ID: 1155260711

View in Genome Browser
Species Human (GRCh38)
Location 18:24039366-24039388
Sequence CACAAAGAGAAGTGTATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155260706_1155260711 26 Left 1155260706 18:24039317-24039339 CCTCAGACTAGGCATGTGTTATA 0: 1
1: 0
2: 1
3: 6
4: 111
Right 1155260711 18:24039366-24039388 CACAAAGAGAAGTGTATTCAAGG 0: 1
1: 0
2: 0
3: 23
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155260711 Original CRISPR CACAAAGAGAAGTGTATTCA AGG Intronic
902666757 1:17944826-17944848 TACAAAGAGAAGGGAATTCTGGG + Intergenic
906042769 1:42801598-42801620 AAAAAAAAGAAGTGTACTCAAGG - Intergenic
906697152 1:47830655-47830677 CACAAAGAGAGGTTTCTCCAAGG + Intronic
908039529 1:60093752-60093774 CACTAGGAGAAATGTTTTCAGGG - Intergenic
908500622 1:64740226-64740248 TACAAAGAGTACTTTATTCATGG + Intergenic
909290737 1:73880046-73880068 CACAAATAGAAGTGGACTTATGG - Intergenic
909990771 1:82220566-82220588 CACAGAGAAAAGAGAATTCAAGG + Intergenic
910089732 1:83448027-83448049 TATAAAGAGAAGGGTAGTCAAGG - Intergenic
912275473 1:108253726-108253748 GACAAAGAGAAGTGTTGGCAAGG - Intergenic
912292751 1:108440622-108440644 GACAAAGAGAAGTGTTGGCAAGG + Intronic
915419188 1:155766094-155766116 CTCAAAGAGAAGAGGAGTCAAGG - Exonic
915548419 1:156617104-156617126 AAGAAAGAAAAGTATATTCAAGG + Intergenic
917166984 1:172123659-172123681 CAAAAAGGGAAGTGTAGTCCTGG - Intronic
918805656 1:189038940-189038962 CACACAGAGACATTTATTCAAGG - Intergenic
921054577 1:211534392-211534414 CACAAAGAGAGGAGTCTGCAGGG + Intergenic
921079698 1:211729143-211729165 AACAAATAGAAGTGAAGTCAAGG - Intergenic
921193711 1:212732118-212732140 CAAAAAAAGAAATGTAATCATGG - Intronic
921482468 1:215678937-215678959 CACAAGGAGAAGTGCTTTGAGGG + Intronic
921584212 1:216928817-216928839 CACTCAGAGTAGTGTCTTCAAGG - Intronic
922691906 1:227699768-227699790 ACCAAAGTGAAGTGTACTCAGGG + Intergenic
922992624 1:229927772-229927794 CACAATCAGAAGAGTATACAAGG + Intergenic
924379608 1:243450110-243450132 CACTTAGAGCACTGTATTCATGG + Intronic
924669739 1:246111508-246111530 CTCAAAAAGAAGTCTACTCAAGG + Intronic
924829157 1:247574112-247574134 CACAAAGAGAAAAGAAATCAAGG - Intronic
1063245326 10:4212047-4212069 CAACAATATAAGTGTATTCAAGG + Intergenic
1064282376 10:13962877-13962899 AACAAAGAAAAGTGCTTTCAAGG + Intronic
1064773092 10:18745618-18745640 CACAATGAGATGTAAATTCAAGG - Intergenic
1065071397 10:22027959-22027981 AACAAAGAGAACTGCAATCATGG - Intergenic
1068729569 10:60341545-60341567 CTCCAAAAGAATTGTATTCATGG + Intronic
1069350516 10:67520771-67520793 CAAAAAGAGAATTGTGTTCTAGG - Intronic
1069971855 10:72177983-72178005 CACAAAGAAAGGTGACTTCAGGG + Intronic
