ID: 1155264433

View in Genome Browser
Species Human (GRCh38)
Location 18:24077160-24077182
Sequence GCCCATCTGCTCCTTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155264428_1155264433 6 Left 1155264428 18:24077131-24077153 CCCTGCTTCACTCTGCCTCCAAG No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data
1155264427_1155264433 7 Left 1155264427 18:24077130-24077152 CCCCTGCTTCACTCTGCCTCCAA No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data
1155264430_1155264433 -9 Left 1155264430 18:24077146-24077168 CCTCCAAGCCGCTCGCCCATCTG No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data
1155264423_1155264433 26 Left 1155264423 18:24077111-24077133 CCCTTTTGTCCCGGTGTGTCCCC No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data
1155264426_1155264433 16 Left 1155264426 18:24077121-24077143 CCGGTGTGTCCCCTGCTTCACTC No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data
1155264429_1155264433 5 Left 1155264429 18:24077132-24077154 CCTGCTTCACTCTGCCTCCAAGC No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data
1155264425_1155264433 17 Left 1155264425 18:24077120-24077142 CCCGGTGTGTCCCCTGCTTCACT No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data
1155264424_1155264433 25 Left 1155264424 18:24077112-24077134 CCTTTTGTCCCGGTGTGTCCCCT No data
Right 1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155264433 Original CRISPR GCCCATCTGCTCCTTCCTAC TGG Intronic