ID: 1155259005

View in Genome Browser
Species Human (GRCh38)
Location 18:24023365-24023387
Sequence GCCGCTGCTGAGCCACATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155259002_1155259005 8 Left 1155259002 18:24023334-24023356 CCTGTGCTGAGTAAGGGCGATGG 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG 0: 1
1: 0
2: 1
3: 19
4: 172
1155258997_1155259005 28 Left 1155258997 18:24023314-24023336 CCTTGGAACGTCCAGGCTGCCCT 0: 1
1: 0
2: 2
3: 23
4: 208
Right 1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG 0: 1
1: 0
2: 1
3: 19
4: 172
1155259001_1155259005 9 Left 1155259001 18:24023333-24023355 CCCTGTGCTGAGTAAGGGCGATG 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG 0: 1
1: 0
2: 1
3: 19
4: 172
1155258998_1155259005 17 Left 1155258998 18:24023325-24023347 CCAGGCTGCCCTGTGCTGAGTAA 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG 0: 1
1: 0
2: 1
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155259005 Original CRISPR GCCGCTGCTGAGCCACATGC AGG Intronic
900243769 1:1628632-1628654 GACGCTGCAGCGCCACGTGCAGG - Exonic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
900993047 1:6106741-6106763 GGAGCTGCTGAGCGACATGAAGG - Exonic
901060729 1:6470833-6470855 GCTGAAGCTGAGCGACATGCTGG - Exonic
901086150 1:6613551-6613573 GCCGCCGCGGAGCCTCATGGGGG + Intronic
901762956 1:11482400-11482422 GAGGCTGCTTAGCCACATGGTGG - Intronic
902175023 1:14642984-14643006 GCAGCTGCTGAGTCACATGGTGG - Intronic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
907213529 1:52843050-52843072 GACGCTGCCGAGGCACTTGCTGG + Intronic
907634413 1:56118965-56118987 GTGGGTGCTGAGCCTCATGCAGG + Intergenic
910748843 1:90605364-90605386 GCAGCTGTTTAGCAACATGCAGG - Intergenic
916694122 1:167220188-167220210 GCACCTGCTGAGCCACACGCGGG - Intergenic
917854153 1:179087913-179087935 GCAGCTGATGAGCCAGATCCGGG + Exonic
919913541 1:202126603-202126625 GACGCTGCTCAGCCACACTCAGG - Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920533566 1:206722855-206722877 GCCTCTGCTGCACCACATGGAGG - Intronic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
1062922586 10:1291392-1291414 GCCGCTGCTGAGCATCCTGCAGG + Intronic
1067319061 10:45199662-45199684 ACCGCAGCTCAGCCACATCCAGG - Intergenic
1067568987 10:47358106-47358128 GTCTCTTCTGAGCCTCATGCCGG + Intergenic
1069525007 10:69161949-69161971 GCCGCTGCTGAGTTGCATGGAGG - Intronic
1074715114 10:116211247-116211269 GCAGCAGCTGAGCCGGATGCAGG + Intronic
1076027201 10:127125556-127125578 TCAGCTGCTCAGCCACATCCTGG + Exonic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076724036 10:132405099-132405121 GCCGCTGCCCAGCCTCCTGCGGG - Exonic
1076868972 10:133183436-133183458 GGCGCTGCTGAGCCGGATGCAGG + Exonic
1077176711 11:1194410-1194432 GCCGCTGCTCAGGCTCTTGCCGG - Intronic
