ID: 1155264433

View in Genome Browser
Species Human (GRCh38)
Location 18:24077160-24077182
Sequence GCCCATCTGCTCCTTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 277}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155264426_1155264433 16 Left 1155264426 18:24077121-24077143 CCGGTGTGTCCCCTGCTTCACTC 0: 1
1: 0
2: 3
3: 28
4: 304
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG 0: 1
1: 0
2: 1
3: 24
4: 277
1155264430_1155264433 -9 Left 1155264430 18:24077146-24077168 CCTCCAAGCCGCTCGCCCATCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG 0: 1
1: 0
2: 1
3: 24
4: 277
1155264428_1155264433 6 Left 1155264428 18:24077131-24077153 CCCTGCTTCACTCTGCCTCCAAG 0: 1
1: 0
2: 4
3: 39
4: 412
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG 0: 1
1: 0
2: 1
3: 24
4: 277
1155264424_1155264433 25 Left 1155264424 18:24077112-24077134 CCTTTTGTCCCGGTGTGTCCCCT 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG 0: 1
1: 0
2: 1
3: 24
4: 277
1155264427_1155264433 7 Left 1155264427 18:24077130-24077152 CCCCTGCTTCACTCTGCCTCCAA 0: 1
1: 1
2: 5
3: 41
4: 475
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG 0: 1
1: 0
2: 1
3: 24
4: 277
1155264429_1155264433 5 Left 1155264429 18:24077132-24077154 CCTGCTTCACTCTGCCTCCAAGC 0: 1
1: 0
2: 1
3: 39
4: 404
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG 0: 1
1: 0
2: 1
3: 24
4: 277
1155264425_1155264433 17 Left 1155264425 18:24077120-24077142 CCCGGTGTGTCCCCTGCTTCACT 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG 0: 1
1: 0
2: 1
3: 24
4: 277
1155264423_1155264433 26 Left 1155264423 18:24077111-24077133 CCCTTTTGTCCCGGTGTGTCCCC 0: 1
1: 0
2: 0
3: 6
4: 195
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG 0: 1
1: 0
2: 1
3: 24
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155264433 Original CRISPR GCCCATCTGCTCCTTCCTAC TGG Intronic
900019511 1:179186-179208 GCCCCTTTGCTCCTTCCTTAAGG + Intergenic
900197128 1:1382118-1382140 GGCCATCTGCCCCTTCCTTCTGG - Intergenic
900324275 1:2100384-2100406 CCCCAGCTGCCCCTTCCTCCAGG + Intronic
900575032 1:3378889-3378911 CTCCATCTGCTCCCTCCTTCAGG + Intronic
901166596 1:7225861-7225883 GCTCCTCTGCTCATCCCTACAGG + Intronic
901656392 1:10772157-10772179 CCCCTTCTCCTCCTTCCTCCAGG - Intronic
903236666 1:21955245-21955267 GCCCTTCTGATCCCTCCTCCTGG - Intergenic
904590628 1:31613511-31613533 GCCACTCTGCTGCTTACTACTGG - Intergenic
905010085 1:34741464-34741486 GCCCCTCTTCCCCTTCCCACCGG - Intronic
906034079 1:42740137-42740159 GCCCAGCTGCTCCTCCCACCTGG - Exonic
907775748 1:57512857-57512879 GCCCACAGGCTCCTGCCTACTGG + Intronic
909394199 1:75151176-75151198 TTCCATCTGCTTCTTCGTACAGG - Intronic
909491361 1:76229877-76229899 GCCCCTCTGCTCCTCCCTACTGG - Intronic
912232094 1:107806150-107806172 GCCCTTGTGCTGCTTCCTATGGG + Intronic
912503989 1:110143155-110143177 GCCCACCTGCTCCTGTCTGCAGG - Intergenic
913442742 1:118916173-118916195 GCACATCTGCTTCTTTCTTCTGG - Intronic
