ID: 1155250001

View in Genome Browser
Species Human (GRCh38)
Location 18:23945256-23945278
Sequence CTTTGCTTGCGGAGGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155249994_1155250001 -4 Left 1155249994 18:23945237-23945259 CCCACATGGCTGCTATTGCCTTT 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1155250001 18:23945256-23945278 CTTTGCTTGCGGAGGCTGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 162
1155249988_1155250001 23 Left 1155249988 18:23945210-23945232 CCAGGGGGCAAGAGTAGCAGCAG 0: 1
1: 0
2: 3
3: 32
4: 289
Right 1155250001 18:23945256-23945278 CTTTGCTTGCGGAGGCTGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 162
1155249995_1155250001 -5 Left 1155249995 18:23945238-23945260 CCACATGGCTGCTATTGCCTTTG 0: 1
1: 0
2: 0
3: 20
4: 195
Right 1155250001 18:23945256-23945278 CTTTGCTTGCGGAGGCTGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155250001 Original CRISPR CTTTGCTTGCGGAGGCTGTG GGG Intronic
900680282 1:3912643-3912665 CTGTGTTTGCGCTGGCTGTGAGG - Intergenic
901089698 1:6633079-6633101 CTCTGCGTCCGGAGCCTGTGGGG - Exonic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
904507953 1:30974657-30974679 CTGTCCTTGCTGAGCCTGTGGGG + Exonic
904977842 1:34472278-34472300 TTGTGCTTGTGGAGGGTGTGTGG - Intergenic
905347130 1:37318775-37318797 CTGTGCTTCAGGAGGGTGTGGGG + Intergenic
905627541 1:39498679-39498701 CTTGGCCTGCAGAGGCTGTGGGG + Intronic
905668883 1:39778429-39778451 CTTGGCCTGCAGAGGCTGTGGGG - Intronic
906513711 1:46425729-46425751 ATTTGTTTGCTGAGCCTGTGAGG - Intergenic
907236272 1:53051723-53051745 TTTTGATTGGGGAGGCAGTGTGG + Intergenic
907307072 1:53519350-53519372 CTTTTCTTCCTGAGGCTGTTTGG + Intronic
908187939 1:61670592-61670614 CTGTCCTTCCGGAGGCTGTAGGG - Intergenic
910108393 1:83655773-83655795 CTTTGCCTGCTGAGGATGGGAGG - Intergenic
911943239 1:104073539-104073561 CTCTGCGTCCGGAGCCTGTGGGG - Intergenic
919748857 1:201024381-201024403 CTCTGCTTGTTGTGGCTGTGGGG + Intergenic
920061274 1:203228619-203228641 CTGTGCTTCCGTAAGCTGTGGGG - Intronic
920308522 1:205034167-205034189 CTGAGCTGGCAGAGGCTGTGAGG - Intergenic
920440694 1:205978737-205978759 CTGTGCTTGGGCAGGCAGTGGGG + Exonic
922809401 1:228407309-228407331 CTTGGCCTGCCAAGGCTGTGAGG - Intergenic
923724151 1:236491869-236491891 CTGTGGCTGCGGGGGCTGTGAGG + Intergenic
924038350 1:239958214-239958236 CATTGCTGGAGGAGGCTGTGTGG - Intergenic
1062923879 10:1299826-1299848 CTGTGCTTCCGGAGGCCATGCGG + Intronic
1062931650 10:1356735-1356757 CTTTGCTTGAGAAGGCTGGAGGG - Intronic
1064082654 10:12321051-12321073 CTTTGTTTGGGGAGGGTGAGGGG - Intergenic
