ID: 1155248668

View in Genome Browser
Species Human (GRCh38)
Location 18:23935380-23935402
Sequence TGGGCTTCAGCAGATAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155248661_1155248668 20 Left 1155248661 18:23935337-23935359 CCAGGTGCAGAAATTTGGTGGGA 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1155248668 18:23935380-23935402 TGGGCTTCAGCAGATAGGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 178
1155248659_1155248668 21 Left 1155248659 18:23935336-23935358 CCCAGGTGCAGAAATTTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1155248668 18:23935380-23935402 TGGGCTTCAGCAGATAGGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155248668 Original CRISPR TGGGCTTCAGCAGATAGGGT GGG Intronic
900435790 1:2629923-2629945 TGGGCTTCAACAGGAAAGGTGGG - Intronic
900575833 1:3382091-3382113 TGCGCATCAGCAGTCAGGGTGGG + Intronic
900605933 1:3523546-3523568 TGGGCTGTGGCAGGTAGGGTAGG - Intronic
902455728 1:16532864-16532886 TCGGCTTCAGTAGATGGGGTCGG + Intergenic
902496444 1:16875048-16875070 TCGGCTTCAGTAGATGGGGTCGG - Intronic
905259531 1:36707752-36707774 AGGACTCCAGGAGATAGGGTGGG - Intergenic
905697022 1:39982024-39982046 TGGCTTTCAGCAGATGGGTTTGG + Intergenic
907314974 1:53562561-53562583 TGGGACTCAGCTGAGAGGGTGGG - Intronic
908855396 1:68421151-68421173 AGGGCTTCAGCAAATGGGGGAGG - Intergenic
909139104 1:71840869-71840891 TGGCCTTCAGCTGATTGGATGGG - Intronic
909379717 1:74984631-74984653 TGGGCTTGAGAAGATAGCTTTGG - Intergenic
910996826 1:93114356-93114378 TGGGCGACAGCAGATAGAGAAGG - Intronic
911500080 1:98674605-98674627 TGGGCTTCAGCATATAAATTTGG + Intronic
911726053 1:101242046-101242068 TGTGGTTCAGAAGATAGGCTGGG - Intergenic
913661097 1:121007161-121007183 TCGGCTTCAGTAGATGGGGTTGG + Intergenic
914012465 1:143790338-143790360 TCGGCTTCAGTAGATGGGGTTGG + Intergenic
914165367 1:145170845-145170867 TCGGCTTCAGTAGATGGGGTTGG - Intergenic
914651094 1:149698948-149698970 TCGGCTTCAGTAGATGGGGTTGG + Intergenic
916509101 1:165455419-165455441 TGGGATTCATCTAATAGGGTGGG - Intergenic
917771429 1:178283867-178283889 TGGGTTTCACAAGATAGGGCTGG + Intronic
918381746 1:183962864-183962886 TGGGCTTCAGCTGAAAGGACAGG - Intronic
920415681 1:205797894-205797916 TGGCCATCAGCAGGTAGGCTGGG - Exonic
1063544696 10:6969397-6969419 GGGGCCTCAGGGGATAGGGTGGG + Intergenic
1064991460 10:21260267-21260289 GGCTCTTAAGCAGATAGGGTTGG - Intergenic
1065697636 10:28394368-28394390 TGGGCATGAGCAGATGGTGTGGG + Intergenic
1066064127 10:31750112-31750134 TGGGCTTCAGGGGAGAGGGGAGG + Intergenic
1067834890 10:49632455-49632477 AGGGCTTCAGCTGAGAGGGTTGG - Intronic
1074383166 10:112996517-112996539 TGGCCTTCAGCATTTAGTGTTGG + Intronic
1077341111 11:2026751-2026773 TGGGCAGCAGCATAAAGGGTGGG + Intergenic
1079102101 11:17548056-17548078 AGGGCTTTAGCACTTAGGGTGGG + Intronic
1080747307 11:35119742-35119764 TGGGCTGGAGCAGTGAGGGTGGG + Intergenic
1083339806 11:61951774-61951796 TGGGCTGCAGCAGGTGGGCTTGG - Intronic