913703773 1:121397839-121397861 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
913942432 1:125120349-125120371 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
913980124 1:143499548-143499570 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
914074472 1:144325033-144325055 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
914104704 1:144641413-144641435 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
914814392 1:151052880-151052902 GCCCTTCTCCTCCTTCCTGCTGG - Exonic
917056798 1:170991365-170991387 ACCCACCTGCTCCTGCCTACAGG - Intronic
919599042 1:199600011-199600033 CCACAGCTGCCCCTTCCTACAGG - Intergenic
919866407 1:201786407-201786429 GTTCTTCTGCTGCTTCCTACAGG + Exonic
923520647 1:234732778-234732800 GACCAGCTGCTCCCTCCTCCTGG - Intergenic
924616687 1:245617899-245617921 TCCCCCCTGCTCCTTCCCACAGG + Intronic
924955965 1:248927155-248927177 GCCCCTTTGCTCCTTCCTTAAGG - Intergenic
1062966657 10:1612305-1612327 GCCGCTCTGCTCTTTCCTCCTGG - Intronic
1063077673 10:2733023-2733045 GCCCATCTCCTGCTTCCTGAAGG + Intergenic
1063227978 10:4034089-4034111 GCCCCTCTTCTCCTTCGTATTGG + Intergenic
1066063496 10:31745070-31745092 TTCCACCTGCTCCTTCCCACTGG + Intergenic
1066694863 10:38068732-38068754 TCCCCTCTTCTCCTTCCTCCAGG - Intergenic
1066780891 10:38943351-38943373 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1066997648 10:42578450-42578472 TCCCCTCTTCTCCTTCCTCCAGG + Intronic
1069534886 10:69245978-69246000 TCCCATGTGCTCCTTCCTGTGGG + Intronic
1070411949 10:76149993-76150015 GGCCATTTGCTGCTTCCCACAGG + Intronic
1073295207 10:102434671-102434693 GCCCATCACCCCCTTCCTAGGGG - Intergenic
1075312032 10:121422297-121422319 GCCCATCAGCTCAGTCCTATTGG - Intergenic
1075452089 10:122558429-122558451 CCTCATCTTCCCCTTCCTACTGG - Intergenic
1075737467 10:124672777-124672799 GCCCAGCTGCTCCTTGCCACTGG - Intronic
1076815024 10:132910337-132910359 GCTCAGCTGCTCCTTCCTGCGGG - Intronic
1076908960 10:133378057-133378079 GGCCATCTCCTCCTGCCTCCAGG - Intergenic
1076961600 10:133766561-133766583 GCCCCTTTGCTCCTTCCTTAAGG - Intergenic
1076976114 11:174381-174403 GCCCCTTTGCTCCTTCCTTAAGG + Intronic
1077236270 11:1483394-1483416 GCCCTTCTGCTTCTTCCAAGTGG - Intronic
1078068622 11:8094157-8094179 TCCCTTCTTCTCCTTCCTAGCGG - Exonic
1078142612 11:8702958-8702980 GCCCCTCAACTCCTTCCTTCTGG - Intronic
1078446542 11:11409182-11409204 GCCCACCTGCTTCTAGCTACTGG + Intronic
1078693060 11:13601341-13601363 TCACACCTCCTCCTTCCTACAGG + Intergenic
1078883619 11:15478205-15478227 GCCCGTCTGCTCCATCCTCCTGG + Intergenic
1081589490 11:44411312-44411334 GCCCTTCTGCTCCTTTATAAAGG + Intergenic
1083046594 11:59741817-59741839 TCCCACCTGCTCCTTCCACCTGG + Intronic
1083475051 11:62910051-62910073 GGCCAGCTGCTCCTTTCCACGGG + Exonic
1084509891 11:69596966-69596988 GCCCCTCAGCTTCTTCCTGCAGG - Intergenic
1084519684 11:69655703-69655725 GCCCAGCTCCTCCTTGCTCCTGG + Intronic