1067156167 10:43782980-43783002 CCTTGCTGGCTGAGTCTGTGGGG - Intergenic
1068885240 10:62091262-62091284 GTTTGCCAGCGGTGGCTGTGTGG - Exonic
1071359404 10:84830796-84830818 CTCTGCTTCCAGAGGCTCTGTGG + Intergenic
1075718921 10:124573839-124573861 CTTAGCTGTCGGGGGCTGTGGGG + Intronic
1075903436 10:126061774-126061796 CATTGCTTTGGGAGGCTCTGGGG - Intronic
1076553907 10:131309289-131309311 CTTGGCTTGCAGTGGCTGTTTGG - Exonic
1076869420 10:133186107-133186129 CCTTGGTTGGGGAGGCTCTGGGG - Exonic
1078611174 11:12820726-12820748 CTTGGCCTGTGCAGGCTGTGGGG + Intronic
1078720088 11:13876172-13876194 CCTTGCTTGCTCAGACTGTGTGG - Intergenic
1081464199 11:43301212-43301234 CGTTGCTTCCAGAGGCTCTGGGG - Intergenic
1083737051 11:64687409-64687431 CTTGGCATCCGGAGGCAGTGAGG - Intronic
1084607745 11:70182348-70182370 CTCAGCATGCCGAGGCTGTGCGG + Intronic
1095832353 12:46601499-46601521 CTTAGCTTGCTGGGTCTGTGGGG + Intergenic
1096162321 12:49389182-49389204 CTTTGCGTGAGAAGGCTGGGCGG - Intronic
1096887522 12:54732469-54732491 ACTTGCTTGCAGAGGCTCTGGGG + Intergenic
1100404584 12:94262479-94262501 CTTTGCTCAAGGAGGCTGTTTGG - Intronic
1100676972 12:96878751-96878773 ATTTGCTTGCATAGGATGTGTGG + Intergenic
1103925928 12:124423316-124423338 CTCTCCCTGCGAAGGCTGTGGGG - Intronic
1104896481 12:132167352-132167374 CTGTGCGTGCTGAGGCTGTTGGG + Intergenic
1105316335 13:19268109-19268131 GCTTTCTTGCTGAGGCTGTGGGG - Intergenic
1105888971 13:24668491-24668513 CACTGCTTGCTGAGGCTGAGGGG + Intergenic
1106083625 13:26521239-26521261 CTTTGCTTGGGGAGGTAGAGTGG - Intergenic
1107630364 13:42336433-42336455 CTTTCCTTCTGGAGGCTCTGAGG - Intergenic
1107904884 13:45052757-45052779 CTTTGCATTTGAAGGCTGTGTGG - Intergenic
1110103789 13:71644564-71644586 CTTTTCTTGCGGAAGATCTGAGG - Intronic
1112814970 13:103263221-103263243 GGTTGTTTGCAGAGGCTGTGGGG + Intergenic
1112818524 13:103302520-103302542 GTTTGTTTGCGGTGGCTCTGTGG + Intergenic
1113003866 13:105676941-105676963 CTTTTCCTGGGGAGGCTTTGAGG - Intergenic
1114307494 14:21437188-21437210 CTTTACCTGCAGTGGCTGTGGGG + Intronic
1116370301 14:44121918-44121940 CTTTGCTTGCAGAGGCTCTTTGG + Intergenic
1118514286 14:66508820-66508842 CTTTGCTTCCGAAGGCGCTGGGG - Intronic
1120311780 14:82837902-82837924 GGTTGCTTCCGGAGGCTCTGAGG - Intergenic
1121293655 14:92798410-92798432 CTTTATTTGTGGAGGATGTGGGG - Intronic
1129974877 15:79813533-79813555 CATTGGTTGGGGAGGCTGAGTGG + Intergenic
1130653501 15:85775786-85775808 CCTGGGTTGCAGAGGCTGTGGGG + Intronic
1131458585 15:92602667-92602689 CTGAGCTTGCGAAGGCTGAGTGG - Intergenic
1133730665 16:8576104-8576126 CTCTGCTTGGGCAGCCTGTGAGG - Intronic