1070436039 10:76394624-76394646 CACATAGACAAGTATTTTCATGG - Intronic
1070549013 10:77475990-77476012 CACAAAGAGAAGGGTCTTCTGGG + Intronic
1072092098 10:92138482-92138504 CAAAAAGTGACGTTTATTCAAGG - Intronic
1073651789 10:105368286-105368308 CACAAAGTGAACTGTATTTTAGG + Intergenic
1074490941 10:113939061-113939083 CTCAAAGAGATGTGATTTCAGGG - Intergenic
1075823385 10:125333247-125333269 GACAAAGACATCTGTATTCATGG + Intergenic
1078291980 11:10020725-10020747 CACAGAGAGAAGTTTTTCCAGGG + Intronic
1078487285 11:11735380-11735402 CACAAAGAGAAGTGTTTCAAAGG - Intergenic
1079488901 11:20965589-20965611 CACAAGTGGAATTGTATTCAAGG + Intronic
1079807046 11:24945114-24945136 GGCAAATAGAAGTCTATTCAGGG - Intronic
1085132133 11:74049609-74049631 CACACAGAGAAGCTGATTCAGGG + Intronic
1087334441 11:96825702-96825724 TTCAAAGAGAAGTGATTTCAGGG + Intergenic
1087544078 11:99561557-99561579 CCAAAAGAGAAGTGATTTCATGG + Intronic
1088864754 11:113836929-113836951 CACATAGAGCAGTGGCTTCATGG - Intronic
1089260512 11:117220902-117220924 CACAGAGAGAAGGGGTTTCATGG - Intronic
1089761284 11:120725876-120725898 CACAAAGAGAATTCTAGTGATGG + Intronic
1090358643 11:126157749-126157771 CACACAGAGAAATGTCTTCTGGG + Intergenic
1090814716 11:130282419-130282441 CACATAGCGAAGTGTTCTCAAGG + Intronic
1091330025 11:134725003-134725025 CACAAATAGGAATGTACTCAGGG + Intergenic
1092655920 12:10685529-10685551 CACAAACACAAATGTATTCATGG + Intergenic
1093213650 12:16337138-16337160 GACAAAGAGAAGTGAGTTAAAGG + Intergenic
1093410332 12:18857702-18857724 CACAAAGAGAAATGTTGTGAAGG - Intergenic
1094226319 12:28050305-28050327 GACCAAGAGAAATGTATTCTTGG - Intergenic
1096448750 12:51719645-51719667 AACATAGAGAAGTAAATTCAGGG + Intronic
1098534726 12:71581776-71581798 CACAGAGAGAAGGTCATTCATGG + Intronic
1098938726 12:76510284-76510306 CACAAAGAAAAATGTACTAAAGG + Intronic
1099945281 12:89236700-89236722 CACTAAGAGCAGGGTATTCGGGG + Intergenic
1099968340 12:89474856-89474878 CACACACAGATGTTTATTCAAGG - Intronic
1101640264 12:106582090-106582112 GACAAAGAGAAGTGGAGGCAGGG + Intronic
1102449550 12:113030546-113030568 CCGAAAAAGAAGTGAATTCAAGG - Intergenic
1102812598 12:115837455-115837477 CACAAAGCAAAGTGTACTCTAGG + Intergenic
1104464725 12:128980880-128980902 CGCAAAGAGATGTGCATACAGGG + Intronic
1105752148 13:23431282-23431304 CACAAAGAGAAGTCAAAGCAGGG + Intronic
1109402353 13:61850974-61850996 TGAAAAGAGAAGTGTCTTCAAGG + Intergenic
1110093836 13:71490062-71490084 CACAGAGAAAATTTTATTCATGG + Intronic
1110279724 13:73678989-73679011 CACATAGAAAAGGGTGTTCAAGG + Intergenic
1110624331 13:77635089-77635111 GTCTAAGAGAAGAGTATTCAGGG + Intronic
1112389846 13:98972983-98973005 CACAAAGAGCATTGTAGTGAAGG + Intronic