1084918266 11:72447908-72447930 GCCACTCTGCTTCTTCCAACTGG + Intergenic
1084950972 11:72665305-72665327 GCCTCCCTGCTCCTTCCTGCGGG + Intronic
1085014329 11:73162979-73163001 GCCCCTCTGGACCTTCCTCCTGG + Intergenic
1085521483 11:77141634-77141656 GCCCATCAGGTCCTACCTCCTGG + Intronic
1086804812 11:91227189-91227211 GCCCATCTGGTTTCTCCTACTGG + Intergenic
1087128942 11:94652371-94652393 GCCCAGTTGTTCCTTCCTGCGGG - Intergenic
1087938245 11:104061000-104061022 CCCCATTTCCTCCTTCCCACAGG + Intronic
1089497117 11:118913538-118913560 CCCCAGCTGCTCCCTCCCACAGG + Intronic
1089938546 11:122390925-122390947 GCCTATCTTCTCTCTCCTACTGG - Intergenic
1090283857 11:125481684-125481706 GCCCAGCTCTTCCTTCCTCCAGG - Intronic
1090389759 11:126381316-126381338 GCCCATTTTCTCCATCCTGCAGG - Intronic
1090702501 11:129309251-129309273 GCCCACCTGCCCTTTTCTACTGG + Intergenic
1096753994 12:53783650-53783672 GCCCATCTGCCTCCTACTACAGG + Intergenic
1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG + Intergenic
1104109917 12:125695299-125695321 TCCCATCTGCTCTTGCCTTCTGG + Intergenic
1106540012 13:30681976-30681998 TCAGATCTGCTCCTTCCTATGGG + Intergenic
1106669393 13:31888632-31888654 TCCCATCTCCTCCTGCCTTCAGG + Intergenic
1107339907 13:39395021-39395043 TCCCCACTGCTCCTTCCCACGGG + Intronic
1108115971 13:47128556-47128578 GCACCTCTGCTCCTGCCTAGTGG + Intergenic
1108121659 13:47194467-47194489 GCTCCTCTGCTCCTTCCTTTGGG + Intergenic
1110190311 13:72722756-72722778 TCCCATCTGCTCCTTTCTTTTGG + Intronic
1111685882 13:91500374-91500396 GGCCATCTGATATTTCCTACTGG + Intronic
1116239240 14:42320239-42320261 CCCCATCTGCTGGTTCCTGCTGG + Intergenic
1121626007 14:95385870-95385892 GCTCATCTGCCCCTTCCTGGTGG + Intergenic
1122272221 14:100573393-100573415 CCCCAGCTGCTCCTTCCCACTGG - Intronic
1122582688 14:102781155-102781177 GGCCATCTGGTCCCTCTTACAGG + Intronic
1202939689 14_KI270725v1_random:135803-135825 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1123393446 15:19900089-19900111 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1124881422 15:33646162-33646184 GCAGATCTGTTTCTTCCTACGGG + Intronic
1125506616 15:40271241-40271263 GCCCTTCTGCTCTTTCTGACAGG - Intronic
1126106112 15:45148062-45148084 GCCCTTCTGCTCTCTCCTTCAGG - Intronic
1126236070 15:46386023-46386045 GTCAATCTGCTCCTTCGTATAGG - Intergenic
1126802696 15:52314328-52314350 GACCAGCTCCTCCTTCCTTCTGG - Intronic
1128236944 15:66074111-66074133 GCCCATCTTCTCCTTCCCCAGGG + Intronic
1128671424 15:69577196-69577218 GCATTTCTGCTCCTTCCTGCGGG + Intergenic
1129333119 15:74837929-74837951 CCTTATCTGCTCCTTCCTCCAGG + Intronic
1130273429 15:82464247-82464269 GCCCATCTGCCGCTTCATCCAGG + Intergenic
1130465780 15:84191618-84191640 GCCCATCTGCCGCTTCATCCAGG + Intergenic
1130486915 15:84403206-84403228 GCCCATCTGCTGCTTCATCCAGG - Intergenic
1130498485 15:84481918-84481940 GCCCATCTGCCGCTTCATCCAGG - Intergenic
1130588069 15:85196214-85196236 GCCCATCTGCCGCTTCATCCAGG + Intergenic
