ID: 1155247715

View in Genome Browser
Species Human (GRCh38)
Location 18:23925723-23925745
Sequence TGGAGTAAATGTAGAACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155247708_1155247715 25 Left 1155247708 18:23925675-23925697 CCCAGTGCAATCACATTCCTCTA 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1155247715 18:23925723-23925745 TGGAGTAAATGTAGAACTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 179
1155247709_1155247715 24 Left 1155247709 18:23925676-23925698 CCAGTGCAATCACATTCCTCTAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1155247715 18:23925723-23925745 TGGAGTAAATGTAGAACTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 179
1155247710_1155247715 8 Left 1155247710 18:23925692-23925714 CCTCTAGCAAGTATGTTCAGACC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1155247715 18:23925723-23925745 TGGAGTAAATGTAGAACTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 179
1155247707_1155247715 26 Left 1155247707 18:23925674-23925696 CCCCAGTGCAATCACATTCCTCT 0: 1
1: 0
2: 0
3: 9
4: 242
Right 1155247715 18:23925723-23925745 TGGAGTAAATGTAGAACTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155247715 Original CRISPR TGGAGTAAATGTAGAACTGT AGG Intronic
900391453 1:2435734-2435756 TGGAGAAGATGATGAACTGTGGG + Intronic
903763194 1:25713616-25713638 TGGAGTTTATATAGGACTGTTGG + Intronic
906034695 1:42742838-42742860 AGGGGTAAAGCTAGAACTGTAGG - Intergenic
909308067 1:74106840-74106862 TGGCATAAATACAGAACTGTGGG - Intronic
909869744 1:80723937-80723959 AGGAGTAAATTTAAAACTTTAGG + Intergenic
912006123 1:104903624-104903646 TGGAGTAAATGGAGATCATTTGG - Intergenic
915063570 1:153206549-153206571 AGGATTAAAGGGAGAACTGTAGG + Intergenic
915205391 1:154266928-154266950 TTGAGTAAATCTATAACAGTGGG + Intronic
917124496 1:171674548-171674570 TGGAGTAAGTTTACAACTGGGGG + Intergenic
918009814 1:180576323-180576345 TGGATGAAATGTAGAAAGGTGGG - Intergenic
918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG + Intergenic
919703893 1:200658007-200658029 TGGAGTAAATGTTCAAATCTTGG + Intronic
921721622 1:218478514-218478536 TGGAGAAGATGAAGAAATGTGGG - Intergenic
923933761 1:238736342-238736364 TGTAGTTAATGTATAACTGATGG + Intergenic
924671226 1:246128050-246128072 TGCAGTAAGGGTAGAAATGTAGG + Intronic
1065241896 10:23714106-23714128 TGGAGAAAAGGTAGAAGTCTAGG - Intronic
1067475779 10:46565018-46565040 TGGAATATATGTTGAACTGCTGG - Intergenic
1067618959 10:47776757-47776779 TGGAATATATGTTGAACTGCTGG + Intergenic
1068476823 10:57537380-57537402 GGGAGCAACTGTAGAACTCTTGG + Intergenic
1070514188 10:77188565-77188587 TGGAGTAAATGTTCAGTTGTAGG + Intronic
1071031153 10:81183043-81183065 TGGAGCAAAAGAGGAACTGTAGG + Intergenic
1071690001 10:87807427-87807449 TGGAGAGAATGTGGAACAGTAGG - Intronic
1075185514 10:120252750-120252772 TGGAGGAAATGAAGAAAGGTGGG - Intergenic
1078396496 11:10986347-10986369 AGGATTAAATGTAGACCTTTGGG - Intergenic
1079001129 11:16757462-16757484 TAGAGTAAATTTAGGTCTGTTGG + Intergenic
