ID: 1155264428

View in Genome Browser
Species Human (GRCh38)
Location 18:24077131-24077153
Sequence CTTGGAGGCAGAGTGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155264428_1155264440 30 Left 1155264428 18:24077131-24077153 CCCTGCTTCACTCTGCCTCCAAG No data
Right 1155264440 18:24077184-24077206 ATTCCTGCTGCTCTCTCCTGGGG No data
1155264428_1155264433 6 Left 1155264428 18:24077131-24077153 CCCTGCTTCACTCTGCCTCCAAG No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data
1155264428_1155264439 29 Left 1155264428 18:24077131-24077153 CCCTGCTTCACTCTGCCTCCAAG No data
Right 1155264439 18:24077183-24077205 CATTCCTGCTGCTCTCTCCTGGG No data
1155264428_1155264438 28 Left 1155264428 18:24077131-24077153 CCCTGCTTCACTCTGCCTCCAAG No data
Right 1155264438 18:24077182-24077204 GCATTCCTGCTGCTCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155264428 Original CRISPR CTTGGAGGCAGAGTGAAGCA GGG (reversed) Intronic