1137922254 16:52501986-52502008 TTTTACTTGCGGAGGCAGGGAGG - Intronic
1139883505 16:70192776-70192798 CTGTGCCAGCAGAGGCTGTGGGG - Intergenic
1140369005 16:74402743-74402765 CTGTGCCAGCAGAGGCTGTGGGG + Intergenic
1141018150 16:80469431-80469453 CTTTGCCATGGGAGGCTGTGTGG + Intergenic
1142302239 16:89265507-89265529 CTTCCCTTCCGGAGGCTCTGAGG - Intergenic
1142972720 17:3623652-3623674 CTTTGCTTGGGGCAGCTGGGAGG - Intronic
1144542570 17:16158962-16158984 CTTTGCTTGCAGATTCTGTAGGG + Intronic
1149556604 17:57577929-57577951 CTTTGCTTGCGGGTGGTGTGGGG - Intronic
1150816571 17:68396688-68396710 GTTTGCTGGGGGAGGCTGGGTGG - Intronic
1151192617 17:72409423-72409445 CTTTTCTTGCTGAGGCTGCAGGG - Intergenic
1152629165 17:81402080-81402102 CTGCGCTTGGGGAGGCTGGGAGG - Intronic
1152746004 17:82039603-82039625 CATTGCTTCCCGAGGCTTTGGGG + Intergenic
1155250001 18:23945256-23945278 CTTTGCTTGCGGAGGCTGTGGGG + Intronic
1158505821 18:58044879-58044901 CTCGGCTTGCGGAGGGTGGGGGG - Intronic
1158624719 18:59061219-59061241 CTTTGTTTGCCTAGGCTTTGTGG + Intergenic
1159950749 18:74481123-74481145 CTCTGCTTGCGGACTCTGTGTGG + Intergenic
1159988785 18:74877320-74877342 CTTTCATTGCGGAGGCTGTGAGG - Exonic
1160259089 18:77274365-77274387 CTTTGCCTGCAGAGCCTGGGTGG - Exonic
1160503363 18:79413380-79413402 CTGTTCTTTTGGAGGCTGTGAGG + Intronic
1166948241 19:46410314-46410336 ATTTGCTAGCGGTGCCTGTGTGG - Intergenic
926385559 2:12332664-12332686 CCTTTCTTGCTGAGGTTGTGGGG + Intergenic
930019446 2:46992561-46992583 CGTAGCTTCCTGAGGCTGTGGGG - Intronic
930706081 2:54506238-54506260 ATGTGCTTTCGGAGGTTGTGAGG + Intronic
931451099 2:62368446-62368468 GCTTGCTTTGGGAGGCTGTGTGG + Intergenic
934658728 2:96131944-96131966 CTGTGCTGGCAGCGGCTGTGTGG - Intronic
935374021 2:102377266-102377288 CTTTACTTCTGGAGGCTGTAGGG + Intronic
936052583 2:109235975-109235997 CTTTACTTTAAGAGGCTGTGGGG + Intronic
936086553 2:109473444-109473466 TTTTATTTGGGGAGGCTGTGGGG + Intronic
937789802 2:125945998-125946020 AGTTGCTTGTGAAGGCTGTGGGG - Intergenic
945106773 2:206323666-206323688 CTTTGCCTGCAGAGCCTATGTGG - Intergenic
947495840 2:230635991-230636013 ATTTGATTGGTGAGGCTGTGGGG + Intergenic
1169293789 20:4375332-4375354 CTTGGCTCCAGGAGGCTGTGGGG - Intergenic
1170730760 20:18972955-18972977 ATTTGTTTGCTAAGGCTGTGGGG - Intergenic
1173321984 20:41996913-41996935 CATCGCTTGGGGAGGGTGTGGGG + Intergenic
1176177098 20:63733867-63733889 CTGTGCCTGAGGAGGCCGTGTGG + Intronic
1177672662 21:24253201-24253223 TTTTGCTTGTGGAGGGTGTTTGG + Intergenic
1179434448 21:41350569-41350591 CATTGATTGCAGAAGCTGTGCGG - Intronic