1083481203 11:62948911-62948933 TGGCCTTCTGCAGATTGGCTTGG + Intronic
1086994691 11:93342530-93342552 AGGGCTGCAGCAGATATTGTGGG - Intronic
1088333470 11:108677112-108677134 TGGACTTCAACAGATGGGCTGGG + Exonic
1088916244 11:114230055-114230077 TGGGCTTCAACCGAGAGGGCGGG - Intronic
1089075645 11:115736423-115736445 TGGGCATCATCAGTTAGGGGCGG + Intergenic
1089169369 11:116501410-116501432 TGGGCTGCAGCTGCTTGGGTGGG - Intergenic
1089383226 11:118050920-118050942 AGCTCTTCTGCAGATAGGGTGGG - Intergenic
1090260261 11:125314344-125314366 TGGGCGGCAGCAGATGGGTTGGG + Intronic
1202824096 11_KI270721v1_random:81940-81962 TGGGCAGCAGCATAAAGGGTGGG + Intergenic
1095845064 12:46735362-46735384 TTGGCTGCAGCCAATAGGGTTGG - Intergenic
1096529281 12:52233175-52233197 TGGGCTTCCACAGGTAGGGGCGG - Exonic
1096750202 12:53753787-53753809 TGGGCTGCAGCAGAGAGCCTGGG + Intergenic
1096978188 12:55712344-55712366 TGGGCTTCAAGAGAGGGGGTTGG - Intronic
1099274822 12:80561397-80561419 TGGGCTTCAACAGAGAAGGTAGG + Intronic
1101220057 12:102629552-102629574 AGGGTGTCAGGAGATAGGGTAGG - Intergenic
1102524969 12:113505989-113506011 GGGGCTGCAGCAGAGAGAGTGGG - Intergenic
1103865545 12:124049239-124049261 TGGGCCTCAGGAGGTGGGGTGGG - Intronic
1111380543 13:87444437-87444459 TGGGCTACAGCTGATACTGTAGG + Intergenic
1113529044 13:111006599-111006621 TCGGGCTCAGCAGAGAGGGTGGG + Intergenic
1119735325 14:76977892-76977914 TGGGCTGGTGGAGATAGGGTAGG - Intergenic
1120496507 14:85243853-85243875 TGGTCTTCAGAAGAAAGTGTGGG + Intergenic
1122116821 14:99531917-99531939 AGGGCTTCAGCAGGTAGTGAGGG - Intronic
1122406548 14:101504390-101504412 TGGGTTTCAGAAGATGGTGTGGG + Intergenic
1122567244 14:102668536-102668558 AGGGCTTCAGCAGATAGCCGAGG - Intronic
1123808276 15:23897453-23897475 TGGGCATCAGCAGGTGGGGCGGG + Intergenic
1123827317 15:24095252-24095274 TTGGTTTCAGGAGATGGGGTGGG + Intergenic
1123861346 15:24470579-24470601 TTGGTTTCAGGAGATGGGGTGGG + Intergenic
1126411147 15:48374303-48374325 TGGGCTACAGCAAAGAGAGTGGG - Intergenic
1130829470 15:87584709-87584731 TGGGCTTCAGCAGGTGGGGAGGG - Intergenic
1131566339 15:93489092-93489114 TGGGCTTCACCAGATAGAATAGG + Intergenic
1131926366 15:97388339-97388361 TGGGCTTAAGCAGATTAAGTTGG + Intergenic
1132049159 15:98592451-98592473 TGAGCTTCATGAGAAAGGGTTGG + Intergenic
1132250285 15:100330921-100330943 TGGGCCTCAGCAGAAGGGCTGGG + Exonic
1132405059 15:101536909-101536931 TGGGCAGCAGCAGATGGGGCGGG - Intergenic
1135561225 16:23478585-23478607 TGGGCCACAGCAGCTTGGGTGGG - Intronic
1135895795 16:26401102-26401124 TGGTCTTCAGCAGGTGGGCTGGG + Intergenic
1136022120 16:27446929-27446951 TGGGCTGCAGCAGGTGGGGCTGG - Intronic
1136073572 16:27803316-27803338 AGGGCTGCCGCAGAGAGGGTCGG - Intronic
1136136311 16:28258838-28258860 TGGCCTCCAGGAGAGAGGGTTGG - Intergenic
1138171500 16:54854134-54854156 TCATCCTCAGCAGATAGGGTGGG + Intergenic
1138958135 16:61996193-61996215 TGTGCTTCAGGGGATTGGGTTGG - Intronic