1077487828 11:2847163-2847185 GCCCCTGCTGGGCCACTTCCAGG - Intronic
1080905780 11:36543394-36543416 GCTGCTGCCAGGCCACATGCCGG + Intronic
1085058705 11:73424886-73424908 ACTGCTGCTGAGCCACCTGGGGG + Intronic
1087370580 11:97279190-97279212 GCTGCTGCTGAGGGACATGGGGG - Intergenic
1092190052 12:6512635-6512657 GCCACTGGGGAGCCACAAGCAGG + Intronic
1094813264 12:34162333-34162355 GCAGCTGCTTGGCCAGATGCAGG - Intergenic
1095396864 12:41771776-41771798 GCCCCTGCAGAGGCACCTGCAGG + Intergenic
1101412486 12:104481026-104481048 ACCTCTGCTGAGTCACATCCCGG - Intronic
1103001503 12:117388659-117388681 CCCCCTGCTCAGCCACATGCTGG - Intronic
1103698524 12:122835577-122835599 GCGGGTGCTGAGCCGCAGGCCGG + Exonic
1104849940 12:131868059-131868081 GCCGCAGCTGAGTCACTTGCTGG + Intergenic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1110009976 13:70320354-70320376 GCCGCTGAGCAGCCACAGGCTGG - Intergenic
1114051402 14:18921706-18921728 CCAGCTGCAGAGCCATATGCAGG - Intergenic
1114111159 14:19480219-19480241 CCAGCTGCAGAGCCATATGCAGG + Intergenic
1114670469 14:24408231-24408253 GCTGCTGCTGAGCCTGGTGCGGG + Exonic
1116635079 14:47384280-47384302 GTTGCTGCTGAGCCACATGAGGG + Intronic
1120968472 14:90187942-90187964 GGCACTGATGGGCCACATGCCGG + Intergenic
1122229502 14:100298655-100298677 GCTGGGGCTGATCCACATGCTGG - Intronic
1122853046 14:104547060-104547082 GCAGCTGCTGCTCCAGATGCAGG + Intronic
1122886105 14:104711162-104711184 GACGCTGCTGCACCACGTGCTGG + Exonic
1126893695 15:53235265-53235287 TCAGCTGCTGGGCCACATGTTGG + Intergenic
1127209988 15:56764262-56764284 GACCCTGCTGACCCACATTCAGG - Intronic
1127360421 15:58240379-58240401 TCCGCAGCTGAGCCAATTGCTGG + Intronic
1127900325 15:63336294-63336316 GCAGCTGCTTAGACACAAGCCGG + Intronic
1132621810 16:871352-871374 GCCGCAGCTGAGTCTCGTGCAGG + Intronic
1132781882 16:1631319-1631341 GCCACTGGGGAGCCTCATGCTGG + Intronic
1132918243 16:2366731-2366753 GCCGCTCCTGAGCCCCCTTCAGG - Intergenic
1133265784 16:4582778-4582800 GCCCCTGCTCACCCCCATGCAGG - Intronic
1133555586 16:6903784-6903806 GCCGCTGCTTAGCCAGAGGAGGG + Intronic
1137554659 16:49463043-49463065 GCCAGTGCTGAACCACATCCGGG - Intergenic
1137581851 16:49638425-49638447 CTCGCTGCAGAGCCACATGCAGG - Exonic
1138382066 16:56609338-56609360 GCAGCTGCTGCGCCTGATGCTGG + Exonic
1138388042 16:56649498-56649520 GCAGCTGCTGTGCCTGATGCTGG + Intronic
1138388543 16:56653049-56653071 GCCGCTGCTGTGCCTGATGTTGG + Exonic
1141167750 16:81671774-81671796 GCCCCGGCTGTGCCACGTGCAGG - Intronic
1141445190 16:84053329-84053351 GACACTGCTCAGCCACAAGCAGG + Intergenic
1141505024 16:84471345-84471367 GGTGCTGCTGAGCCCCAGGCTGG - Intergenic
1141638801 16:85329476-85329498 GGGGCTGCAGAGCCACCTGCAGG + Intergenic
1141671683 16:85495315-85495337 GCCGCTACCGAACCACAGGCCGG - Intergenic
1141777395 16:86133595-86133617 GCCGCTGCTGTGCTGCAGGCTGG - Intergenic
