ID: 1155264426 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:24077121-24077143 |
Sequence | GAGTGAAGCAGGGGACACAC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1155264426_1155264433 | 16 | Left | 1155264426 | 18:24077121-24077143 | CCGGTGTGTCCCCTGCTTCACTC | No data | ||
Right | 1155264433 | 18:24077160-24077182 | GCCCATCTGCTCCTTCCTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1155264426 | Original CRISPR | GAGTGAAGCAGGGGACACAC CGG (reversed) | Intronic | ||