1139478951 16:67217757-67217779 AGGGCTTCAGCAGAGAGGGTTGG - Intronic
1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG + Intergenic
1140248032 16:73268878-73268900 TGGGCAACTGCAGACAGGGTGGG + Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147566516 17:41539533-41539555 GGGGCTTCAGAAGAAAGGGCTGG + Intergenic
1147675185 17:42200378-42200400 TGGGCTACAGCAGGTAGTGGAGG - Exonic
1148648037 17:49230437-49230459 TGGGCTCCGGGAGATAGGGGAGG - Intronic
1150299341 17:64035593-64035615 AGGGCTTCAGGAGACAAGGTGGG + Intergenic
1152146798 17:78573233-78573255 AGGGCTTCAGCAGATGGATTTGG - Intronic
1152380637 17:79940853-79940875 TCGGCTTCCGCAGATAGGTCGGG - Exonic
1153656566 18:7288110-7288132 TGGGTTTCAGAATACAGGGTTGG + Intergenic
1155248668 18:23935380-23935402 TGGGCTTCAGCAGATAGGGTGGG + Intronic
1155538666 18:26843931-26843953 TGGGACTCAGCAGAGTGGGTTGG + Intergenic
1157581557 18:48776873-48776895 TGGGCTGCAGGAGATCCGGTGGG + Intronic
1157670346 18:49523337-49523359 TGGGCTCCAACAATTAGGGTGGG - Intergenic
1159264929 18:66068616-66068638 TAGGGTTGAGCAGATAGTGTGGG - Intergenic
1162359121 19:10206952-10206974 TGGGCTGCAGCGGAGAAGGTAGG - Intronic
1162782027 19:13011490-13011512 TGGACTTCAGGAGTGAGGGTGGG + Intronic
1166855796 19:45782154-45782176 GGGGCTCCTGCAGATGGGGTGGG - Intronic
1202706620 1_KI270713v1_random:29221-29243 TCGGCTTCAGTAGATGGGGTCGG + Intergenic
926111813 2:10188576-10188598 TGGGCTTCAGCATATGGATTTGG + Intronic
927495657 2:23550013-23550035 TGGGCTGGAGCAGGCAGGGTAGG - Intronic
927965117 2:27263306-27263328 TGGGCTTCAGGAGCGAGGCTTGG - Intronic
928289078 2:30021561-30021583 TTGGATTCAGGAGATAGTGTTGG - Intergenic
929492678 2:42409766-42409788 TGGGTTTAAGGAGACAGGGTGGG - Intronic
930007492 2:46909737-46909759 TGGGCTGCAGCCTAGAGGGTAGG + Intronic
930373470 2:50534286-50534308 TGGGCTGCAGAAGATAGGCTAGG + Intronic
934516575 2:94991833-94991855 GGGGCTTCAGTAGCTAGTGTGGG - Intergenic
936491578 2:112977221-112977243 TTGGCTACAGCAGATAGGATGGG + Intronic
937261639 2:120590372-120590394 TGGGTTGCATTAGATAGGGTTGG - Intergenic
937865525 2:126748551-126748573 TGGGCTCCTGAAGAGAGGGTAGG + Intergenic
937871477 2:126789274-126789296 TGGCCTACAGGAGAGAGGGTGGG - Intergenic
940274619 2:151926025-151926047 TGGAATTCAGGAGATAGGTTAGG + Intronic
944659782 2:201911805-201911827 TAGGCTTCAGCTGATTGTGTTGG - Intergenic
946029871 2:216695285-216695307 TTGGCTGCAGCCGAGAGGGTGGG + Exonic
947049951 2:226031086-226031108 TGGGATTCTGCAGAGAGGGGAGG - Intergenic
948087721 2:235265505-235265527 TCTGCTTCAGCAGACAGCGTGGG + Intergenic
948189156 2:236044919-236044941 TGGAGTGCAGCAGAAAGGGTAGG + Intronic
1170199292 20:13725146-13725168 TCTGCATGAGCAGATAGGGTAGG - Intronic
1172010383 20:31842934-31842956 TGGGGTTCAGCAGGCATGGTGGG + Intergenic
1173859306 20:46271878-46271900 TGGGCTTCAGAGGAGAGGTTAGG - Intronic
1175626251 20:60490411-60490433 TGGTTTACAGCAGATAGGGGAGG - Intergenic
1175952845 20:62592581-62592603 TGGGTTTCATCAGAGAGGATGGG + Intergenic