1112561093 13:100514702-100514724 CGCACAGACAAGTATATTCATGG - Intronic
1114135260 14:19840892-19840914 AACAAAGAGAAGTGCACTAAAGG + Intergenic
1114329318 14:21620084-21620106 CACAAAGCAAAATGTTTTCAAGG + Intergenic
1115117773 14:29903464-29903486 AACAAAGAGAACTGTACTCCAGG - Intronic
1115149525 14:30268549-30268571 CACAGAGAGCATTGTAATCAAGG - Intergenic
1115431093 14:33319691-33319713 CACAAAGAAAAGTGAACTTAGGG - Intronic
1115550467 14:34500460-34500482 AACAAAGATGAGTGTGTTCATGG + Intergenic
1116259057 14:42599234-42599256 CTCAATGTGAAGTGTATTCTTGG - Intergenic
1116461070 14:45174572-45174594 TACAAATAGAAGTATATTCCAGG + Intronic
1116870081 14:50062111-50062133 CCCAAAAAGAAGTGTGTTGAGGG - Intergenic
1119027067 14:71162266-71162288 CATAAAGAGAAGTTGATTAATGG + Intergenic
1119518538 14:75267950-75267972 AACAAGGAGCAGGGTATTCAGGG - Intronic
1119868776 14:77995264-77995286 CACAAAAAGAAGTGTGGTGAAGG + Intergenic
1120151047 14:81034268-81034290 GAGAATGAGAAGTCTATTCAAGG + Intronic
1120717202 14:87852712-87852734 GAGACAGAGAAGGGTATTCAAGG - Intronic
1121219710 14:92276444-92276466 CAGAAAGACAAGTGCTTTCAAGG - Intergenic
1122165105 14:99817332-99817354 CATAAAGAGACCTGTACTCAAGG + Intronic
1122597163 14:102901835-102901857 CAAAAGGAGAAGTGAATTCAGGG + Intronic
1127922827 15:63506011-63506033 CACAAAGAAAAATGTACTCTGGG + Intronic
1128090905 15:64918312-64918334 AACAAAGAAAATTGTTTTCATGG - Intronic
1128678516 15:69629290-69629312 CCCAAAGAGAAGACAATTCATGG - Intergenic
1128929911 15:71695008-71695030 CAGAATGAGATGTGAATTCAAGG - Intronic
1130723702 15:86416232-86416254 CCTAAAGGGAACTGTATTCATGG + Intronic
1131371066 15:91882341-91882363 CACAAAGAGAAGCAAATGCATGG - Intronic
1131755852 15:95560706-95560728 CACAAAATGAAGTGTGTTTAAGG + Intergenic
1132095246 15:98979575-98979597 CATAAAAAGAAATGTATTAATGG + Intronic
1132337583 15:101058313-101058335 CACAAAGAGACGTGCATGTATGG + Intronic
1133167909 16:3961665-3961687 CACAAAGGGAGCTGAATTCATGG - Intronic
1135175396 16:20223287-20223309 CAGAAGGAGAAATGGATTCATGG + Intergenic
1137540987 16:49361495-49361517 CACAAACACAAATGTCTTCAAGG + Intergenic
1139970535 16:70771382-70771404 CACAAGGGGAAGTCTGTTCAAGG - Intronic
1140626961 16:76805366-76805388 CTCAAGGAGAAGTTAATTCAAGG - Intergenic
1140933453 16:79649560-79649582 CACAGAGAGAAATGTATTTCAGG - Intergenic
1142479886 17:212793-212815 CCTGAAGAGAAGTGAATTCATGG + Exonic
1143085015 17:4409420-4409442 CAGAAAGAAATGTCTATTCAAGG - Intergenic
1144002069 17:11064442-11064464 GACATAAAGAAGGGTATTCATGG + Intergenic
1144145588 17:12394833-12394855 GAGAAAGAGAAGTGAGTTCAAGG - Intergenic
1149585744 17:57785184-57785206 CACTAAGAGAAGAGGATGCAGGG + Intergenic
1151308049 17:73276400-73276422 GACAAATAAAAGTGTTTTCAGGG - Intergenic