1079962356 11:26940368-26940390 TTGAGTAAATGTTGAAATGTTGG - Intergenic
1085286746 11:75367562-75367584 TGGAGTAATTTTAGATTTGTAGG - Intergenic
1086037224 11:82431297-82431319 TGGAGAAATTGTAAAGCTGTTGG - Intergenic
1086782774 11:90928828-90928850 GTGAGTAAATGTGGATCTGTTGG + Intergenic
1088849704 11:113694905-113694927 TGTAGTAAAGGTCGAAGTGTTGG + Intronic
1090083825 11:123633542-123633564 TTGAGTCTATGTAGAAATGTTGG + Exonic
1090298163 11:125608755-125608777 TGGATTGAATGTAAAATTGTGGG - Intronic
1090685583 11:129114749-129114771 TGGAAGAAATTTAGAAATGTGGG - Intronic
1090864151 11:130681691-130681713 TGGAGAAAATCCAGAACAGTGGG + Intronic
1092295372 12:7193012-7193034 TGGAGTTAAGGTAGAACAGTAGG + Intronic
1093201148 12:16187637-16187659 TGGAGTAAATGGAACACTGCAGG + Intergenic
1095438703 12:42220429-42220451 TCTAGTAAAGGAAGAACTGTTGG + Intronic
1095855688 12:46858325-46858347 TGGAATAAAAGTTGAACTTTGGG + Intergenic
1096693804 12:53336292-53336314 TGGAGTCAGAGTAGGACTGTAGG - Exonic
1098133718 12:67379303-67379325 GTCAGTAAATGTATAACTGTTGG - Intergenic
1099597953 12:84692556-84692578 TGGTATAACTGAAGAACTGTGGG - Intergenic
1105416352 13:20215592-20215614 TGGAAAAAATGTAGAATTGGTGG - Intergenic
1106096703 13:26652368-26652390 TGGAATAAAAATAGAACTGAGGG + Intronic
1106608777 13:31257584-31257606 TTGAGGAAAAGTAGGACTGTGGG + Intronic
1106725872 13:32485249-32485271 TGAAGTAAATGAAGAACAGTTGG + Intronic
1107427843 13:40312098-40312120 TGGAGTAAATATAGCATTTTGGG - Intergenic
1107512529 13:41099089-41099111 TGAAGTTAATCCAGAACTGTTGG + Intergenic
1108119089 13:47163628-47163650 TGGAGTAAAGGTAGAAAGATAGG + Intergenic
1108349183 13:49575026-49575048 TGGAGACAAAGTAGAATTGTGGG + Intronic
1109287106 13:60422490-60422512 TGGAGTAAATTTAATTCTGTTGG - Intronic
1109312113 13:60707812-60707834 GGGTGTGAATGTAGAGCTGTTGG + Intergenic
1110931314 13:81221869-81221891 TGGGGTAAATGGGGAAATGTCGG - Intergenic
1110933600 13:81253920-81253942 TGGACTGAATGTTGAACTGGAGG - Intergenic
1111184517 13:84714489-84714511 TTTGCTAAATGTAGAACTGTTGG - Intergenic
1116278107 14:42862810-42862832 TGAATTAAAGGTAGAATTGTAGG - Intergenic
1116346537 14:43802128-43802150 GGGAGGAAATGTAGAGGTGTAGG - Intergenic
1117667452 14:58071605-58071627 AGGAGTAAATGTAGAAATAAGGG + Intronic
1117844701 14:59898473-59898495 TTGAATCAATGTAGAACTATAGG - Intergenic
1119269038 14:73285227-73285249 TTGAGTAAATGTAAGACTGTGGG + Intronic
1125460729 15:39904477-39904499 TGGAATAGATAGAGAACTGTGGG + Intronic
1126047572 15:44657181-44657203 TGAAGTAAATGAAGAAATCTTGG + Exonic
1126254145 15:46605269-46605291 AGGAGCAAATGAAGAACTGTTGG - Intergenic
1126291585 15:47086359-47086381 TGGAGTAATTTTGGAAATGTAGG - Intergenic
1126645267 15:50869342-50869364 TGGAGTCAATGCAGAACTGCTGG + Intergenic
1130025639 15:80268395-80268417 TGGGGTAAAGGAAGAACTGAAGG + Intergenic
1131243749 15:90772035-90772057 TTGGGTAAATGTAAAAATGTAGG + Intronic
1133521707 16:6564645-6564667 TGGGGGAAATGGAGAGCTGTTGG + Intronic
