ID: 1155260473

View in Genome Browser
Species Human (GRCh38)
Location 18:24037515-24037537
Sequence CTTGTGATAGGACATTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155260462_1155260473 24 Left 1155260462 18:24037468-24037490 CCCACCATTTGTGCTATTTATCC 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 95
1155260470_1155260473 -7 Left 1155260470 18:24037499-24037521 CCAAATGTGTGGATTCCTTGTGA 0: 1
1: 0
2: 4
3: 15
4: 132
Right 1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 95
1155260467_1155260473 2 Left 1155260467 18:24037490-24037512 CCCCATTCTCCAAATGTGTGGAT 0: 1
1: 0
2: 2
3: 16
4: 225
Right 1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 95
1155260469_1155260473 0 Left 1155260469 18:24037492-24037514 CCATTCTCCAAATGTGTGGATTC 0: 1
1: 0
2: 1
3: 24
4: 233
Right 1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 95
1155260464_1155260473 20 Left 1155260464 18:24037472-24037494 CCATTTGTGCTATTTATCCCCCA 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 95
1155260463_1155260473 23 Left 1155260463 18:24037469-24037491 CCACCATTTGTGCTATTTATCCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 95
1155260468_1155260473 1 Left 1155260468 18:24037491-24037513 CCCATTCTCCAAATGTGTGGATT 0: 1
1: 0
2: 2
3: 17
4: 249
Right 1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 95
1155260466_1155260473 3 Left 1155260466 18:24037489-24037511 CCCCCATTCTCCAAATGTGTGGA 0: 1
1: 0
2: 1
3: 15
4: 131
Right 1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155260473 Original CRISPR CTTGTGATAGGACATTTGTC TGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900737271 1:4306868-4306890 CTGGTGGTGGGGCATTTGTCTGG + Intergenic
901632341 1:10653990-10654012 CTTGTGAGAGGTCATCTGGCTGG + Exonic
902783627 1:18719562-18719584 TTTGTGATAAGACACTTGCCAGG - Intronic
904389769 1:30174689-30174711 CTTGAGATAGGAGATTATTCTGG + Intergenic
904824855 1:33267468-33267490 CTTGTGATACAACAATAGTCAGG - Intronic
911141118 1:94503545-94503567 CTTGTGGAAAGACATTTTTCAGG + Intronic
913079346 1:115367669-115367691 CTTGTGATAGAACTGTTCTCTGG - Intergenic
1063297241 10:4819128-4819150 ATTGTGCTAGGACATTTACCTGG - Intronic
1064892436 10:20192682-20192704 CTTTTCATAGGTCATGTGTCTGG - Intronic
1068121250 10:52784205-52784227 ATTGTGATGGAACATTTGGCTGG + Intergenic
1070705327 10:78633546-78633568 GTTGTGATAGGTAATTTCTCTGG + Intergenic
1070968948 10:80548001-80548023 CAGGTGATAGGACATCTCTCTGG - Intronic
1071775275 10:88779842-88779864 CTAGTATTAGGACATTTTTCTGG - Intergenic
1073702479 10:105944040-105944062 CTTGTGAAAGTCCATTAGTCAGG - Intergenic
1080878195 11:36295729-36295751 TTTGTGATGGGACATCTGGCTGG - Intergenic
1085694964 11:78696524-78696546 CTTGTGCTAGGACTTTTGTGAGG + Intronic
1092312554 12:7374258-7374280 CTTGTCATATTACATTTGTCTGG - Intronic
1093849712 12:24020698-24020720 CCTGTGATTTGACCTTTGTCTGG - Intergenic
1094675560 12:32616666-32616688 CTTGAGATAATACATTTGTCTGG + Intronic