1154215649 18:12414208-12414230 ATCAAAGAGAAGAGTACTCAGGG + Intronic
1154459389 18:14564847-14564869 AACAAAGAGAAGTGCACTAAAGG + Intergenic
1155260711 18:24039366-24039388 CACAAAGAGAAGTGTATTCAAGG + Intronic
1155428513 18:25730674-25730696 CATAAAAAGGAGTGCATTCATGG - Intergenic
1156096451 18:33538697-33538719 CACAAAAAAGAGGGTATTCAAGG + Intergenic
1157113171 18:44840126-44840148 CATAAAGAGAAGTGTACACATGG - Intronic
1157454528 18:47814048-47814070 CATCAAGAGAAGGATATTCAAGG + Exonic
1157817278 18:50738797-50738819 CACAGAGAGAAGTATATTTAAGG + Intergenic
1159211543 18:65328461-65328483 TACAAAGATAAATGTATACAAGG - Intergenic
1159308852 18:66681596-66681618 CACAAAGAAGAGGATATTCAGGG + Intergenic
1159825652 18:73206055-73206077 AAAAAAGAGAAATATATTCAAGG - Intronic
1164502976 19:28834769-28834791 GCCATAGAGAAATGTATTCATGG + Intergenic
1165345563 19:35247166-35247188 CACAAAGAATAATGTTTTCAAGG - Intergenic
1166662001 19:44653555-44653577 AACACACAGCAGTGTATTCAAGG - Intronic
925290119 2:2742188-2742210 CACATAGAGAAATGGCTTCAAGG + Intergenic
926460311 2:13121680-13121702 CACAAAGAGAAAAGTACTCTGGG + Intergenic
926869709 2:17400648-17400670 AAAAATGAGAAGTGTATGCAAGG + Intergenic
926895866 2:17687684-17687706 CATAAACAAAAGTATATTCAGGG - Intronic
927222659 2:20728391-20728413 CACAAAGAGAGGGGTTATCAAGG - Intronic
927248347 2:20976307-20976329 AATAAAGAGAAGTGTTTTCCAGG + Intergenic
927332814 2:21885941-21885963 CACAAAGAGAACTAAATTCAGGG - Intergenic
929069353 2:38013439-38013461 CACAAAAAGAAGTGTACTCTGGG + Intronic
930279439 2:49352770-49352792 CACTACGAGAGGTGTATACAGGG + Intergenic
930355330 2:50311400-50311422 GACAAATAGGAGTGTATTTATGG + Intronic
930834327 2:55777090-55777112 CACAAACAGAAGTGAAATCTTGG + Intergenic
930853955 2:55992514-55992536 GACAAAGATAGATGTATTCAGGG - Intergenic
931102989 2:59023496-59023518 AACTAAGAGAAATGTATTCCAGG + Intergenic
931713270 2:65007952-65007974 GACAAAGAGAAGTTGATTAATGG - Intronic
933176933 2:79184981-79185003 CACAATGAGATCTGTTTTCAAGG + Intergenic
933905557 2:86888958-86888980 CACAGACAGAAGAGCATTCATGG - Intergenic
934132772 2:88965485-88965507 CACTAAGACAAGTATTTTCAAGG - Intergenic
934484958 2:94698084-94698106 CATAAAAAGAAATGAATTCATGG - Intergenic
935766391 2:106372125-106372147 CACAGACAGAAGAGCATTCATGG - Intergenic
936366606 2:111862685-111862707 CACAGACAGAAGAGCATTCATGG + Intronic
937878328 2:126843874-126843896 CACCAAGTGGAGTTTATTCAAGG + Intergenic
939877231 2:147591723-147591745 AATAAAGAGATGTGTATTCAAGG + Intergenic
940048084 2:149431200-149431222 CATAAAGAGAACCGTATTCAGGG + Intronic
941211782 2:162648568-162648590 AGCACAGAGATGTGTATTCATGG - Intronic
