ID: 1155264425

View in Genome Browser
Species Human (GRCh38)
Location 18:24077120-24077142
Sequence AGTGAAGCAGGGGACACACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155264425_1155264433 17 Left 1155264425 18:24077120-24077142 CCCGGTGTGTCCCCTGCTTCACT No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155264425 Original CRISPR AGTGAAGCAGGGGACACACC GGG (reversed) Intronic