1135579588 16:23614234-23614256 TTAGGTAAAAGTAGAACTGTGGG + Intronic
1138369159 16:56510952-56510974 TGGAGTAAATGGAGAAACGATGG - Intronic
1142529452 17:569441-569463 TGGAATAAATGTATACCTATAGG - Intronic
1147050599 17:37791511-37791533 TGGAGTCCATGTAGTACTGATGG + Intergenic
1147521786 17:41180375-41180397 TGGAGGAAATGAGGAAATGTTGG - Intergenic
1152349476 17:79776822-79776844 TGGAGAAAATACTGAACTGTAGG - Intergenic
1152973863 18:194025-194047 TGGGGGAAATGTAAAACGGTGGG - Intronic
1155247715 18:23925723-23925745 TGGAGTAAATGTAGAACTGTAGG + Intronic
1155727446 18:29105763-29105785 TGGATTAAATGGAGAAGAGTTGG + Intergenic
1156561754 18:38133476-38133498 TGAAGTAAAAGCAGAGCTGTGGG + Intergenic
1157086212 18:44582483-44582505 TGGAGTAATTTTAGAGCTGATGG + Intergenic
1158776636 18:60589989-60590011 TGGAGATAATGTAGAAATATAGG - Intergenic
1164863617 19:31583703-31583725 TGGAGAAAAAGTAGCCCTGTTGG + Intergenic
1165750300 19:38255597-38255619 TGTAGCATATGTTGAACTGTAGG + Intronic
1168143724 19:54407174-54407196 TTGGGTAAAAGTAGAATTGTTGG + Intergenic
930181360 2:48361776-48361798 TGGATTAAAAAAAGAACTGTTGG + Intronic
931417069 2:62091483-62091505 TGGAGTCAATCCAGAACTGCTGG + Intronic
936688915 2:114862704-114862726 AGGAGTAAAAGGAGAAATGTAGG + Intronic
937782346 2:125853591-125853613 AGGTGTAAATGTAAAACTGGTGG - Intergenic
939359044 2:141145455-141145477 TGGAGTAAATTTAACAGTGTTGG + Intronic
941691824 2:168508217-168508239 TTGAATAAATGTATAACTTTAGG + Intronic
943411143 2:187549965-187549987 TGGAACAAATGTACAAATGTGGG - Intronic
948339570 2:237238587-237238609 TGGAGTAAATAATGAAGTGTGGG - Intergenic
1171506416 20:25639047-25639069 TGCAGTAAAAGTTGAACTTTGGG + Intergenic
1171991440 20:31699614-31699636 TGGAATAAATGAAGGATTGTTGG - Intronic
1177938517 21:27380311-27380333 GAGAGTAAATGTATAACTGAAGG + Intergenic
1180915416 22:19482716-19482738 TGGAGCTAATGTAGACCTATTGG + Exonic
1184880596 22:47302044-47302066 TGGAGGAAACGCAGATCTGTGGG + Intergenic
949529443 3:4939764-4939786 TGCTCTTAATGTAGAACTGTAGG + Intergenic
951495143 3:23317216-23317238 TCAAGTTAATTTAGAACTGTGGG + Intronic
952359163 3:32612441-32612463 TGGAGTACATGTTTTACTGTTGG - Intergenic
952984130 3:38762527-38762549 TGGAGTATTTGCAGAACCGTAGG + Intronic
953911878 3:46897357-46897379 TGGAGAAAATGTATTTCTGTGGG - Intronic
957542532 3:81592276-81592298 TGGAGGAAATGGAGAGATGTTGG - Intronic
957544737 3:81622971-81622993 TTGAGCAGATGTAGAACTGGTGG - Intronic
957570401 3:81940461-81940483 TGGGGTAAATGAGGAGCTGTTGG - Intergenic
958531717 3:95340984-95341006 TACAGAAAATGTAGAACTATAGG - Intergenic
963878624 3:150503630-150503652 TGGAGCAAATGAACAAATGTTGG + Intergenic
964503523 3:157374073-157374095 TGGAGTAAATGAATAACAGCTGG + Intronic
966013047 3:175105198-175105220 GGGAGGAAATGAAGTACTGTGGG - Intronic
966435630 3:179880951-179880973 TGGTGGAAAGGTAGAGCTGTAGG - Intronic
969876410 4:10138782-10138804 TTGGGTAAAAGTGGAACTGTTGG + Intergenic