1142031605 16:87841296-87841318 GTACCTGCTGAGCCACATGGAGG + Intronic
1142321449 16:89385809-89385831 GCCGCTGCGCAGCCAGAGGCCGG + Intronic
1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG + Exonic
1144480145 17:15622238-15622260 GCCGCTGCTGGGCCAGATAGAGG + Intronic
1144717835 17:17446742-17446764 CCCACTGCTCAGCCCCATGCAGG + Intergenic
1144918160 17:18741500-18741522 GCCGCTGCTGGGCCAGATAGAGG - Intergenic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1146793131 17:35764230-35764252 GCCGCAGCAGCGCCACCTGCTGG - Exonic
1147191302 17:38739581-38739603 GCCGCTGCTGAGCATCAGGTGGG - Exonic
1148021685 17:44557684-44557706 GGCGCTGCGGGGCCGCATGCTGG - Exonic
1148820265 17:50355943-50355965 GGCGCAGCTGGGCCACAAGCGGG - Exonic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1152870855 17:82752304-82752326 GGCGCTGCTGGGCCGCCTGCGGG + Exonic
1154076844 18:11211658-11211680 TCCACTGGTGAGACACATGCAGG - Intergenic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1159011904 18:63065885-63065907 GCCTGTGCTGACCAACATGCTGG + Intergenic
1159359548 18:67382078-67382100 GCCGCTGCTCAGACACACACGGG - Intergenic
1159775842 18:72602036-72602058 GCCCCTGCTGAGCCACATCTGGG + Intronic
1161394280 19:4037171-4037193 GCAGGTGCTGAGCCCCAGGCAGG - Intronic
1162424161 19:10583950-10583972 CCCGCTGCTGAGCCACGGCCAGG - Exonic
1164455011 19:28399643-28399665 GCACCTGCTGATGCACATGCAGG + Intergenic
1165355294 19:35300238-35300260 GCCGCTGCTGACCTGGATGCGGG + Exonic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1167473895 19:49689480-49689502 CCCGCTGCTTAGCTACCTGCGGG + Exonic
1167509862 19:49890350-49890372 GCCGCTGCCCCGCCACATGCAGG - Exonic
925300427 2:2807808-2807830 GCCGCTGCTCACCCACACCCTGG + Intergenic
926131943 2:10308653-10308675 GCCAGTGCTGAGCCAGGTGCAGG - Intronic
926281058 2:11446914-11446936 GCCCTTGCAGAGCCACAGGCTGG - Intronic
927362582 2:22253323-22253345 TCAGCTGCTGAGCCTCCTGCAGG + Intergenic
927496704 2:23555967-23555989 CCCCCTTCAGAGCCACATGCTGG - Intronic
927515370 2:23668934-23668956 GCCCCTGCTGTGCCACTTCCGGG - Intronic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
942944596 2:181658591-181658613 GCTGCTGCTAAACCCCATGCAGG + Intronic
944129063 2:196326299-196326321 GCCACTGGTGAGCCACCTCCTGG - Intronic
947837221 2:233184526-233184548 GTGGCTGCTGAGCCACCTTCTGG + Intronic
948894450 2:240921768-240921790 GCCCCTCCTCAGCCACAAGCTGG - Intronic
1170771290 20:19334940-19334962 GCCTCTGCTGTGCCATATGCAGG + Intronic
1172223415 20:33288793-33288815 GCCGCTGCTCAGTGCCATGCGGG + Exonic
1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG + Intronic
1173812968 20:45967752-45967774 CACACTGCTGCGCCACATGCGGG - Exonic
1174335738 20:49859147-49859169 GCCACTGCTGAGACCCAAGCTGG + Intronic