1179553129 21:42156021-42156043 CTTTGCCTGGGGAGGCCATGCGG - Intergenic
1181480786 22:23197989-23198011 CGTGGGTTGCGGAGGGTGTGTGG + Intronic
1182362173 22:29753080-29753102 CTGTGCCTGGGGAGGCTGTCCGG + Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
953903191 3:46854778-46854800 ATCTGCTTCAGGAGGCTGTGTGG - Intergenic
954929899 3:54272365-54272387 CTGGGCTTGGGGAAGCTGTGGGG + Intronic
958165708 3:89876202-89876224 AATTGTTTGTGGAGGCTGTGGGG + Intergenic
960011238 3:112835964-112835986 CTTTGCCTACTGCGGCTGTGGGG - Intronic
962249944 3:133829783-133829805 CTTTCCTTGCCTTGGCTGTGAGG + Intronic
963107385 3:141658932-141658954 GTTTCCTTACGGAGGCTTTGGGG + Intergenic
968614154 4:1569816-1569838 CTTTTCTTGGGGAGACTTTGGGG + Intergenic
968997818 4:3956241-3956263 CTTTACCTGCGGAGGGTTTGAGG + Intergenic
972864295 4:43211362-43211384 CTCTGGTTGGGGAGGCTGTTGGG + Intergenic
973943358 4:55932677-55932699 ATTTGCTTGCTCAGGGTGTGGGG - Intergenic
974401957 4:61419584-61419606 GTTTGCATGTGGAGTCTGTGTGG - Intronic
974670156 4:65019944-65019966 TGTTTCTTGTGGAGGCTGTGAGG + Intergenic
974670213 4:65020627-65020649 GTTTCCTTGTGGAGACTGTGAGG - Intergenic
975365192 4:73520896-73520918 CTGAGCTTGCTTAGGCTGTGGGG + Intergenic
982080156 4:151781747-151781769 CTTTGTTTGCTGAGGCTGGAGGG + Intergenic
984869059 4:184310951-184310973 CTTTGCTGGAGGAAGCTGGGAGG - Intergenic
986377553 5:7148133-7148155 TTTGGCTTGGGGAGGCTGGGAGG - Intergenic
987152306 5:15055753-15055775 AGGTGCTTGGGGAGGCTGTGGGG + Intergenic
989750286 5:44884297-44884319 CTCTGCTTGCGGGGGAGGTGTGG - Intergenic
990070133 5:51772293-51772315 CTTTGCTTGCCTATGCTTTGGGG - Intergenic
995620600 5:114021468-114021490 CTTAGCTTGCTGACTCTGTGGGG - Intergenic
996570624 5:124929363-124929385 CAGTGCTGGCTGAGGCTGTGTGG + Intergenic
998104077 5:139457253-139457275 CTGAGCATGTGGAGGCTGTGGGG - Intronic
1000187857 5:158878331-158878353 CTTTGATTTGGGAGGCTCTGTGG - Intronic
1000485380 5:161835716-161835738 CTCTCCTTGCTGAGGCTATGTGG + Intergenic
1001031212 5:168264713-168264735 CCATGCTTGGGGAGGCTCTGAGG - Intergenic
1001089220 5:168724975-168724997 CTTAGCTTCCGGAAGCTGTTGGG + Intronic
1002793459 6:451731-451753 CTCTGCTTGTGGTAGCTGTGTGG + Intergenic
1004004800 6:11628725-11628747 CTCTGCCTTTGGAGGCTGTGAGG + Intergenic
1004483262 6:16040701-16040723 CTCTGCTTGCGGGGGAGGTGTGG - Intergenic
1004558841 6:16728026-16728048 TTTTGCATGAGGAGGCTGTGAGG + Intronic
1006639349 6:35481172-35481194 GTTTGCCTGCGGAGGCTGCGAGG - Intronic
1006749274 6:36366496-36366518 CATTGCTTGGGAAGGCTGGGAGG - Exonic
1011019318 6:82793839-82793861 CTTTGGTTGCCTATGCTGTGGGG - Intergenic