970917186 4:21349733-21349755 TTGAGTACAGGGAGAACTGTGGG - Intronic
971565709 4:28138159-28138181 TGGCCTAAATGAAGAAATGTGGG - Intergenic
972093564 4:35319527-35319549 TGCATAAAATGTAGAACTGTTGG + Intergenic
973280067 4:48350693-48350715 TGGAGGAAATGAACAACTTTAGG + Intronic
973660046 4:53095628-53095650 TGAATGAAATGTAGAGCTGTTGG - Intronic
974995260 4:69148293-69148315 TGGACTAAAGGCAGAAATGTAGG - Intronic
975523899 4:75328623-75328645 TGGCCTGAATGAAGAACTGTAGG - Intergenic
976812181 4:89109770-89109792 TTGAGAAAATCTAGAAATGTGGG + Intronic
977720400 4:100233214-100233236 TGCAATAAAAGTTGAACTGTGGG + Intergenic
978648810 4:110975097-110975119 TGGAGTCATTGTAGAATTGGAGG - Intergenic
978871331 4:113581843-113581865 TTAAGTAAAAGTAGATCTGTAGG + Intronic
979828676 4:125272851-125272873 TGTAGCAAGTGTAGTACTGTGGG + Intergenic
979943619 4:126795983-126796005 TGGAGAAAATGGAGAGATGTTGG - Intergenic
980479589 4:133370356-133370378 TGGAGAAAGTGTTGAACTTTAGG + Intergenic
980656890 4:135800238-135800260 TGAAGGAAATGAAGAAGTGTAGG - Intergenic
982287502 4:153750334-153750356 TGGAGTAGCTGTAGAAATGCTGG - Intronic
982326562 4:154135274-154135296 TGGAGTACAGATAGGACTGTAGG - Intergenic
982429893 4:155310821-155310843 TGGAGTAAGTGAAGAAGAGTAGG + Intergenic
982898473 4:160965839-160965861 TAGAGGAAATGTGGAAATGTTGG - Intergenic
984948436 4:184988394-184988416 TGGAGCTAAAGTAGAAGTGTTGG - Intergenic
987816983 5:22915452-22915474 TGGCATAAATGTTGAGCTGTAGG + Intergenic
988121902 5:26974971-26974993 TGGGGAAAATGGAGAGCTGTTGG - Intronic
988192747 5:27961006-27961028 TGGGGTAAATGTAGAAATTAAGG - Intergenic
990055894 5:51577608-51577630 TGGAGTAAATGTAGGGGTGCAGG - Intergenic
990691275 5:58367145-58367167 TGTAATAAATGTACAACTGAGGG + Intergenic
991992625 5:72356108-72356130 TGGAGTAAGTTTAGAAAAGTAGG + Intronic
994749072 5:103716166-103716188 TGGAATCTATGTAGAAGTGTGGG - Intergenic
994872697 5:105373724-105373746 TGGAGGAAATGAAGAGCTGTTGG - Intergenic
995754029 5:115483459-115483481 TGGAGTAAATGTGAAAGTTTAGG - Intergenic
999200180 5:149810654-149810676 TGGATCTAATGTAGAACTTTTGG + Intronic
999852328 5:155555447-155555469 TGGAGAAAATTTTGAAATGTTGG - Intergenic
1001853119 5:174986790-174986812 TGGAGGAAATGGAGAAGTGGTGG - Intergenic
1007007568 6:38380032-38380054 TGGAGTAAATGAAGAAAGGTGGG + Intronic
1008147473 6:47908849-47908871 GAGAGTAAATGTAAAACTGTAGG + Intronic
1008949937 6:57145750-57145772 TGCGGTAAATGTACAAGTGTAGG + Intronic
1009462400 6:63930085-63930107 TGAAGTAAAGGTGGAACTGGCGG - Intronic
1010924253 6:81724413-81724435 TGGATTAAATGGAGGACTGAAGG - Intronic
1011339575 6:86298972-86298994 TGGAGTAAATGCAGAAGGGTGGG + Intergenic
1011451903 6:87502003-87502025 TAGAGTAAATATTCAACTGTAGG - Intronic
1012771081 6:103436240-103436262 TGGAGTCAAAGTAAAACTTTAGG - Intergenic
1013336500 6:109168317-109168339 TGAAGTAAATGGAGAAGTGGGGG + Intergenic
1013569337 6:111405533-111405555 TGTAGTCAATGAAGAGCTGTAGG + Exonic
1014637545 6:123866728-123866750 AGAAGCAAATGTAAAACTGTGGG - Intronic