1175905633 20:62378086-62378108 GACCCTGCGGAGCCACCTGCAGG + Intergenic
1176122040 20:63458341-63458363 GCCGCTGCAGTGCCTCATGGTGG + Intronic
1176447177 21:6830679-6830701 TCCGCTGCTCAGCCCCATCCTGG - Intergenic
1176825347 21:13695705-13695727 TCCGCTGCTCAGCCCCATCCTGG - Intergenic
1180469875 22:15644081-15644103 CCAGCTGCAGAGCCATATGCAGG - Intergenic
1180859023 22:19066551-19066573 GACGGTGCAGAGCCACCTGCGGG - Intronic
1180951463 22:19722421-19722443 CCCGCAGCTGAGGCGCATGCAGG + Exonic
1181087709 22:20449982-20450004 GCTCCTCCTGAGCCACCTGCTGG + Intronic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1184479103 22:44736851-44736873 GCCTCTGCTGAACCCCGTGCAGG + Exonic
951654608 3:24991736-24991758 GCATCTGCTGAGCCATATGGAGG + Intergenic
952998065 3:38904590-38904612 ACCGCTGCAGGGACACATGCAGG + Intronic
953058231 3:39405296-39405318 GGAGCTGCAGAGCCACTTGCAGG + Intergenic
957322501 3:78650397-78650419 ATTGCTGCTGAGCCACAGGCAGG + Intronic
961382947 3:126507936-126507958 GCAGGTGCTGTGCCACCTGCTGG + Intronic
961431898 3:126889523-126889545 GCTCCTGCTGAGCCACTGGCTGG + Intronic
961667792 3:128504404-128504426 GCCCCTGCTGTGTCCCATGCAGG - Intergenic
964310416 3:155386136-155386158 GCCCATGCTGTGCCACAGGCTGG - Intronic
966712908 3:182987604-182987626 GCCACTGCTGAGGCACATGCTGG - Intergenic
967834806 3:193952043-193952065 TCCGTTGCTGAGTCACTTGCTGG + Intergenic
967843194 3:194023610-194023632 GCCATTGCTGAGGCACATGCGGG + Intergenic
968108314 3:196019910-196019932 GCCCCTGGTGTGTCACATGCCGG - Intergenic
969676557 4:8617644-8617666 GTTGCTGCTGAGCCCCGTGCAGG + Intronic
971257914 4:25030842-25030864 GCCGCAGCCGAGCAGCATGCTGG + Exonic
974932661 4:68376492-68376514 GCAGCTGCTGTGCCTGATGCTGG + Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
984474288 4:180216576-180216598 GCTGCTGCTGGCCCACATGTGGG - Intergenic
984713153 4:182902800-182902822 GCCGCTGCTGATTTCCATGCTGG - Intronic
985909455 5:2867515-2867537 GCAGCTGCTGAAGCACACGCTGG - Intergenic
994186044 5:96816479-96816501 GTCCCTGCTGAGCAACATCCTGG - Intronic
995391653 5:111646557-111646579 GCCTTTCCTGAACCACATGCTGG - Intergenic
1000199051 5:158989355-158989377 GCTGCTCCTGAGCCAAATGATGG + Intronic
1001381711 5:171310131-171310153 GCCGCTGCGGAGACACAGGAGGG - Exonic
1003171226 6:3723449-3723471 GCCCCTGCTGCTCCACTTGCAGG + Exonic
1007088242 6:39165926-39165948 TCCTCTGTTGAGCCTCATGCTGG - Intergenic
1011281051 6:85678431-85678453 GCCGCCGCTCAGGCACATGCCGG + Intergenic
1017885069 6:158592164-158592186 GCAGCTGCTGGGCCCTATGCTGG - Intronic
1018947417 6:168357112-168357134 GCCCCTGCTGAGCACCATCCTGG - Intergenic
1019527348 7:1486735-1486757 GCAGCTGCTGGGCCGCCTGCAGG - Exonic
1020107621 7:5429420-5429442 GAGGCTGCTGGGCCACATTCCGG + Intergenic
1021862558 7:24921552-24921574 GCCACTTCTGAGCTACATTCTGG - Intronic