1131090972 15:89624830-89624852 CCCCATCTCCTCCTTCCTGTGGG + Exonic
1132405062 15:101536913-101536935 CCCCATCTGCTGCTGCCCACAGG + Intergenic
1132843796 16:1990775-1990797 GCCCTGCTGCTCCTTCCCTCCGG + Intronic
1133285961 16:4690975-4690997 TCCTGTCTGCTCCTTCCTCCGGG + Intergenic
1133466823 16:6035336-6035358 GCCCATCTGCTCCATCCTTGGGG - Intronic
1136079438 16:27841779-27841801 GCTCCTCTGCTCCCTCCTTCGGG - Intronic
1136696120 16:32083734-32083756 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1136699444 16:32117463-32117485 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1136715735 16:32279646-32279668 ACCCATGTGCTTCTTCCTTCAGG - Intergenic
1136752176 16:32650121-32650143 ACCCATGTGCTTCTTCCTTCAGG + Intergenic
1136768206 16:32810471-32810493 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1136771461 16:32845411-32845433 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1136796614 16:33026986-33027008 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1136799936 16:33060634-33060656 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1136822417 16:33330341-33330363 ACCCATGTGCTTCTTCCTTCAGG - Intergenic
1136828980 16:33386880-33386902 ACCCATGTGCTTCTTCCTTCAGG - Intergenic
1136834046 16:33485662-33485684 ACCCATGTGCTTCTTCCTTCAGG - Intergenic
1136899120 16:34016014-34016036 ACCCATCTGCTTCTTCCTGCAGG - Intergenic
1136902345 16:34051895-34051917 ACCCATCTGCTTCTTCCTGCAGG - Intergenic
1136957835 16:34804644-34804666 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1137084067 16:36100612-36100634 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1140232753 16:73131471-73131493 GCACGTCTGATTCTTCCTACTGG + Intronic
1140670010 16:77269089-77269111 GGCCACCTGCTCCTTCCTCTGGG + Intronic
1142151819 16:88515904-88515926 GCCCATCCACTCATTCCTCCTGG - Intronic
1142444145 16:90123287-90123309 GCCCCTTTGCTCCTTCCTTAAGG - Intergenic
1203010870 16_KI270728v1_random:238858-238880 ACCCATGTGCTTCTTCCTTCAGG + Intergenic
1203054319 16_KI270728v1_random:910105-910127 ACCCATGTGCTTCTTCCTTCAGG + Intergenic
1203070598 16_KI270728v1_random:1072487-1072509 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1203073885 16_KI270728v1_random:1107522-1107544 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1142463362 17:112191-112213 GCCCCTTTGCTCCTTCCTTAAGG + Intergenic
1142562028 17:815883-815905 GCCCCTCTTATCCTCCCTACTGG - Intronic
1142965941 17:3581374-3581396 ACCCTTCTGCTCCCTCCCACAGG + Intronic
1143408704 17:6695802-6695824 GCTGATCTGCTTCTTCCTGCTGG - Exonic
1144638778 17:16926489-16926511 GCACCTCTGCTCCTCCCTTCAGG - Intergenic
1145355797 17:22148591-22148613 GCCCATGTGTTTCTTCCCACCGG + Intergenic
1145690361 17:26732494-26732516 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1145710136 17:26963648-26963670 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1145766862 17:27464164-27464186 ACCCATTTGCTTCTTCCTGCAGG - Intronic
