ID: 1155248946

View in Genome Browser
Species Human (GRCh38)
Location 18:23937517-23937539
Sequence CAGGGAGGCGGGTGTCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155248939_1155248946 -3 Left 1155248939 18:23937497-23937519 CCTGAATGCATGATAGAGGCCAG No data
Right 1155248946 18:23937517-23937539 CAGGGAGGCGGGTGTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155248946 Original CRISPR CAGGGAGGCGGGTGTCCATG AGG Intronic