1011208092 6:84923236-84923258 CTTTGCTTGTGAAGGCTGGGAGG - Intergenic
1015153563 6:130064979-130065001 CTTTGCATGGGGTGGCTGTAGGG + Intronic
1015568187 6:134595269-134595291 CCTTGCCTGAGGAGGCTGGGCGG + Intergenic
1016799303 6:148152784-148152806 CTTTTCATGGGGAGGCTGGGGGG + Intergenic
1016956075 6:149627912-149627934 CTTAGGTTCCAGAGGCTGTGGGG + Intronic
1018209786 6:161469711-161469733 CATTCCTTCTGGAGGCTGTGGGG - Intronic
1018398980 6:163403606-163403628 CTCTGCATGGAGAGGCTGTGGGG + Intergenic
1019514060 7:1432078-1432100 CTGTGCTGCAGGAGGCTGTGAGG - Intronic
1020086309 7:5312671-5312693 CTTGGGCTGCAGAGGCTGTGTGG + Exonic
1022520057 7:31000439-31000461 CATTGCTTCCGGAACCTGTGCGG + Intergenic
1023945859 7:44802678-44802700 CTTTGGTTATGGAGGCTTTGAGG + Exonic
1025207998 7:57004401-57004423 CTTGGGCTGCAGAGGCTGTGTGG - Intergenic
1025663953 7:63572474-63572496 CTTGGGCTGCAGAGGCTGTGTGG + Intergenic
1028333270 7:89622711-89622733 CATTCCTTGCAGAGACTGTGAGG + Intergenic
1029353733 7:100034382-100034404 CTTTCCCTGCAGGGGCTGTGTGG - Exonic
1035462793 7:159055445-159055467 CTTTGCTTACCAAGGCTCTGTGG - Intronic
1035495917 7:159326005-159326027 TTTGGCTTGGGTAGGCTGTGTGG + Intergenic
1035576802 8:713269-713291 ATTTGCTGGTGGCGGCTGTGAGG + Intronic
1037600015 8:20385930-20385952 CATTGCTGGTGGAGGGTGTGGGG + Intergenic
1037920346 8:22801402-22801424 CTTTGCTCCAGGAGGCAGTGTGG - Intronic
1044499709 8:92939567-92939589 CTTTGCCTGGGGAGGTTGTAGGG - Intronic
1044769643 8:95617809-95617831 CTTTGCTTGTGAAGGCTGGGCGG - Intergenic
1045246286 8:100444290-100444312 CTCAGCTTGAGGAGGCAGTGTGG + Intergenic
1047584636 8:126257940-126257962 CATTGCTTCTGGAGGCTCTGGGG + Intergenic
1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG + Intergenic
1050150749 9:2617242-2617264 CTTTCTATGCTGAGGCTGTGGGG + Intergenic
1051611712 9:18967973-18967995 CTTAGCCATCGGAGGCTGTGAGG - Intronic
1056002376 9:82230832-82230854 CTTTGCTGCAGGAGGCAGTGAGG - Intergenic
1060268820 9:122127321-122127343 CTTTGGGTGCTGAGGCTGGGGGG + Intergenic
1062419012 9:136470180-136470202 CCTGGCTTGCGCAGGCTCTGGGG - Intronic
1186435234 X:9537493-9537515 CGTTGGTTGCTGGGGCTGTGGGG - Intronic
1187740292 X:22348502-22348524 CTCTGCTTGCGGAGGTTGACTGG - Intergenic
1190101317 X:47524602-47524624 CTCTGCTTGGGAAGTCTGTGGGG - Intergenic
1192069953 X:67928074-67928096 CTTTGTTTGCCTATGCTGTGGGG - Intergenic
1192661982 X:73051510-73051532 TTTTGGTTGCTGAAGCTGTGTGG - Intergenic
1199942983 X:152642349-152642371 CTCTGCATGTGGAGGATGTGTGG - Intronic
1200031839 X:153303362-153303384 TGATGCTGGCGGAGGCTGTGGGG - Intergenic