1145799928 17:27676447-27676469 CCCCATCTGCTGCTTCCTGGGGG + Intergenic
1146693603 17:34892969-34892991 GCCCTTCTCCCCCTTCCTTCTGG + Intergenic
1148515364 17:48211858-48211880 GCCCCTTTCCTCCTTCCTGCTGG - Intronic
1150564209 17:66324130-66324152 GACCATCTGCTTCTTCAAACAGG - Intronic
1152964701 18:104293-104315 GCCCCTTTGCTCCTTCCTTAAGG + Intergenic
1153374304 18:4358017-4358039 CTCCATCTGATCCTTCCAACAGG - Intronic
1154033010 18:10769853-10769875 GCCCTTCTGCCCCTGCCTATGGG - Intronic
1154491918 18:14929098-14929120 GCACATCTGTTCCTTCATCCAGG + Intergenic
1154518121 18:15196988-15197010 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG + Intronic
1156527478 18:37780063-37780085 CTCCATCTCCTCCTTCCTATGGG - Intergenic
1157509691 18:48261969-48261991 TCCCCTCTGCACCTTCCTTCTGG - Intronic
1158193889 18:54862569-54862591 GCTCTTCTGCTGATTCCTACTGG + Intronic
1158684473 18:59600704-59600726 CCCCATCTCCTCCTGCCCACTGG + Intronic
1160653079 19:244629-244651 GCCCTTTTGCTCCTTCCTTAAGG + Intergenic
1161216461 19:3097182-3097204 GCCCAACAGCCCCTTCCTTCCGG - Intronic
1161258340 19:3322028-3322050 CCCCATCTTCTCCCTCCTCCTGG - Intergenic
1161739539 19:6012248-6012270 GCACATCTGCTTCTTTCTCCTGG + Intronic
1161810098 19:6466593-6466615 ACCCACCTGCTCCTCGCTACTGG - Exonic
1162131698 19:8530037-8530059 GCCCATATGCACCTGCCCACAGG - Intronic
1163291856 19:16384184-16384206 GCCCATCTGCCCCTGCCTGGGGG + Intronic
1163361230 19:16847454-16847476 GCCCTCCTGCACCTTCCCACAGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163559346 19:18009761-18009783 GCCCCACTGCTCCTTGCTGCAGG + Exonic
1164386496 19:27775257-27775279 GTCCCTATGCTCCTTCCTGCAGG + Intergenic
1165340162 19:35205612-35205634 GTCCATCTGGCCCTTCCTCCTGG + Intergenic
1165913378 19:39243730-39243752 ACCCATCCCCTCCTCCCTACAGG - Exonic
1165917577 19:39269893-39269915 ACCCATCCCCTCCTCCCTACAGG + Exonic
1167007047 19:46782823-46782845 GCTCAGATGCTCCTTCCTCCAGG - Intronic
1167528500 19:50000456-50000478 GCCCATCTGCCCCCTACCACCGG - Intronic
1168356578 19:55703959-55703981 GCGCTTGTGCTCCTTCCTTCTGG + Intronic
1202670012 1_KI270709v1_random:41152-41174 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1202680021 1_KI270712v1_random:1922-1944 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
924958888 2:15908-15930 GCCCCTTTGCTCCTTCCTTAAGG + Intergenic
925053558 2:836236-836258 GCCCAGCTGTTCCTTCCCAAAGG + Intergenic
926127684 2:10282024-10282046 GCCCAAGTGCTCCTTCCTGCCGG - Intergenic
926781106 2:16472660-16472682 ACCCATCTTCTCCTGCCTTCAGG + Intergenic
927110477 2:19860837-19860859 GCCCTCCTTCTCCTTCCTCCAGG + Intergenic
928322601 2:30295452-30295474 GCTCTTGTGCCCCTTCCTACAGG - Intronic
931198144 2:60072687-60072709 GCCCCTCTGCTCCTGACTCCTGG - Intergenic
931722293 2:65075994-65076016 GGCCAGCTGCTCCACCCTACTGG + Intronic
931938191 2:67221625-67221647 GGACATCTGCTTCTTTCTACTGG + Intergenic
932141180 2:69279782-69279804 CCCCATGTTCTCCTTCCTAGAGG - Intergenic