942343056 2:174970142-174970164 GACCAAAAGAAGTGTACTCAAGG - Intronic
942547804 2:177082792-177082814 AAAAAAGAGAATTGTATTAATGG - Intergenic
945697726 2:213129083-213129105 CACACAGAGAATTCTATTTATGG + Intronic
946851704 2:223913593-223913615 GTCAAAGATAAGTGTATGCATGG - Intronic
1169616506 20:7452478-7452500 AACAAATAGAAGTTTATTAAAGG - Intergenic
1170319157 20:15075668-15075690 CACAAGGAGGAGTTTACTCAGGG - Intronic
1170875932 20:20250110-20250132 CACAAAGAGAATTCTAGTCATGG - Intronic
1171205274 20:23274094-23274116 CACAAAGAAAAATGTATTTATGG - Intergenic
1174364315 20:50047205-50047227 CACCAGGAGAAGAGTATTCCCGG - Intergenic
1176919654 21:14672462-14672484 CACAAAGACAAGTGGAATTATGG - Intergenic
1177054265 21:16280395-16280417 CAAACAGAGAACTGCATTCATGG - Intergenic
1177549785 21:22605565-22605587 GACAAAGAGAAGTGGCTTAAAGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179309107 21:40181147-40181169 CACAAACAGAAATGTATGCATGG - Intronic
1179442037 21:41401819-41401841 CACAATGAGAAAAATATTCATGG - Intronic
1179459459 21:41523975-41523997 AACAAAGAGGAGTCTCTTCAGGG + Intronic
1182410823 22:30184205-30184227 CATAAAGAGGAGTCTATTAAAGG + Intergenic
1184180236 22:42817350-42817372 AACAAAGACAAATGTATTCGAGG + Intronic
949625037 3:5855870-5855892 CACCAACAGATTTGTATTCAAGG - Intergenic
950858352 3:16126197-16126219 AACAAACAGAAGTGCTTTCAAGG + Intergenic
951048067 3:18063314-18063336 CAGAAGGAGAAATGTAGTCAAGG + Intronic
951640943 3:24834563-24834585 TACAAAGTGAAGTGAACTCAAGG - Intergenic
952286319 3:31972852-31972874 CAAAAAGAAAAGATTATTCATGG + Intronic
954947945 3:54443147-54443169 AAATAAGAGAAGTTTATTCAAGG - Intronic
955611805 3:60765569-60765591 CACAGAGAGAAATGTAATCAGGG + Intronic
956573841 3:70729128-70729150 CACAAAGCAGAGTGCATTCAAGG + Intergenic
957034793 3:75283783-75283805 CTCAAAGAGAAGTGTAGCCCTGG + Intergenic
959672976 3:109000123-109000145 GGCAGAGAAAAGTGTATTCAAGG - Intronic
960139072 3:114135050-114135072 GAGAAAGAGAGGTGGATTCAGGG - Intronic
960680958 3:120247023-120247045 CACAAAGGGAAGGGTCTTCCAGG + Intronic
961907500 3:130277601-130277623 CAAAAAGATAAGGGTATACAAGG - Intergenic
964897837 3:161619485-161619507 CACAGAGAGAATGGAATTCATGG - Intergenic
965044841 3:163563876-163563898 CACAAAGAGAATTTGTTTCAGGG + Intergenic
966054296 3:175664334-175664356 CACAAAGAAATCTATATTCAAGG - Intronic
966864826 3:184251927-184251949 CAAAATGAAAAGTATATTCAAGG + Intronic
969096209 4:4734748-4734770 TCCAAAGGGAAGTCTATTCAGGG - Intergenic
969539168 4:7775352-7775374 CTCAAAGGGAAGTGAATTAAAGG - Intronic
970621305 4:17822096-17822118 AAAAAAGATAATTGTATTCATGG + Intronic
971783346 4:31067598-31067620 CACAAAATGAAGTGTTATCAAGG + Intronic
972040084 4:34582803-34582825 AACAAAGGGAATTGTATTCATGG + Intergenic