1178041204 21:28642664-28642686 TGGCTTTCAGCAGAAAGGGATGG + Intergenic
1184144946 22:42604408-42604430 TTGGATTCAGCATCTAGGGTGGG - Intronic
1184232043 22:43163476-43163498 TGGGCTTCAGCAGAGGGAGGGGG + Intergenic
1184871214 22:47239663-47239685 TGGGCTTCAGGAGATGAGGCAGG - Intergenic
1185013661 22:48331301-48331323 TGGGCTTCAGAAGCCTGGGTAGG - Intergenic
1185221068 22:49629549-49629571 TGGGCTGGAGCAGACAGGCTGGG + Intronic
949871266 3:8591381-8591403 TGGGCCTCTGCACATAGTGTGGG + Intergenic
950146414 3:10653281-10653303 TGGGCTGCAGCAGATAAGAGTGG - Intronic
952746078 3:36781803-36781825 TTGGCTTCAGAAGAGAGAGTGGG - Intergenic
953179986 3:40585965-40585987 TGGTCTTCAGCAGCTGGGGGAGG + Intergenic
954269370 3:49495605-49495627 TTGGCTGCAGCAGCTAGAGTAGG - Intronic
957121288 3:76097200-76097222 GTGGCTGCAGCACATAGGGTTGG - Intronic
957136854 3:76299281-76299303 GGGGCTTCAGTAGCTAGGGCAGG + Intronic
959902153 3:111673546-111673568 TGGGGCTCAGGAGATAAGGTGGG + Intergenic
963871939 3:150426156-150426178 TGGGCTACTGCAGAAAGGGTTGG - Intronic
964007734 3:151851912-151851934 TGGGCCTGAGCACCTAGGGTAGG - Intergenic
966214118 3:177483686-177483708 TGGTCTTCAGCAGATTTGTTTGG - Intergenic
968517573 4:1021279-1021301 TCGGCTTCTCCACATAGGGTGGG + Intronic
969444914 4:7239263-7239285 TGAGCTTCTGCAGAAAGGCTGGG + Intronic
972399692 4:38689118-38689140 GGCGCTTCACCAGATGGGGTGGG + Intronic
974892499 4:67898743-67898765 AGGGTTTCATCAGATTGGGTAGG - Intergenic
977912831 4:102557721-102557743 TGGGCAATAGCAGTTAGGGTGGG + Intronic
979306612 4:119152300-119152322 TAGACTCCAGCAGATGGGGTAGG - Intronic
980133408 4:128837309-128837331 TGGACCTCAGCAGAAATGGTGGG + Intronic
983909224 4:173218051-173218073 TTGGCTTCTGGAGACAGGGTAGG + Intronic
984187802 4:176567474-176567496 TTGGCTTCAGAATATAGGGCAGG + Intergenic
985027033 4:185748210-185748232 GGGGCTTCATCAGGTAGGGCTGG + Intronic
985665782 5:1180957-1180979 AGGGCCCCAGCAGATGGGGTCGG - Intergenic
987012411 5:13781136-13781158 TGGGCTGCATCAGACGGGGTGGG + Intronic
988789211 5:34591905-34591927 TGGGCTGCAGCAGATGCTGTTGG - Intergenic
990531770 5:56681409-56681431 TGGCCTTCTGCAGAGAAGGTGGG - Intergenic
991918006 5:71624258-71624280 AGGGCTTCAGCAGATGAGTTCGG + Intronic
996191581 5:120549650-120549672 TTGGCTAAAGTAGATAGGGTGGG + Intronic
997197617 5:131990309-131990331 TGGGCTTCAGCAGATTAGACAGG - Intronic
997579980 5:135011074-135011096 TGGGCATCAGGAGCTACGGTGGG + Intronic
998377925 5:141703262-141703284 TGGGCTTCAGAAGATAGCTGTGG - Intergenic
998613651 5:143716463-143716485 TGGGCCTCGGCAGAGATGGTTGG - Intergenic
999872203 5:155764579-155764601 TGGGCTCCAGCAGTTTGGCTTGG - Intergenic
1002426878 5:179181821-179181843 TGGGCTTCAGCAGATATCAAAGG + Intronic
1006638681 6:35477465-35477487 TGGGCCTCAGCAGAAAGGCTGGG - Intronic
1006728171 6:36215032-36215054 TTGGCTGCAGCAGAGGGGGTGGG + Intronic
1007785631 6:44277733-44277755 AGGGCTTCAGCTCATAGGATAGG - Exonic