932323336 2:70837961-70837983 GCCCTTCTGCTCCTGGCTCCTGG + Intergenic
934251403 2:90359255-90359277 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
934258157 2:91444143-91444165 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
935673087 2:105572023-105572045 GCCCGTTTGCTCCTTCATATAGG - Intergenic
936792004 2:116162204-116162226 GCACCTCTGCTCCTTCCAGCTGG - Intergenic
938233404 2:129680988-129681010 GCCCATGGGCTTCTTCCTAGGGG - Intergenic
938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG + Intronic
941568582 2:167140926-167140948 TCCCAGCTGCCCCTTCTTACTGG - Intronic
943188633 2:184647167-184647189 TCCTATCTCCTCCTTCCTAGGGG - Intronic
943361997 2:186930957-186930979 TTCCATCTTCTCCTTTCTACCGG + Intergenic
945392167 2:209277627-209277649 GCTAATCAGCTCCTTCCTACTGG + Intergenic
945524078 2:210866459-210866481 GGCAACCTGCTCCTTCCTATGGG - Intergenic
1172645967 20:36469837-36469859 GGCCATCTGCTCCTTCTCCCTGG + Intronic
1173124052 20:40320464-40320486 GCCCATCTCCTTCTCCCTAGGGG - Intergenic
1173318885 20:41969927-41969949 TAGCCTCTGCTCCTTCCTACTGG - Intergenic
1173891958 20:46519626-46519648 CCCCATCTGCTGGTTCCTGCTGG - Intergenic
1175074332 20:56360274-56360296 GCCCAGCTGTTCCTTCCTCCGGG + Intronic
1176071252 20:63227488-63227510 ACCCAGATGCTCCTTCCTATTGG - Intergenic
1176583501 21:8551282-8551304 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1177011076 21:15730464-15730486 GCCCCACTTCTCCTTCCGACGGG + Intronic
1178682554 21:34685159-34685181 GCATATCAGCTTCTTCCTACTGG - Intronic
1179106060 21:38401758-38401780 ATCCATCTGCTCCTTCCTGATGG - Intronic
1180266311 22:10528213-10528235 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1181817762 22:25451475-25451497 GCCTAACTATTCCTTCCTACAGG + Intergenic
1182737697 22:32542883-32542905 GGCCAGCTGCTCCCTCCCACTGG + Intronic
1183476623 22:38039194-38039216 CCCCATCTGGTGCTTCCCACGGG - Intronic
1184330990 22:43827705-43827727 GCCCATATGCTCCTTCCCTTGGG - Intronic
1184829162 22:46972973-46972995 GCCCAGCTGCTCACTCCTGCTGG + Intronic
1185061730 22:48610522-48610544 GCCCCTCTGCTCCTCCGTGCTGG - Intronic
1185061747 22:48610586-48610608 GCCCCTCTGCTCCTCCATGCTGG - Intronic
1203289059 22_KI270735v1_random:16956-16978 GCCCATTTGCTTCTTCCTGCAGG + Intergenic
1203324825 22_KI270738v1_random:4138-4160 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
949878324 3:8641627-8641649 GCCCATCTGGTCTTTCCCACAGG - Intronic
950640638 3:14346096-14346118 TCCCAACAGCTCCTTCCTCCAGG + Intergenic
951084435 3:18494306-18494328 CCCCATCTGCTCCCTCCTGAAGG + Intergenic
955023771 3:55147294-55147316 GCTCATCTGATCCTTCCCATTGG + Intergenic
957140728 3:76352323-76352345 GCACATCCCCTCGTTCCTACTGG + Intronic
958641622 3:96813856-96813878 CCCCCTCTGCTGCTTCCTCCCGG + Intergenic
959560368 3:107772989-107773011 GCACATATGATCCTTTCTACTGG - Exonic
962443106 3:135440999-135441021 GCCCTTCTGTTCCTTCCCCCTGG + Intergenic
964017299 3:151963335-151963357 GCCCATCAGCACCTTCCTTTGGG + Intergenic