973792910 4:54394879-54394901 CACAAAGAGGATGGCATTCAGGG + Intergenic
974501408 4:62708703-62708725 TACACAGAGAAGTGTGTACAAGG + Intergenic
976315703 4:83656616-83656638 CTCAAAGAGAAATGTAATGAAGG + Intergenic
977146174 4:93442956-93442978 GACAGAGAGAAGAGAATTCAAGG - Intronic
977412907 4:96690573-96690595 AAGAAAGGGAAGTGCATTCAAGG + Intergenic
977818303 4:101442064-101442086 CTGAAGGAGATGTGTATTCAAGG - Intronic
979292414 4:118992329-118992351 GACAAAGAGGACTGGATTCAAGG + Intronic
979809732 4:125021554-125021576 AACAAACAGAAGTTTATTAATGG - Intergenic
980597842 4:134978219-134978241 CAAAGAGAGATGGGTATTCACGG - Intergenic
981451486 4:144903140-144903162 GAGAAAGATAAGTGGATTCATGG + Intergenic
982885612 4:160776907-160776929 TATAAATTGAAGTGTATTCAGGG + Intergenic
983157760 4:164372237-164372259 CCCAAAGAGACATGTATTTATGG - Intronic
983615302 4:169697566-169697588 CACAAAGAGAAGAGGATTCCAGG - Exonic
984463397 4:180064533-180064555 CACAAATATCAGTGTATTAATGG + Intergenic
985349672 4:189045372-189045394 CACAAAAAGGTGTGTATTTAAGG - Intergenic
985483097 5:130148-130170 CACAAAGAGAAGGAAATTGATGG + Intergenic
989289479 5:39746837-39746859 AGGAAAGAGAAGTGTATGCAGGG - Intergenic
990156139 5:52879479-52879501 CCCAAAGACATGTGTATCCATGG + Intronic
990240651 5:53813172-53813194 CACTAAAAGAAATGCATTCAGGG - Intergenic
990800652 5:59598977-59598999 CCAAAAGAGATGTGCATTCAAGG - Intronic
991426866 5:66500758-66500780 GACACAGAGAAGTGTGTTTATGG - Intergenic
991474134 5:67001989-67002011 CGCACAGAGAAGAGTAATCAAGG - Intronic
992891885 5:81211249-81211271 CACAAAGTTGAGTCTATTCACGG - Intronic
993067360 5:83115890-83115912 GACAAGGAGGAGTTTATTCATGG + Intronic
998661481 5:144243724-144243746 AACAAAAAAAAGAGTATTCATGG - Intronic
998661529 5:144244045-144244067 CATAAATAGAAAAGTATTCATGG - Intronic
998731801 5:145086055-145086077 CAGAAAGAGAAAAGGATTCATGG + Intergenic
999161311 5:149501988-149502010 CATAAAGAGAAGTCTTTTGATGG + Intronic
999210869 5:149887146-149887168 CACAAAGATAAGTCCATCCAAGG + Intronic
1000623729 5:163514844-163514866 AACTAAGACAAATGTATTCAAGG - Intronic
1000634800 5:163631774-163631796 CAAAAAGAGGAGTAAATTCAAGG - Intergenic
1001590315 5:172860310-172860332 CATAAAGAGAACCCTATTCAGGG - Intronic
1003273759 6:4630391-4630413 CACAAAGAGAAGAGGCTTGAAGG + Intergenic
1003666341 6:8115203-8115225 CACAAGAAGAAGTCTATTGATGG + Intergenic
1003693883 6:8382542-8382564 CAGACAGAGAAGTGTAGTAAAGG + Intergenic
1004715070 6:18208952-18208974 CCCAAATAGAAGTATATTAAAGG + Intronic
1005859778 6:29891284-29891306 CACAATGAGATTTGTATGCAGGG - Intergenic
1005867353 6:29946083-29946105 CACAAGGAGATTTGTATGCAGGG - Intergenic
1006061613 6:31424550-31424572 CACAAAAAGAAGTGAAATAACGG - Intergenic