1102648442 12:114419077-114419099 CTTCTGTTAGGGCATTTGTGAGG + Intergenic
1104331086 12:127845927-127845949 TTTGTGTTAGGAAAATTGTCAGG - Intergenic
1109585676 13:64399292-64399314 GTTGTCATAGGGCATTTCTCAGG + Intergenic
1110675459 13:78237836-78237858 CTTGTGATTTGAGATTTTTCTGG - Intergenic
1110681035 13:78312135-78312157 CTAGTGCCAGGACATTTCTCTGG - Intergenic
1112537386 13:100273475-100273497 CTTGTGCTAAGACATCTGTTAGG + Intronic
1117195097 14:53331903-53331925 CTGCTGCTTGGACATTTGTCTGG + Intergenic
1119343759 14:73904053-73904075 GTTGTGACCGGACATTTGTATGG + Exonic
1124026585 15:25972542-25972564 CTTGTAATAGTACATTTGGCAGG - Intergenic
1124134738 15:27024591-27024613 TTTGTGAAAGATCATTTGTCAGG + Intronic
1127057820 15:55150520-55150542 CTTGAGATGGGAGATTTGCCTGG + Intergenic
1130231532 15:82100973-82100995 CTTGAGATGGGGTATTTGTCAGG - Intergenic
1130929719 15:88415209-88415231 CTTTTGAAAGGACAGTTGTTAGG + Intergenic
1141352015 16:83306688-83306710 CTAGTGATAGGAGATTAGGCTGG + Intronic
1142953985 17:3507875-3507897 CTTGTCATAGGATATATTTCTGG - Intronic
1145903330 17:28501825-28501847 ATTGGGAAAGGACTTTTGTCTGG - Intronic
1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG + Intronic
1158360798 18:56670841-56670863 CTTTTGATTGGCCATCTGTCAGG + Intronic
1158768918 18:60491106-60491128 CTTCTGTTAGGCCATTTCTCTGG + Intergenic
1160404114 18:78632799-78632821 CTTATGCTAGGAGATTTCTCTGG - Intergenic
1161972014 19:7587423-7587445 CTTTTGCTAGGGCAGTTGTCTGG - Intergenic
928730245 2:34223576-34223598 CTAGTGATAGGACTTTTGAGAGG + Intergenic
929029576 2:37637877-37637899 CTTGAGATGGGGCATTAGTCTGG - Intergenic
933147440 2:78871972-78871994 CTTTTGTGAGGACATCTGTCCGG - Intergenic
933507909 2:83202410-83202432 CTTTTGATAGGATATTTTCCTGG + Intergenic
937781561 2:125844390-125844412 CTAGTCATACGAAATTTGTCCGG + Intergenic
946331390 2:219010927-219010949 CCTGTGACAGGACATCGGTCTGG + Exonic
1169200717 20:3707994-3708016 CTTGTGAGAGCCCATTTCTCAGG + Intergenic
1170410740 20:16088586-16088608 CTTCTGCAAGGACATCTGTCTGG - Intergenic
1174850407 20:53988474-53988496 TTCGTCATAGGACTTTTGTCAGG - Intronic
1184352982 22:43957012-43957034 CTTCTGAAAGGAAATATGTCTGG + Intronic
949244279 3:1907201-1907223 CTTGTTAGATGACTTTTGTCTGG + Intergenic
949845915 3:8370762-8370784 GGTATGAGAGGACATTTGTCAGG - Intergenic
951118868 3:18899452-18899474 CTTGTGATATGATAAATGTCGGG - Intergenic
953926486 3:46985254-46985276 CTTGTGATAGGGCATGTGACTGG + Intronic
953999020 3:47541723-47541745 CTTTTCTTAGGACATTTGTGGGG - Intergenic
959211917 3:103395750-103395772 CTTTAGATAGGACAGTGGTCAGG - Intergenic
960073279 3:113455833-113455855 CTTGTTAAAGCAAATTTGTCAGG - Intronic
960285901 3:115828264-115828286 GTTATCATAAGACATTTGTCAGG + Intronic
970483748 4:16503962-16503984 CATGGGACAGGACATCTGTCAGG + Intronic
971537524 4:27772361-27772383 CTTCTAGTAGGGCATTTGTCAGG - Intergenic
975234891 4:71982114-71982136 CTTGAGATAGGAGATTATTCTGG + Intergenic
976012391 4:80506388-80506410 GTTGAGATAGTGCATTTGTCAGG + Intronic