965494848 3:169385136-169385158 GCCCATCTGTGCCCTCCCACTGG + Intronic
967371180 3:188748100-188748122 GTACATCTGCTCCATCGTACTGG + Intronic
968359781 3:198138820-198138842 GCCCACCTGCTCCTCCCTAATGG - Intergenic
968364765 3:198175404-198175426 GCCCCTTTGCTCCTTCCTTAAGG - Intergenic
968659227 4:1792376-1792398 GGCCATCTGCTCCCACCTTCAGG - Intergenic
979848436 4:125546391-125546413 GCTCACATGCTCCTTCCCACAGG - Intergenic
982116345 4:152101477-152101499 TCCCATATGCTTCTACCTACAGG - Intergenic
983210421 4:164952764-164952786 GCCCAGGTGCTCCCTCCTTCAGG + Intergenic
983231671 4:165135215-165135237 GCCCATCTGATCGTTTCTAATGG - Intronic
983833167 4:172357136-172357158 GCCAATCAGCGCCTTCCTCCTGG + Intronic
985464830 4:190184043-190184065 GCCCCTTTGCTCCTTCCTTAAGG - Intronic
985628024 5:1000172-1000194 GCCCATCTGCTGCCTCCTAAGGG + Intergenic
986685111 5:10269710-10269732 GCCCATCTGGTTATTCCTTCAGG + Intergenic
988393116 5:30661370-30661392 GCCCATTTGCTCCTTCAGCCTGG - Intergenic
988503045 5:31799314-31799336 GCCCATCCCCACCTTCCTGCAGG - Exonic
994045807 5:95308565-95308587 GCCCATCCTCTCTTTCCTGCTGG - Intergenic
995509350 5:112892736-112892758 GCCCATCTTCTCCCTCCTCTCGG - Exonic
998515511 5:142750157-142750179 TCCCATCTTCTCCATCCTCCAGG - Intergenic
999229691 5:150054351-150054373 GCAGATCTGCTCCTTCCTTCAGG - Exonic
1002640872 5:180630131-180630153 GCCCAGCTGCCCCTTGCTCCTGG + Intronic
1002755353 6:154336-154358 GCCCCTTTGCTCCTTCCTTAAGG + Intergenic
1005808855 6:29501207-29501229 GCCCAGCTTCACCTTCATACTGG - Intergenic
1006445093 6:34075532-34075554 GCCCGTCTGCTCCTCTCCACTGG + Intronic
1009194043 6:60663546-60663568 CCACAGCTGCTCCTTCCTCCAGG + Intergenic
1011022061 6:82825577-82825599 GCTCATATGGTCCTTGCTACTGG - Intergenic
1011214225 6:84987744-84987766 GGCAATCTGCTCCTTCCTCTGGG - Intergenic
1017158076 6:151340539-151340561 GCTCACCTGCTCCCTCCAACTGG - Intronic
1017890128 6:158631072-158631094 GCCTGCCTGCTCCTTCCCACAGG + Intronic
1019251426 7:15485-15507 GCCCCTTTGCTCCTTCCTTAAGG + Intergenic
1019260207 7:77830-77852 GCCCACCTGCTCCTCCCTAATGG + Intergenic
1021178238 7:17475158-17475180 GCCCCTCTGCTCTCTCCTTCCGG + Intergenic
1022536892 7:31103850-31103872 GTCCATCCACTCCTTCCTCCAGG - Intronic
1024747643 7:52426987-52427009 TCCCATCTGCTGGTTCCTACTGG - Intergenic
1025478847 7:60957798-60957820 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1025482053 7:60993446-60993468 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1025553208 7:62274895-62274917 ACCCATTTGCTTCTTCCTGCAGG + Intergenic
1026076831 7:67179324-67179346 GGCCATCTGCTGGTTCCTGCTGG + Intronic
1026700031 7:72633015-72633037 GACCATCTGCTGGTTCCTGCTGG - Intronic
1028728862 7:94121900-94121922 ACACCTCTGCTCCTTCCTCCAGG + Intergenic
1031688043 7:124756697-124756719 GCACTTCTGCTCCATCCTCCAGG - Intronic
1031966752 7:128032456-128032478 ACCCAACTGCTCCCTCCGACCGG - Intronic
1033075552 7:138247033-138247055 CCCCATCTCCTCCTTCCCCCTGG + Intergenic