1007650356 6:43416399-43416421 GATACAGAAAAGTGTATTCATGG + Intergenic
1008327481 6:50201490-50201512 AAAAAAAAGAAGTATATTCATGG - Intergenic
1009849256 6:69174424-69174446 CACAAAAAGAAATGAAGTCATGG - Intronic
1010231488 6:73539156-73539178 AAAAAAGAGATGTGAATTCATGG + Intergenic
1011716361 6:90109301-90109323 CACAAGAAGAAGTGGTTTCATGG - Intronic
1012550768 6:100463603-100463625 CACCAAGAACAGTGTATTGATGG + Exonic
1013169555 6:107624296-107624318 AACAAGGTGAAGTGTATTCCTGG + Intronic
1014344843 6:120255151-120255173 CACAAAGAGGAGGGTATGAAAGG - Intergenic
1015175780 6:130306685-130306707 CCCAAAGATAAGTGTATACAGGG + Intronic
1017556809 6:155580462-155580484 CATAAAGAGAAGAGAATTCAGGG + Intergenic
1017849546 6:158293203-158293225 CACAAAGAGGTGTATTTTCAAGG - Intronic
1021277330 7:18668847-18668869 CACAAAGCCAAGTGTATGAAAGG - Intronic
1021469640 7:20986700-20986722 AACAAGGAGAAGAGTTTTCATGG + Intergenic
1022728677 7:33003240-33003262 CACAAAGAGGAGTGTGGTCCTGG - Intronic
1023711190 7:42994629-42994651 CATAAAAAGAAGTGTAAGCATGG - Intergenic
1024201473 7:47112677-47112699 TACAAAGAAAAATGTGTTCATGG - Intergenic
1024282424 7:47730468-47730490 CACAAAGAGAAGTTTCCACATGG + Intronic
1024350146 7:48355294-48355316 CACAAGGGGAAGTGTGTTCTAGG + Intronic
1025044970 7:55684749-55684771 CACAAAGAGGAGTGTGGTCCTGG + Intergenic
1026306999 7:69150991-69151013 CACAAAGAGTATTGCATGCAAGG - Intergenic
1026764619 7:73152720-73152742 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027041089 7:74962488-74962510 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027082548 7:75239885-75239907 CCCAAACAGAAATGCATTCAGGG + Intergenic
1028428456 7:90718270-90718292 CATTAAGAGAAGTGTATACATGG + Intronic
1030036536 7:105412002-105412024 CACACAAAGATGTGAATTCAGGG + Intergenic
1030761403 7:113357041-113357063 CATAAAGAGATGTCTTTTCAAGG - Intergenic
1030834300 7:114264301-114264323 CAAAAATAGAAGTTTTTTCATGG + Intronic
1031040962 7:116838167-116838189 CCCAAAGAGGAGTGTAATCCAGG - Intronic
1031278493 7:119763964-119763986 AGCAAAGAGAAGAGTATTCCAGG - Intergenic
1031740706 7:125426557-125426579 CACAAACACAAATCTATTCATGG - Intergenic
1033674283 7:143522435-143522457 CGCAAACAGCAGTGTAGTCATGG + Intergenic
1033687059 7:143650611-143650633 CGCAAACAGCAGTGTAGTCATGG + Intronic
1033697552 7:143807012-143807034 CGCAAACAGCAGTGTAGTCATGG - Intergenic
1033963108 7:146938099-146938121 AACAAAGATAAGTGAATTGAAGG + Intronic
1037692785 8:21196842-21196864 GACAGAGAGAAGTTTATTAAGGG + Intergenic
1037776288 8:21838120-21838142 CATAAATAGAAGTGGATTCAGGG - Intergenic
1039133653 8:34295842-34295864 CTCTAAGAGAAATGTAGTCAAGG - Intergenic