1018514395 6:164562660-164562682 TGCTGAAATTGTAGAACTGTTGG + Intergenic
1020790386 7:12620337-12620359 TAGAGGAAATGGAGAAATGTTGG - Intronic
1021258300 7:18422049-18422071 TGGAGTAAAAGTAGAATAGAAGG - Intronic
1021662940 7:22939261-22939283 TGGAATAAATATAGAAGAGTAGG + Intergenic
1023174661 7:37424119-37424141 TGGAGGAAATGATGATCTGTTGG - Intronic
1023523444 7:41072612-41072634 TGGAGTAAATGAAGAATGGTAGG + Intergenic
1026837775 7:73649708-73649730 TGGAGTAAATGTAAGAGTCTGGG - Intergenic
1027646245 7:80803207-80803229 AGGAGTGAATGTAAAACTGTTGG - Intronic
1030198323 7:106875739-106875761 TTGAGTAAATGTTTAACAGTGGG + Intronic
1030541782 7:110839511-110839533 TGGGGTAAAGGTACAGCTGTAGG - Intronic
1030871484 7:114761294-114761316 TGCAGTTAAAGTAGACCTGTAGG + Intergenic
1031768653 7:125813237-125813259 TGGAGCTTATGTTGAACTGTTGG - Intergenic
1032648425 7:133851566-133851588 GGGAGTGAATGAAGATCTGTGGG + Intronic
1033521520 7:142165907-142165929 TGGAGTCATTGTGGAAGTGTTGG - Intronic
1033986376 7:147230728-147230750 TGGAGTAAATGAGGAGATGTTGG - Intronic
1034078874 7:148258351-148258373 TGGAGCAAATGTAGATGTGTGGG - Intronic
1041433225 8:57807958-57807980 TGGGGAAAATGAAGAGCTGTTGG + Intergenic
1042740662 8:72041213-72041235 TGGAGCAAACTTAGAACTGAAGG + Intronic
1043636074 8:82383904-82383926 GGGAGTAAATGTAAAGATGTTGG - Intergenic
1043739643 8:83794662-83794684 TGGAGAAAATGTAGAGCAATAGG + Intergenic
1046018766 8:108638093-108638115 GGGTGTGAAAGTAGAACTGTGGG + Intronic
1047567210 8:126058667-126058689 TGGAGAAAAAGTATAACTATTGG + Intergenic
1050971783 9:11886547-11886569 GAGAGTAATTGTAGAACTGCTGG - Intergenic
1051846440 9:21456531-21456553 TTGAGTAAATGGCAAACTGTGGG + Intergenic
1055328623 9:75159034-75159056 AGGAGGAAATTTAGAACTGAGGG + Intergenic
1056160662 9:83889015-83889037 TGCAATAAATATAGAAGTGTAGG - Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058828136 9:108793237-108793259 GTGAGTAAATGCAGATCTGTCGG + Intergenic
1059998332 9:119935308-119935330 TGTAGGAAACATAGAACTGTTGG - Intergenic
1186847943 X:13550031-13550053 TGGAGTAAATGGTGAATTATAGG - Intergenic
1187725935 X:22202157-22202179 TGGGGAAAAAGTAGTACTGTTGG - Intronic
1187770228 X:22687473-22687495 TGGAAAAAATGGAGAAATGTGGG - Intergenic
1189626066 X:42898254-42898276 TCCAGTAAATATAGACCTGTAGG + Intergenic
1192145259 X:68677919-68677941 TGGATCAGATGTAAAACTGTTGG + Intronic
1192957381 X:76087198-76087220 TGGAGGAAATATAGAAATGTAGG + Intergenic
1193956169 X:87866008-87866030 TGGAGTAAGTAAAGAAGTGTGGG - Intergenic
1195065179 X:101233496-101233518 TGGAAACAATGTGGAACTGTTGG + Intronic
1195226231 X:102796862-102796884 TGGAGTAATTGAAGTATTGTTGG - Intergenic
1197550271 X:127884457-127884479 CTTAATAAATGTAGAACTGTAGG - Intergenic
1199172375 X:144746251-144746273 TGGAGTCAATCCAGAACTGCTGG - Intergenic
1199646083 X:149914059-149914081 TGGAGAAAATGGAACACTGTTGG + Intergenic
1201465607 Y:14277162-14277184 TGCAGTTAATGTAAAACTGCTGG + Intergenic