1033265300 7:139880514-139880536 GCCCATCTGCTCCTTCACAGAGG + Intronic
1034543766 7:151776695-151776717 TGCCATCTGCGCCTTCCTCCAGG - Intronic
1035305318 7:157928140-157928162 CCTCATCTGCACCTTCCTTCTGG - Intronic
1035512599 8:204345-204367 GCCCTTTTGCTCCTTCCTTAAGG + Intergenic
1036116511 8:5966009-5966031 GACCATCTCCTCCTTGCAACTGG + Intergenic
1037579493 8:20236201-20236223 GCCCAGCTCCTCCTACCCACAGG - Intergenic
1037860225 8:22399597-22399619 GCACAGCTGCTCTTTCCTCCAGG - Intronic
1038012559 8:23486603-23486625 GCCAATTTCCTCATTCCTACTGG + Intergenic
1038247144 8:25869376-25869398 GCCCTGCTGCTCTTTCCTAAGGG + Intronic
1047717876 8:127612403-127612425 GCCCATCTTCCTCTTCCTATAGG - Intergenic
1051210057 9:14731870-14731892 CCCCAGCTCCTCCTTCCTGCTGG + Intergenic
1051875744 9:21791252-21791274 GCCCATCCCCTCCTTCCCCCCGG - Intergenic
1053173820 9:35908573-35908595 GCCCGTCGTCTCCTTCCTCCTGG + Intergenic
1055657082 9:78461657-78461679 GCTCATGTGCTCCTTCCACCAGG + Intergenic
1055709894 9:79049514-79049536 GCCCATCTGCATCTTCGTTCCGG + Intergenic
1057269937 9:93645025-93645047 GCCCCTCTGCTGCTTCCTCTGGG + Intronic
1059457101 9:114406544-114406566 CCCCATCGGCCCCTTCCCACGGG - Exonic
1060030242 9:120208552-120208574 GCCCAGGTGCTCATTTCTACTGG - Intergenic
1060340218 9:122768414-122768436 GGCCACCTGCTCCTTCCTCTGGG - Intergenic
1060405651 9:123371761-123371783 GCCCAGCTGCTCCTACCCTCTGG + Intronic
1060714370 9:125909137-125909159 GTCCATCTGCTCCTTCATCTTGG + Intronic
1061864948 9:133487394-133487416 GCTCATCTGCCCCTTCCTGCAGG - Intergenic
1062218187 9:135400276-135400298 GCTCATTTCCTCCTTCCTGCAGG + Intergenic
1062421562 9:136484835-136484857 CCCCATCTGCTTCTTCCCAGTGG + Exonic
1062723891 9:138060390-138060412 GCCCCTCTGCTGGTTTCTACTGG - Intronic
1062744484 9:138202641-138202663 GCCCACCTGCTCCTCCCTAATGG - Intergenic
1062749133 9:138238287-138238309 GCCCCTTTGCTCCTTCCTTAAGG - Intergenic
1203613459 Un_KI270749v1:29053-29075 ACCCATTTGCTTCTTCCTGCAGG - Intergenic
1185776218 X:2804884-2804906 GCCCAGCTGCTGCTTCCACCGGG - Intronic
1186166589 X:6832859-6832881 GCCCTTCTGCACATTCCTAATGG + Intergenic
1187982636 X:24774582-24774604 GCTCAACTGCTCCTTCCCAGGGG - Intronic
1188388525 X:29591495-29591517 CCCCCTCTGCTCCTCCCGACTGG - Intronic
1188494056 X:30765139-30765161 GCCCATCTTCTACTTCCCTCTGG - Intergenic
1190747450 X:53332935-53332957 GTCCATATCCTCCTTTCTACGGG - Intergenic
1192741069 X:73893076-73893098 CCACAGCTGCTCCTTCCCACAGG - Intergenic
1193533555 X:82686187-82686209 GGCCACCTGCTCCTTCCTCTGGG + Intergenic
1195383154 X:104289935-104289957 GCCTATCTGCTGCTTCCTCTGGG - Intergenic
1199476204 X:148248136-148248158 CCCCACATGCCCCTTCCTACAGG + Intergenic
1201293786 Y:12446825-12446847 GCCCAGCTGCTGCTTCCACCGGG + Intergenic
1202019984 Y:20454087-20454109 GCCCATCTGCTTCTTCCCTTAGG + Intergenic
1202369454 Y:24187097-24187119 GCCCATCTTCTGCTTCATCCAGG - Intergenic
1202501331 Y:25483020-25483042 GCCCATCTTCTGCTTCATCCAGG + Intergenic