1039444206 8:37617916-37617938 GACAAAGAGAAGTTGGTTCAGGG + Intergenic
1041007176 8:53506975-53506997 CAGAAAGTGAAGAGAATTCAAGG - Intergenic
1041765600 8:61415144-61415166 AACAGAGAGAAGTGTTTTGAGGG - Intronic
1043100983 8:76045355-76045377 CAAACAGAGAAGTGAATTCTAGG + Intergenic
1043959630 8:86402266-86402288 CAAAAAGGGAAGTGTAGGCATGG - Intronic
1043981322 8:86643398-86643420 CATAAAGAAAAGTGGATTAAAGG - Intronic
1046106222 8:109669781-109669803 AACAAAGACAATTGTAATCAAGG - Intronic
1047593449 8:126351706-126351728 GACAGAGTGAAGTATATTCAGGG + Intergenic
1048911584 8:139140497-139140519 CACAAAGATTAGGGTATCCAAGG - Intergenic
1048950083 8:139489459-139489481 CACAAAGAGGAATGTTGTCAGGG - Intergenic
1049629866 8:143647918-143647940 AACAAAGGGAAGAGGATTCAAGG + Intronic
1050268507 9:3916750-3916772 TGCAAAGAGATGTGCATTCAGGG - Intronic
1050501697 9:6304938-6304960 AAGAAAGAAAAGTGGATTCAAGG - Intergenic
1050522179 9:6512287-6512309 CAGAAATAAAAGTGAATTCACGG - Intergenic
1050762302 9:9087545-9087567 CATACAGAGAAGTGATTTCAAGG + Intronic
1051061166 9:13046703-13046725 CCCAAAGAGCAGTGTATTCTGGG + Intergenic
1051239196 9:15034327-15034349 CACAAAGAGAAGAGGATTCCAGG + Intergenic
1051786295 9:20747616-20747638 CACAAATAGTAGTGTTTTCCAGG - Intronic
1052102227 9:24462495-24462517 CACAAATGGAAGTATATTCATGG + Intergenic
1054878796 9:70123736-70123758 CACAGAGAGAAATGTACACAGGG + Intronic
1055556992 9:77484370-77484392 CAAAAAGAGAATTGTGATCATGG + Intronic
1056136051 9:83630187-83630209 AACAAAGAGAAGTGCACTCTTGG - Intronic
1057005073 9:91550015-91550037 TACAGAGAGAAGAGTAATCAAGG + Intergenic
1057344641 9:94238589-94238611 CATAAGGAGAAGTGAATTCTGGG - Intergenic
1057620374 9:96629252-96629274 CACAATTAGAAGTGAATTAAAGG + Intergenic
1059382918 9:113942268-113942290 CACACAGAGGAGTGGCTTCATGG + Intronic
1060466404 9:123910525-123910547 AACAAACAAAAGTATATTCATGG + Intronic
1060895509 9:127214665-127214687 CATAAAGAGAAATGTAAACACGG - Intronic
1062163608 9:135093846-135093868 CAGAAAGGAAAGTGCATTCAGGG + Intronic
1186509379 X:10118934-10118956 CACAAAGATCACTGCATTCAAGG - Intronic
1186656885 X:11622145-11622167 CAAAAAGATATGTGAATTCAAGG + Intronic
1188376821 X:29441393-29441415 CACAATGAGAAGTGTGTTTCAGG - Intronic
1189661488 X:43304705-43304727 AACATAGAGAAGTAAATTCAGGG - Intergenic
1191998738 X:67125457-67125479 CAAATTAAGAAGTGTATTCAGGG + Intergenic
1194580396 X:95664943-95664965 AACAAAGGAAAGTGTATTGAAGG + Intergenic
1196411522 X:115424966-115424988 CCCAGAGAGAAGTGGATGCAGGG + Intergenic
1198107979 X:133479075-133479097 CACAAACAGAAGAGAATTAAGGG + Intergenic
1198152519 X:133924861-133924883 GACAAAGAGAAAAGTATTCGTGG + Intronic
1199782997 X:151080672-151080694 CACAAACAAATGTGAATTCATGG - Intergenic