642774 TACACCAGGCTAGGTGCTACAGG - Intronic
971802833 4:31315381-31315403 TACACCTTGAGAGAAGCTACAGG - Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
976565040 4:86543209-86543231 TACACCAGGAATTGAGCTATAGG + Intronic
981606847 4:146548677-146548699 TACAGCTTGATTGTAGCCACAGG + Intergenic
981657217 4:147125237-147125259 CACACCTGGCCTGGAGCTGCTGG + Intergenic
982720911 4:158859092-158859114 CATAGCTGGATTAGAGCTACAGG - Exonic
983825661 4:172256210-172256232 TGCAGCTGGATTGGATTTACAGG - Intronic
987860061 5:23473537-23473559 AACACCTGGACTAGAGATACAGG + Intergenic
991016974 5:61942825-61942847 ATCACCTGGATAGGAGTTACTGG - Intergenic
991735459 5:69627775-69627797 TACCTCTGGATTGGAGGGACAGG - Intergenic
991779460 5:70118405-70118427 TACCTCTGGATTGGAGGGACAGG + Intergenic
991811947 5:70483414-70483436 TACCTCTGGATTGGAGGGACAGG - Intergenic
991858752 5:70993878-70993900 TACCTCTGGATTGGAGGGACAGG + Intronic
991871912 5:71118762-71118784 TACCTCTGGATTGGAGGGACAGG + Intergenic
992391350 5:76334045-76334067 TAAACCTGAATTGGAGAAACAGG - Intronic
993438114 5:87923107-87923129 TACACATGGAGAGGAGCAACTGG - Intergenic
993967502 5:94375440-94375462 AACACCTGGAGTGGAGGGACAGG - Intronic
997778903 5:136637475-136637497 TACACATAGATTGGACCTATGGG + Intergenic
998268268 5:140683099-140683121 TACACCTGTATTTGAACTAAAGG - Exonic
999036653 5:148359116-148359138 TACACCTGGAGTGAAGCTCTAGG - Intergenic
1008097545 6:47354911-47354933 TCCACCCAGATTGGAGCTTCAGG - Intergenic
1036034953 8:5008506-5008528 TTCACCTGGTCCGGAGCTACTGG + Intergenic
1038153636 8:24965941-24965963 TACAAATGGATGGGAGCTATAGG + Intergenic
1040852430 8:51914724-51914746 TACACCTGGTATGGATGTACCGG + Intergenic
1043304962 8:78782829-78782851 TACCCCTGGGATGGAGCTTCTGG - Intronic
1048155434 8:131943767-131943789 TACACCTGGTTAAGATCTACTGG + Intronic
1055762070 9:79619770-79619792 TAGACATGGATTGGGGCTTCTGG + Intronic
1060276921 9:122189468-122189490 CACACCTGGAGTTCAGCTACTGG + Intronic
1189744083 X:44152018-44152040 TACACCTGAATTAGAGATGCTGG - Intronic
1190137318 X:47808551-47808573 GAGACCAGGCTTGGAGCTACAGG - Intergenic