1009513491 6:64582929-64582951 TGGGTTTCAGCAGATACAGTTGG + Intronic
1010010090 6:71039035-71039057 TTGGGTTCAGAAGATAGGGTGGG - Intergenic
1011683783 6:89807762-89807784 TAGGCTTAAACAGACAGGGTGGG - Intronic
1012404506 6:98879687-98879709 TGGGTTTCACCATATTGGGTAGG - Intronic
1012583993 6:100900197-100900219 TTGGCTTCAGAAATTAGGGTGGG - Intergenic
1013426768 6:110019311-110019333 TGGGCTTCAGAACAGAAGGTGGG - Intergenic
1013954296 6:115822653-115822675 TGGGCTTCTGGAGAGAGGGCTGG + Intergenic
1018739391 6:166715639-166715661 TGGGCTACACCAGATAGCCTCGG - Intronic
1018881073 6:167881661-167881683 TAGCCTTCAGCAGTTAGGGTAGG - Intronic
1019520149 7:1457181-1457203 TGGGGTTCAGTAGATATGGTAGG - Intronic
1020984279 7:15112931-15112953 TGGGCTTCAGCAGGTTGTGCAGG + Intergenic
1021471104 7:21003198-21003220 CTGGCTGCAGCAGACAGGGTGGG - Intergenic
1021677953 7:23099709-23099731 TTGGCATCACAAGATAGGGTTGG + Intergenic
1024465055 7:49703485-49703507 TGGCCTCCAGCAGACAGGGCAGG - Intergenic
1024676410 7:51641628-51641650 TAGGCTTGAGCAGGTAGGGCAGG + Intergenic
1031483955 7:122306774-122306796 CGGGCTTCAGCAGCTAGGCCTGG + Intronic
1033438692 7:141358562-141358584 TGGGACTGAGAAGATAGGGTAGG - Intronic
1033614935 7:143004892-143004914 AGGGCATCAGCAGCTAGGGATGG + Intergenic
1035142611 7:156777883-156777905 TGGGGTTCAGCAGGAAAGGTAGG - Intronic
1036552653 8:9828748-9828770 CAGGCTTCAGCAGAGCGGGTGGG - Intergenic
1038781908 8:30575388-30575410 TGCTCTTCAGCAGATGGGGAGGG - Intergenic
1039044777 8:33439905-33439927 AGGGTTTCATCAGACAGGGTGGG - Intronic
1044312780 8:90713189-90713211 AGGACTTCAGCAGTTAGGATAGG + Intronic
1046241891 8:111507148-111507170 TCTGCTTCAGGGGATAGGGTGGG + Intergenic
1047358844 8:124149045-124149067 TGGGCTTTAGGAGATAACGTTGG - Intergenic
1047522441 8:125605451-125605473 AGGGCTTCAGCAGATAAATTTGG + Intergenic
1048423377 8:134299373-134299395 TGGGCTGCAGCATTTAAGGTTGG + Intergenic
1048529509 8:135234615-135234637 TGTGCTTCAGCTGATGGGGGCGG + Intergenic
1058473473 9:105305427-105305449 TGGGACCCAGCAGATAGGGCAGG - Intronic
1059819029 9:117951242-117951264 TGTGCTTTAGCAGAGCGGGTGGG - Intergenic
1060383980 9:123205296-123205318 TGTGCTTCAGCAGACAGAGGAGG - Intronic
1060489649 9:124073370-124073392 GGGGCTTCAGCACATGCGGTGGG + Intergenic
1061883999 9:133582504-133582526 TGGGGTTCAGCAGTCGGGGTAGG - Intronic
1061953731 9:133950750-133950772 TGGGCTGCAGCAGAGAGGAGGGG - Intronic
1186430968 X:9503793-9503815 TGGGCCTCAGCCCATAGGGGAGG + Intronic
1191148768 X:57198097-57198119 TGGGTTTCTGCAGTTAGGGGTGG + Intergenic
1191228482 X:58072725-58072747 TTGGATTTAGCAGACAGGGTGGG - Intergenic
1192420788 X:71028339-71028361 TGGGCTTAGGCTGAGAGGGTGGG + Intergenic
1194535539 X:95102129-95102151 TGGGCTCCAGCAGATTCTGTTGG - Intergenic
1195317558 X:103693760-103693782 TGGGAGTGAGCAGATATGGTTGG + Intergenic
1195655598 X:107328819-107328841 GGGGCTGCAGCAGAAAGGATGGG - Intergenic
1196170916 X:112587668-112587690 TTGTCTTCAGCTGCTAGGGTGGG - Intergenic