1022520071 7:31000500-31000522 GCCCATGCTGAGCCAGAGGCAGG - Intergenic
1023609188 7:41956945-41956967 GCCACTTCTCAGCCACAGGCTGG + Intergenic
1023709114 7:42973259-42973281 TCTGCTGCTGAGCCAAAAGCAGG + Intergenic
1024046068 7:45586678-45586700 GCCGCTGGTGAGCACCATGGAGG + Intronic
1026848129 7:73708932-73708954 GGAGCTGCTGAGCCAGGTGCAGG + Intronic
1028165985 7:87538999-87539021 ACCACTGCTGAGACACAGGCTGG + Intronic
1029379552 7:100204101-100204123 CCTGCTGCTGAGCCTCAAGCAGG + Exonic
1030061288 7:105623326-105623348 GCCATTGCAGAGCCAAATGCAGG - Intronic
1030421291 7:109309809-109309831 GCCTCTTCTGAGCCACAGCCTGG + Intergenic
1031513589 7:122676677-122676699 TCAGCTGCTCAGCCACATCCTGG + Intronic
1034424972 7:151009506-151009528 GGCGCTGCTGAGCCGCGTGGAGG + Exonic
1034998141 7:155591372-155591394 GCTGCTTCTGAGCCACCTCCAGG + Intergenic
1035599951 8:891510-891532 GCAGCTGCTGGGCCACAGGATGG + Intergenic
1036582031 8:10084118-10084140 GACCCTGCTGCTCCACATGCTGG + Intronic
1037492762 8:19411523-19411545 GCCTTTGCTGGGCCACTTGCTGG - Intronic
1037512479 8:19597971-19597993 GCCTTTGCTGAGCCCCAGGCTGG - Intronic
1038193504 8:25345566-25345588 GCAGCTTCTGAGCAACATCCTGG + Exonic
1038481316 8:27903761-27903783 GCCACTGCAGAGTCACAAGCTGG - Intronic
1039594413 8:38778494-38778516 ACCACTCCTGAGCCACAGGCAGG + Intronic
1040296475 8:46151621-46151643 GCGGCAGCTGAGCCACAGGCAGG - Intergenic
1041244852 8:55880162-55880184 GCCGCGGCTGTGCCACCAGCCGG + Intronic
1044088426 8:87971077-87971099 GCCGCTGCTGAGCCCCTTTCTGG + Intergenic
1044516298 8:93142698-93142720 GCCTCTTCTGAACAACATGCTGG - Intronic
1045326843 8:101123435-101123457 GGCGCTGCTTAGCCCCAGGCTGG + Intergenic
1047886067 8:129251408-129251430 GGGGCTTCTGAGCTACATGCTGG - Intergenic
1047931541 8:129733010-129733032 GGACCTGCTGAGCCACATGCGGG - Intergenic
1049164277 8:141116851-141116873 AGAGCTGCTGAGCCACCTGCAGG + Intergenic
1049509779 8:143021744-143021766 GCTGCTGCTGAGCCTGCTGCCGG + Exonic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049647119 8:143740439-143740461 GGCGCTGCTGAGCCTCAGGGCGG - Intergenic
1049766950 8:144359317-144359339 TCCGGTGCTGACCCACCTGCTGG + Exonic
1049791820 8:144475739-144475761 GCCGCTGCAGGGCCCCATGCGGG + Exonic
1054459463 9:65455001-65455023 AGCCCTGCTGAGCCACATCCCGG - Intergenic
1057177405 9:93010269-93010291 GACGCTGCAGCACCACATGCTGG + Exonic
1059245755 9:112848459-112848481 CCAGCTGCAAAGCCACATGCTGG + Intronic
1062142276 9:134966146-134966168 GGCTCTGCTGTGCCCCATGCTGG - Intergenic
1062462483 9:136667718-136667740 GCAGCTGCTGGCCCACCTGCTGG + Intronic
1203522013 Un_GL000213v1:53852-53874 TCCGCTGCTCAGCCCCATCCTGG + Intergenic
1192435680 X:71142208-71142230 GACGCTACTGAGCCACCTGGAGG + Exonic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1200124442 X:153806675-153806697 GCAGCCTCTGAGCCACAGGCAGG + Intronic