979216165 4:118166578-118166600 CTTCTCATAGTATATTTGTCTGG - Intronic
979845861 4:125510778-125510800 CTTGAGATAGGAAATTATTCTGG - Intergenic
982472018 4:155804100-155804122 CTTGAGATAGGATATTTCCCTGG + Intronic
989835551 5:45984707-45984729 CCTGTGAAGGGATATTTGTCAGG + Intergenic
993336029 5:86659913-86659935 CTGGAAATAAGACATTTGTCAGG + Intergenic
993456673 5:88134994-88135016 CTTGTGTTAGGAGAATTTTCAGG + Intergenic
999471438 5:151858444-151858466 CTAGAGATAGGAAATTAGTCTGG + Intronic
1000276310 5:159738411-159738433 CTTTTGAGAGGCCATTAGTCAGG - Intergenic
1003197001 6:3923796-3923818 CTTTTGAGAGGCCATTTGTGAGG - Intergenic
1003969780 6:11288063-11288085 CTTGTGATATGGCAATTGTTTGG + Intronic
1008733233 6:54508855-54508877 CTTGTGATTGCACATGTCTCTGG - Intergenic
1011256049 6:85422176-85422198 CTTGAGAAAGGTCATTGGTCTGG + Intergenic
1012437533 6:99230096-99230118 CTTGTGATGGGGCATCTGTGTGG - Intergenic
1015865230 6:137720838-137720860 CTTGGGTTAGGGCCTTTGTCAGG + Intergenic
1020606394 7:10343202-10343224 CTTGTGTTAAGTCATTTTTCAGG - Intergenic
1021263629 7:18491579-18491601 CTTGTGAAAGAAAATTTATCAGG - Intronic
1022524645 7:31029122-31029144 CTTGTCTTAGGCCATTAGTCTGG - Intergenic
1024921402 7:54559561-54559583 CTTGTGAAGGAAAATTTGTCAGG + Intronic
1026440911 7:70443177-70443199 CTTGTTATTGGAAATATGTCAGG + Intronic
1028437747 7:90824072-90824094 CTTGTGATGTGAGCTTTGTCAGG + Intronic
1029905809 7:104092493-104092515 CTTTTGATAGGTTATCTGTCTGG + Intergenic
1032368979 7:131327737-131327759 CCTGAGATAGGACATTGGCCCGG + Intronic
1035782225 8:2237458-2237480 TTTGTGTTAGGACATATATCTGG - Intergenic
1035809891 8:2482129-2482151 TTTGTGTTAGGACATATATCTGG + Intergenic
1037707387 8:21326625-21326647 CTTGTGCTGGGACCTTTCTCCGG - Intergenic
1040076184 8:43233696-43233718 CTTGAGATAGAACACTTTTCTGG - Intergenic
1040456729 8:47605619-47605641 CTGGTGACAGGACATTTAGCAGG + Intronic
1042384175 8:68153226-68153248 CTTTTGATAGCACACTTGTTTGG - Intronic
1042870695 8:73396082-73396104 CATGTGATATCACATTTGTATGG + Intergenic
1045909685 8:107392264-107392286 ATTGTGAAAAGAAATTTGTCGGG - Intronic
1049321689 8:142000165-142000187 CTTGTCAGAGCACATTTCTCAGG - Intergenic
1050745176 9:8867856-8867878 CTTATGATAGGACATTCTGCAGG - Intronic
1051721518 9:20042039-20042061 CTTGTGGTGGGACATTTGCCTGG + Intergenic
1053651896 9:40177482-40177504 CTTGGGATAGGACAGCTGTGAGG - Intergenic
1054532689 9:66198724-66198746 CTTGGGATAGGACAGCTGTGAGG + Intergenic
1058204367 9:102084908-102084930 CTTGTGATAGGAGATTATTCTGG - Intergenic
1187480665 X:19652189-19652211 CTGGTGACAGCACATTTGTCTGG + Intronic
1192884936 X:75326828-75326850 CTTTTAATATGACACTTGTCCGG + Intergenic
1198163688 X:134032501-134032523 CTTGTGAAAGGGCATTTTGCAGG - Intergenic
1199026631 X:142946978-142947000 CTTGTGAGAGGACATCTGGCAGG + Intergenic
1199416484 X:147589138-147589160 AATGCGATAGGACATTGGTCTGG + Intergenic
1202624458 Y:56843126-56843148 CTGGTGATGTAACATTTGTCTGG + Intergenic